بررسی تغییرات بیان ژن های دفاعی فنیل‌آلانین‌آمونیالیاز و پراکسیداز در برهمکنش با عصارۀ گیاه چریش در گیاه گوجه فرنگی آلوده به نماتد Meloidogyne javanica

نوع مقاله: علمی - پژوهشی

نویسندگان

1 فاارغ التحصیل دکتری بیماری شناسی گیاهی، دانشگاه آزاد اسلامی واحد علوم و تحقیقات، تهران، ایران

2 دانشیار گروه گیاهپزشکی، پردیس کشاورزی و منابع طبیعی، دانشگاه تهران

3 استادیار پژوهشکده بیوتکنولوژی کشاورزی، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، تهران

4 استادیار گروه بیماری شناسی گیاهی، دانشکده کشاورزی، دانشگاه آزاد اسلامی واحد علوم و تحقیقات

چکیده

هدف: هدف از انجام این پژوهش، بررسی تاثیر چند غلظت عصاره آبی میوه چریش بر روی میزان بیان ژن­های رمز کننده دو آنزیم فنیل­آلانین­آمونیالیاز و پراکسیداز در گیاه گوجه فرنگی (دو رقم متین و ارلی اوربانا) در برهم‫کنش با نماتد بیمارگر Meloidogynejavanica بود.
مواد و روش­ها: به‏این‏منظور، گیاه‫چه­های گوجه­فرنگی در مرحله 4 تا 6 برگی با غلظت­های مختلف (غلظت­های 25، 50، 75 و 100 درصد) عصاره تلقیح و سپس توسط عامل بیمارگر مایه­زنی شد. نمونه­برداری از این گیاهان در شش نقطه زمانی (0، 12، 24، 96، 192 و 288 ساعت) بعد از مایه زنی قارچ بیمارگر انجام شد. میزان بیان ژن­های رمزکننده این آنزیم­ها با روش  Real Time-PCRمورد بررسی قرار گرفت و گیاه مایه زنی شده با عصاره به‏عنوان شاهد در نظر گرفته شد.
نتایج: در هر دو رقم مورد بررسی، مقدار بیان ژن رمزکننده هر دو آنزیم در تیمار توام نماتد بیمارگر و عصاره آبی چریش از زمان‏های اولیه پس از مایه­زنی روند افزایشی داشت و دارای اختلاف معنی­دار با شاهد بود. در رقم متین افزایش بیان ژن با میزان و سرعت بیشتری در مقایسه با رقم ارلی اوربانا اتفاق افتاد به­­طوری­که بیان ژن‏های PAL و POX در این رقم به‏ترتیب به‏میزان 2/18 و 5/14 برابر شاهد در گیاه تیمار شده با عصاره و نماتد مشاهده شد. در رقم ارلی اوربانا نیز بیشترین میزان افزایش بیان ژن PAL در زمان 192 ساعت و به‏میزان 5/7 برابر، و در مورد ژن POX در زمان 96 ساعت و به‏میزان 9/3 برابر شاهد مشاهده شد. همچنین در آزمایش‏های گلخانه­ای شاخص‏های بیماریزایی نماتد کاهش چشمگیری را در مقایسه با رقم ارلی اوربانا نشان دادند.
نتیجهگیری: بر اساس نتایج این مطالعه برای‏این­که گیاه بتواند در برابر تهاجم بیمارگرها مصون بماند باید بیان ژن­های دفاعی در زمان‏های ابتدایی بعد از تلقیح بیمارگر افزایش پیدا کند. افزایش زود هنگام بیان ژن­ها در گیاهچه‏های تیمار شده با عصاره چریش پدیده­ای قابل توجیه در مکانسیم مقاومت گیاه در برابر عامل بیمارگر به‏نظر می­رسد.

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

گوجه­فرنگی از ﮔﯿﺎﻫﺎن ﻣﺘﺪاول در ﮐﺸﺖﻫﺎی ﮔﻠﺨﺎﻧـﻪای اﺳـﺖ که به لحاظ ارزش ﻏﺬاﯾﯽ و اﻗﺘﺼﺎدی، در ﺧﺎﻧﻮاده ﺑﺎدمجاﻧﯿﺎن ﺑﻌﺪ از ﺳـﯿﺐ زﻣﯿﻨـﯽ در رﺗﺒـﻪ دوم اﻫﻤﯿـﺖ ﻗـﺮار ﮔﺮﻓﺘﻪ اﺳﺖ. ﺑﺎ ﺗﻮﺟﻪ ﺑﻪﻣﺼﺮف ﺑﺎﻻی ﻣﯿـﻮه ﮔﻮﺟـﻪﻓﺮﻧﮕـﯽ ﻣــﯽﺗــﻮان آن را ﺑــﻪ‏ﻋﻨــﻮان ﯾــﮏ ﻣﺤﺼــﻮل اﺳــﺘﺮاﺗﮋﯾﮏ در ﮐﺸـﺎورزی ﻣـﺪرن ﺗﻠﻘـﯽ ﮐـﺮد. در ﺳﺎل زراﻋﯽ93-92 ﺳـﻄﺢ زﯾـﺮ ﮐﺸﺖ ﮔﻮﺟﻪ ﻓﺮﻧﮕﯽ در اﯾﺮان158223 ﻫﮑﺘﺎر، و ﻣﯿﺰان ﺗﻮﻟﯿـﺪ  آن 6243992 ﺗــﻦ ﺑــﻮده اﺳــﺖ (1).

در میان نماتد های انگل گیاهی، نماتدهای عامل ریشه گره­ایMeloidogyne spp. دارای اهمیت اقتصادی بیشتری هستند و محدود کنندۀ کیفیت و کمیت تولیدات کشاورزی می­باشند. محصولاتی مانند گوجه­فرنگی، سیب‫زمینی، چغندرقند و انواع کدو از مهم­ترین میزبان‌های این نماتد می‫باشند (2).

از میان گونه­های مختلف این نماتد، گونه M. jvanica chitwood  باعث کاهش میزان محصول گوجه­فرنگی به‏میزان 50 درصد می­شود. علاوه بر خسارت­های مستقیم، نماتد ریشه گره­ای به‏دلیل ﺗﺸﺪﻳﺪ ﭘﮋﻣﺮﺩﮔﻲ ﻭﺭﺗﻴـﺴﻠﻴﻮﻣﻲ ﻭ ﻓﻮﺯﺍﺭﻳـﻮﻣﻲ ﺩﺭ ﮔﻴﺎﻫـﺎﻥ ﺍﺯ ﺍﻫﻤﻴﺖ ﺧﺎﺻﻲﺑﺮﺧـﻮﺭﺩﺍﺭ ﺍﺳـﺖ (3).

کنترل نماتد مولد گره ریشه به دلیل دامنه وسیع میزبانی، دورۀ کوتاه چرخه زندگی، تولیدمثل زیاد و نیز انگل داخلی بودن آن دشوار می­باشد (4). از جمله روش­های مورد استفاده در کنترل نماتد ریشه گره­ای، استفاده از نماتدکش­ها، تیمار گرمایی قطعات گیاهی، ریشه­کنی میزبان، کنترل بیولوژیک و استفاده از ارقام مقاوم می­باشد. از جمله اثرات سوء نماتدکش­های شیمیایی، تاثیر منفی بر سلامت انسان، آلودگی محیط­زیست و ایجاد مقاومت در نماتدها می باشد. ­با پیشرفت فن­آوری،کشورهای پیشرفته توانسته­اند با به‏کارگیری روش­های طبیعی، ضمن جلوگیری از تخریب زمین­های کشاورزی، با اصلاح وتقویت این زمین­ها بازدهی و سودآوری کشاورزی را افزایش دهند (5). استفاده از گیاهان و فرآورده­های گیاهی از روش­های ﻧﻮﻳﻦ ﺑﺮﺍﻱ ﻛﻨﺘﺮﻝ ﻧماتدﻫﺎ ﻣـﻲ­ﺑﺎﺷﺪ. ﺍﻳﻦ ﺭﻭﺵ ﺍﺭﺯﺍﻥ، ﺑـﺎ ﻛﺎﺭﺑﺮﺩ ﺁﺳﺎﻥ، ﺑﺪﻭﻥ ﺧﻄﺮﺍﺕﺁﻟـﻮﺩﮔﻲ ﻣﺤـﻴﻂ­ﺯﻳـﺴﺖ ﻭ ﺑـﺎ ﺗﻮﺍﻧﺎﻳﻲ ﺗﺄﺛﻴﺮ ﻣﻔﻴﺪ ﺩﺭ ﺳﺎﺧﺘﺎﺭ ﻭ ﻣﻮﺍﺩ ﻣﻐﺬﻱ ﺧﺎﻙ ﻣـﻲ‏ﺑﺎﺷـﺪ (6).

استفاده از عصاره­های گیاهی به‏دلیل عوارض جانبی کمتر، عدم مقاومت بیمارگر، پایین بودن نسبی هزینه تولید آن‏ها، تجزیه شدن در خاک و عدم آلودگی زیست­محیطی می­تواند به‏عنوان جایگزین مناسب سموم شیمایی مطرح شود (7).

ﻛﺮﻳـﺴﺘﻮﺑﺎﻝ ﺁﻟﺠـﻮ ﻭ ﻫﻤﻜـﺎﺭﺍﻥ  فعالیت عصاره حاصل از 55 گیاه بومی از جمله گیاهان تیره Myrataceae را علیه لاروهای سن دو نماتد M.incognitaدر شرایط آزمایشگاه بررسی کردند. بر اساس نتایج، عصاره گیاه Eugenia winzerlingii ﺩﺭ ﺑﻴﻦ ﮔﻴﺎﻫـﺎﻥ ﻣـﻮﺭﺩ ﺁﺯﻣـﺎﻳﺶ، ﺑﻬﺘﺮﻳﻦ ﺍﺛﺮ ﺭﺍ ﺩﺭﻣـﺮﮒ ﻭ ﻣﻴـﺮ ﻻﺭﻭﻫـﺎ نشان داد (8). در گیاهان، ژن­های متعددی در پاسخ به بیمارگر فعال یا خاموش می­شوند و همچنین ممکن است بیان آن­ها افزایش یا کاهش پیدا کند. بررسی بیان متمایز ژن­ها یکی از روش­های مهم برای مشخص نمودن اساس زیستی سیستم­های بیولوژیک است (9).

میزان بیان ژن­های دفاعی گیاه به‏عنوان یک عامل مهم در پاسخ­های دفاعی SAR در گیاهان مختلف، علیه بسیاری از بیمارگرها می­باشد(10). تفاوت اصلی گیاه حساس و مقاوم در شناسایی به‏موقع بیمارگر مهاجم و فعال­سازی سریع و موثر مکانیسم­های دفاعی گیاه است (11).

با توجه به اهمیت محصول گوجه فرنگی در ایران و با در نظر گرفتن این موضوع که یکی از مهم­ترین عوامل بیماری­زای محدود کننده رشد آن در ایران نماتد بیمارگر M. javanica است، بررسی و مطالعۀ بیان ژن در زمان تنش این بیماری و به‏خصوص ژن­های دفاعی که نقش مهمی را در فرایند پاسخ به تنش در گیاه بازی می‏کنند، بسیار ضروری است. نتایج این تحقیقات اطلاعات مرتبط به سازوکار تحمل و مقاومت به این بیمارگر و همچنین سایر شرایط نامساعد زیستی را افزایش داده و تولید ارقام متحمل از طریق بیوتکنولوژی را هموارتر می‏نماید (11). در این مطالعه ابتدا تاثیر غلظت­های متفاوت عصاره میوه چریشبر بیماریزایی نماتد در شرایط گلخانه ارزیابی شد. سپس میزان تغییرات بیان دو ژن درگیر در سیستم دفاعی گیاه در برهمکنش با نماتد مولد گره ریشه و عصاره چریش، با روش کمی PCR زمان واقعی (Real Time-PCR)  در یک دوره زمانی 12روزه مورد بررسی قرار گرفت.

 

مواد و روش‌ها

تهیه گیاهچه­های گوجه­فرنگی: بذور ضدعفونی شده گوجه فرنگی رقم ارلی اوربانا وای و رقم متین به‏ترتیب به‏عنوان ارقام حساس و مقاوم، در گلدان­های استریل حاوی خاک استریل شامل خاک، ماسه، کود برگ (1:1:2) و مقداری پیت و پرلیت کشت شد و در شرایط مساعد گلخانه (شرایط 16 ساعت نور و 8 ساعت تاریکی، دمای 28-26 درجه سانتی­گراد) پرورش داده شد. گیاه‫چه­ها در مرحله 4 تا 6 برگی، جهت انجام آزمایشات مورد استفاده قرار گرفتند.

عامل بیمارگر: ریشه­های آلوده به نماتد طی نمونه برداری از مزارع و گلخانه­های کشت گوجه فرنگی استان البرز، جمع آوری شد. تکثیر نماتد به‏روش Single egg mass روی گیاهچه­های رقم ارلی اوربانا وای انجام و شناسایی مطابق کلید ایسن باخ صورت گرفت (12). جداسازی لارو نماتد از خاک به‏روش سانتریفوژ و جداسازی ماده‏های بالغ به‫صورت مستقیم از ریشه آلوده انجام شد. پس از شناسایی گونه و چندین دوره تکثیر متوالی، جمعیت خالص گونه M. javanica ایجاد شد. در این تحقیق از لارو سن دوم نماتد استفاده شد (13).

تهیه عصاره آبی : در این تحقیق از میوه چریش جهت تهیه عصاره آبی استفاده شد. میوه‏های گیاه چریش در سایه کاملا خشک و سپس آسیاب شدند. مقدار 25 گرم از پودر تهیه شده در 100 میلی‫لیتر آب مقطر خیسانده و به‏مدت 24 ساعت در rpm 100 روی شیکر تکان داده شد و جهت جدا کردن بقایای گیاهی از پارچه ململ عبورداده شد. سپس به‏مدت30 دقیقه در 12000 دور سانتریفوژ شد. عصاره حاصل (25 گرم گیاه در 100 میلی‏لیتر آب مقطر) به‏عنوان محلول پایه 100 درصد در نظر گرفته شد و با رقیق کردن با آب مقطر غلظت‏های 25، 50 و 75 و 100درصد تهیه شد (14).

بررسی اثر عصاره گیاهی بر فاکتورهای بیماریزایی نماتد مولد غده ریشه در شرایط گلخانه: در این بررسی از غلظت‏های 25، 50، 75 و 100 درصد عصاره آبی میوه چریش جهت تیمار گیاهچه­های گوجه فرنگی استفاده شد.

گیاه‫چه­های گوجه‫فرنگی در مرحله 4 تا 6 برگی به گلدان‏های یک کیلوگرمی منتقل شدند و یک روز پس از انتقال ابتدا هر گیاه‫چه توسط مقدار 30 میلی­لیتر از هر یک از غلظت‏های مختلف آبیاری شد و بعد از گذشت 24 ساعت هر گیاه‫چه توسط تعداد 2000 لارو سن دوم تازه تفریخ شده نماتد M. javanica مایه­زنی شد. گیاه‫چه‏های مایه زنی شده با آب مقطر استریل به­عنوان شاهد در نظر گرفته شد. برای هر تیمار سه تکرار در نظر گرفته شد.

پس از گذشت 45 روز ﺷﺎﺧﺺ رﺷﺪی  بوته­ها (وزن تر و خشک اندام‫های هوایی) با استفاده از ﺗﺮازوی دﻳﺠﻴﺘﺎل ﺑﺎ دﻗﺖ 001/0 ﮔﺮم اندازه گیری ﺷﺪ. ﻭﺯﻥ ﺧﺸﻚ ﺑﺎ ﻗﺮﺍﺭﺩﺍﺩﻥ ﺭﻳﺸﻪ ﻭ ﺳﺎﻗﻪﺩﺭ ﺁﻭﻥ ﺑﻪ‏ﻣـﺪﺕ ﭘﻨﺞ ﺭﻭﺯ ﺩﺭ ﺩﻣﺎﻱ ۵۰ درجه سانتی‫گراد ﺍﻧﺪﺍﺯﻩ­ﮔﻴﺮﻱ ﺷﺪ. شاخص گال بر اساس سیستم درجه بندی صفر تا پنج محاسبه شد (2).

کشت ارقام گوجه فرنگی جهت انجام بررسی‏های آزمایشگاهی و بیان ژن: به‏منظور بررسی اثر عصاره میوه چریش بر بیان ژن­های دفاعی گیاه، دو رقم ارلی اوربانا وای (رقم حساس) و متین (رقم مقاوم) کشت شدند. بذرهای ضدعفونی شده گوجه فرنگی مطابق شرایط بالا کشت شدند. این آزمایش در دو سطح قبل از حمله نماتد و بعد از حمله نماتد و با سه تکرار انجام شد (15).

در آزمایش قبل از حمله بیمارگر، ابتدا گیاهچه­های گوجه فرنگی توسط مقدار 30 میلی­لیتر ازعصاره میوه چریش با غلظت 75 درصد آبیاری شد و 24 ساعت بعد هر گیاه‫چه توسط تعداد2000 لارو نماتد مایه زنی شد.

در آزمایش پس از حمله بیمارگر: ابتدا هر گیاه‫چه توسط تعداد2000 لارو نماتد مایه­زنی شد و 24 ساعت بعد توسط مقدار 30 میلی­لیتر از عصاره میوه چریش با غلظت 75 درصد آبیاری شد.

 نمونه­برداری جهت انجام آزمایش­های ارزیابی بیان ژن در زمان‏های 0، 12، 24 ساعت و روزهای چهارم، هشتم و دوازدهم بعد از مایه­زنی بیمارگر و عصاره انجام گرفت و بلافاصله گیاه‫چه­ها در محل نمونه­برداری به ظرف نیتروژن مایع منتقل وسپس در فریزر 70- درجه سانتی­گراد آزمایشگاه ذخیره شدند. در مطالعات مربوط به اندازه­گیری بیان ژن از دو رقم حساس ارلی اوربانا و مقاوم متین و غلظت 75 درصد عصاره آبی گیاه چریش استفاده شد که این نمونه­برداری‏ها در پنج نقطه زمانی انجام گرفت. در محاسبات گیاه مایه زنی شده با عصاره تنها به‏عنوان شاهد در نظر گرفته شد.

گیاه شاهد سالم: عدم کاربرد عصاره و نماتد

شاهد: گیاه مایه زنی شده با عصاره، و عدم مایه زنی با نماتد

گیاهان مایه زنی شده با عصاره و عدم مایه زنی با نماتد گیاه: گیاه مایه زنی شده با عصاره و با نماتد (تیمار با عصاره 24 ساعت قبل از مایه­زنی با نماتد و تیمار با عصاره 24 ساعت بعد از مایه­زنی با نماتد)

طراحی آغازگر جهت تکثیر ژن­های منتخب: در این بررسی میزان بیان ژن‫های فنیل­آلانین­آمونیالیاز و پراکسیداز با استفاده از روش Real time-PCR انجام شد.

آغازگرهای اختصاصی برای هر ژن بر اساس بررسی منابع علمی و مقالات به‏دست آمدند. نکات استاندارد  درطراحی آغازگر از جمله طول آغازگر، دمای اتصال، G+C %،  ایجاد دایمر ، تولید لوپ یا حلقه در درون هر یک از آغازگرها و DG مناسب، با استفاده از نرم افزار Oligo (National Biosciences Inc., Ver.6) بررسی شد (جدول 1). ساخت آغازگر توسط شرکت ژن فن آوران انجام شد.

آغازگرها به‏طور اختصاصی تنها به ژن مورد نظر خود متصل می­شوند. پس از ساخت آغازگرهای اختصاصی برای هر ژن شرایط PCR برای هر یک از جفت آغازگرهای اختصاصی بهینه گشت. برای انجام PCR از الگوی cDNA استفاده شد. بدین ترتیب که ابتدا RNA از گیاه استخراج گردید و سپس با استفاده از آنزیم رونویسی معکوس بهcDNA  تبدیل گشت تا به‏عنوان الگو در تهیه محصولPCR  هر ژن به‫کار رود.

 

 

جدول 1: توالی آغازگرهای مورد استفاده جهت تکثیر ژن‏ها

ردیف

اسامی ژن­ها

توالی پرایمرها

اندازه محصول

منبع

1

فنیل آلانین آمونیالیاز

 

F

 

5 ACGGGTTGCCATCTAATCTG3

197

(Aimé et al., 2013)

 

R

 5 AGCTCTTTTCCTGGCTGAAA3

2

پراکسیداز

F

 

5TGCAGCATTGACAACACGTA3

112

(el-Gaied et al., 2013)

R

5TCTTCCCATTTTCTCCATCG3

 

 

استخراج RNA و ساخت cDNA: استخراج  RNAاز بافت ریشه گوجه فرنگی با استفاده از کیت  RNXplus (سیناژن، ایران) مطابق دستورالعمل انجام گرفت. برای ساختcDNA  از کیت ساخت cDNA (ThermoScientific، آمریکا) بر اساس دستورالعمل شرکت سازنده استفاده شد (Gholamnezhad et al., 2016).

ژن‫های TeF1α و اکتین به‏عنوان ژن خانه دار (House keeping gene) انتخاب شد. از RNA کل استخراج شده به‏عنوان الگو برای ساخت cDNA استفاده شد. پس از یکسان­سازی غلظت RNA های مختلف، واکنش ساخت cDNA بر طبق دستورالعمل کیت YTA SYBR Green qPCR Master Mix (2x) (یکتا تجهیز آزما، ایران) انجام گرفت. برای تعیین میزان تغییرات بیان ژن­ها در طی نقاط زمانی از روش Livak استفاده شد. در این روش فرض بر این است که بازده نمونه و کنترل داخلی برابر و 100 درصد است و از فرمول CT∆∆-2 به‫منظور بررسی تغییر بیان ژن استفاده شد (16).

میزان بیان ژن‏های دفاعی منتخب بر اساس ژن TEF-1α (ژن خانه­دار) با بیان ثابت نرمال شده، سپس میزان تغییرات بیان ژن در همه تیمارها نسبت به شاهد سنجیده شد.

نتایج به‏دست آمده از Real time -PCR با استفاده از آزمون چند دامنه دانکن در سطح احتمال پنج درصد و با استفاده از نرم­افزار SAS انجام گرفت.

تیمارهای مورد استفاده در این آزمایش به‫صورت زیر می‏باشد:

گیاهچه‏های گوجه فرنگی سالم: عدم کاربرد عصاره و  نماتد

گیاهچه گوجه فرنگی: مایه‫زنی شده با نماتد و عصاره  (عصاره 24 ساعت پس از مایه‫زنی نماتد استفاده شده است).

گیاه‫چه گوجه فرنگی مایه‫زنی شده با  عصاره و  نماتد. (عصاره24 ساعت قبل از مایه‫زنی نماتد استفاده شده است).

گیاه‫چه‏های مایه زنی شده با عصاره و عدم کاربرد نماتد (شاهد)

گیاه‫چه گوجه فرنگی: نماتد+، عصاره.

گیاه‫چه‏ها با عصاره آبی 75درصد میوه چریش مایه زنی شده است.

در این تحقیق از روش SYBR Green استفاده شد. این روش روشی کم هزینه، ودر دسترس است و می‏تواند با صحت بالا جهت بررسی نتایج مورد استفاده قرار گیرد.

 

آنالیز آماری

آزمون بررسی اثر غلظت­های مختلف عصاره  بر مرگ و میر لاروها به‏صورت آزمایش فاکتوریل در قالب طرح کاملا تصادفی انجام شد که شامل فاکتورهای A، غلظت و B، زمان بود. سایر آزمایش‏ها در قالب طرح کاملا تصادفی انجام شد. تجزیه و تحلیل آماری داده­های به­دست آمده با استفاده از نرم افزار SAS انجام شد و میانگین­ها با آزمون چند دامنه دانکن (05/0p≤) مورد مقایسه قرار گرفت.

 

نتایج

اثر عصاره‏های گیاهی بر فاکتور بیماریزایی نماتد (شاخص گال) مولد غده ریشه و وزن خشک و تر ریشه در شرایط گلخانه

در این بررسی پس از گذشت 45 روز اثر سطوح مختلف عصاره چریش بر فاکتور شاخص گال مورد ارزیابی قرار گرفت. همچنین وزن تر و خشک ریشه و اندام‏های هوایی گیاه نیز اندازه­گیری شد.

ارزیابی شاخص گال

تجزیه واریانس داده‏های حاصل از بررسی شاخص گال نشان داد (جدول 2) که بین تاثیر غلظت­های مختلف عصاره گیاه چریش بر روی این فاکتور 45 روز بعد از آلوده سازی با نماتد، در مورد هر دو رقم متین و ارلی­اوربانا، اختلاف معنی­دار در سطح احتمال یک درصد (01/0 p≤) وجود دارد.

 

 

جدول 2: تجزیه واریانس اثر تیمارهای مختلف بر شاخص گال نماتد  M. javanica در رقم متین در شرایط گلخانه

 

منابع تغییرات (S.O.V)

درجه آزادی (df)

میانگین مربعات (MS)

F

رقم متین

ارلی اوربانا

رقم متین

ارلی اوربانا

تیمارهای مختلف (شامل عصاره­های گیاهی و سطوح غلظت)

4

78/0

98/0

**  09/7

**12/6

خطای آزمایش

10

11/0

16/0

 

کل

15

 

 

               

 

** به احتمال 99/99 درصد (01/0 p ≤) اختلاف معنی دار است، 12/9 % C.V= (رقم متین)،  37/7 % C.V= (رقم ارلی­اوربانا)

 

 

در مورد رقم ارلی اوربانا بر اساس نمودار1، الف کمترین مقدار عددی شاخص گال مربوط به تیمار 100 درصد عصاره چریش با مقدار عددی 33/1 بود، که این مقدار با غلظت 75درصد عصاره این گیاه دارای اختلاف معنی­دار نبود. تمامی تیمارها سبب کاهش معنی‏دار شاخص گال در مقایسه با شاهد به میزان 33/4 شدند. در مورد رقم متین همان­طور که نتایج مقایسه میانگین انجام شده در نمودار 1،ب نشان می‏دهد روند مانند رقمارلی­اوربانا بود، اما شاخص گال در شاهد و همچنین بقیه تیمار ها کمتر از رقم ارلی­اوربانا بود. بیشترین مقدار عددی شاخص گال (2) مربوط به غلظت 25 درصد عصاره بود که این مقدار  نیز دارای اختلاف معنی­دار با شاهد (66/2) بود. در این رقم تمامی غلظت‏ها دارای اختلاف معنی‏دار با شاهد بودند، اما دو سطح غلظتی 75 و100 درصد عصاره اختلاف معنی‏دار نداشتند.

 

 

 

 

 

نمودار 1: مقایسه میانگین اثر تیمارهای 25، 50، 75 و 100 درصد عصاره چریش بر شاخص گال نماتد M. javanica. رقم ارلی­اوربانا (الف)و رقم متین (ب) در شرایط گلخانه. هر عدد میانگین سه تکرار است. میانگین­هایی که با یکدیگر اختلاف دارند با حروف مختلف مشخص شده‏اند. تفاوت‏ها با آزمون دانکن (01/0 p ≤) ارائه شده‏اند.

 

وزن خشک ریشه

بر اساس نمودار  2 الف، از نظر وزن خشک ریشه در رقم ارلی اوربانا، بالاترین مقدار مربوط به تیمار شاهد سالم، با مقدار عددی 30/2، بود که در گروه آماری a قرار گرفت و بعد از آن تیمارهای شاهد آلوده، 25، 50، 75 و 100 درصد، بالاترین مقادیر وزن خشک ریشه را داشتند. همان‏طورکه نمودار نشان می دهد بین تیمار 100 درصد و تیمار 25 درصد عصاره چریش از نظر تاثیر بر وزن خشک اختلاف معنی­داری وجود دارد. تیمار 100 عصاره چریش همچنین با شاهد آلوده و سالم نیز دارای اختلاف معنی­دار می­باشد، بین سه تیمار (25 درصد، 50 درصد، 75 درصد) اختلاف معنی­دار وجود نداشت و تیمار 100 درصد نیز با تیمار75 درصد و 50 درصد فاقد اختلاف معنی­دار بود.

بر اساس نمودار 2 ب، از نظر وزن خشک ریشه در رقم متین مقدار وزن خشک ریشه مربوط به تیمار شاهد سالم،

با مقدار عددی 1/3، بود و بعد از آن تیمارهای شاهد آلوده، 25 درصد و در مرتبه های بعدی تیمارهای 50، 75 و 100 درصد، بالاترین مقادیر وزن خشک ریشه را داشتند. همان‏طورکه نمودار نشان می‏دهد بین تیمار 100 درصد و سایر تیمارها از نظر تاثیر بر وزن خشک، در رقم متین، اختلاف معنی­داری وجود ندارد. اما تیمار 100 درصد عصاره چریش دارای اختلاف معنی­دار با شاهد آلوده و سالم می­باشد.

 

 

 

نمودار 2: مقایسه میانگین اثر غلظت‏های 25، 50، 75، 100 درصد عصاره آبی چریش بر وزن خشک ریشه رقم ارلی ­اوربانا (الف) و متین (ب) در شرایط گلخانه. هر عدد میانگین سه تکرار است. میانگین­هایی که با یکدیگر اختلاف دارند با حروف مختلف، مشخص شده‏اند. تفاوت‏ها  با آزمون دانکن (01/0 p≤) ارائه شده‏اند.

 

 

 

 

وزن تر ریشه

شاهد آلوده در رقم ارلی ­اوربانا دارای بیشترین وزن تر با مقدار 10 گرم بود، که این میزان یا سایر تیمارها دارای اختلاف معنی­دار بود. بعد از شاهد آلوده به‏ترتیب بیشترین مقادیر وزن تر ریشه مربوط به تیمارهای 25، 50، 100 و 75 درصد عصاره گیاهی چریش بود. در بین تیمارها فقط تیمار 25 درصد عصاره چریش با دوتیمار 75 و 100 درصد عصاره چریش دارای اختلاف معنی­دار بود (نمودار 3 الف).

بر اساس نمودار 3 ب، از نظر وزن تر ریشه در رقم ارلی

 

 

 

 

 

 

متین بیشترین مقدار این صفت مربوط به تیمار شاهد آلوده، با مقدار عددی 13 گرم بود و بعد از آن تیمارهای شاهد آلوده، 25 درصد چریش و در مرتبه‏های بعدی تیمارهای 50، 75 و 100 درصد، بالاترین مقادیر وزن تر ریشه را، از نظر عددی، نشان دادند. شاهد آلوده با شاهد سالم دارای اختلاف معنی‏دار نبود، اما دارای اختلاف معنی‏دار با سایر تیمارها بود. تیمار 25 درصد عصاره چریش در بین غلظت‏های مختلف این عصاره تنها با تیمار 100 درصد عصاره چریش دارای اختلاف معنی‏دار بود (نمودار 3 ب).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار 3: مقایسه میانگین اثر غلظت‏های 25، 50، 75، 100 درصد عصاره آبی چریش بر وزن خشک ریشه رقم ارلی ­اوربانا (الف) و متین (ب) در شرایط گلخانه. هر عدد میانگین سه تکرار است. میانگین‏هایی که با یکدیگر اختلاف دارند با حروف مختلف، مشخص شده‏اند. تفاوت‏ها  با آزمون دانکن(01/0p≤)  ارائه شده‏اند.

 

 

 

بررسی بیان ژن‏ها در برهمکنش گیاه گوجه­فرنگی با عصاره­ آبی 75درصد میوه چریش و بیمارگر M. javanica

آنالیز و مقایسه الگوی بیان ژن‏های پاسخ دهنده به نماتد بیمارگر هم در سطح ترانسکریپتئومیکس و هم در سطح پروتئومیکس می‏تواند اطلاعات ارزشمندی برای برنامه‏های اصلاحی در اختیار محققین قرار بدهد. هدف از انجام این تحقیق شناسایی ژن‏های درگیر در فرایند دفاعی در گیاه گوجه فرنگی (رقم مقاوم متین و رقم حساس ارلی­اوربانا) در برهم‫کنش با نماتد بیمارگر  M. Javanicaو عصاره چریش است تا در مطالعات آینده با بررسی بیان ژن‏های القا شونده با تنش این بیمارگر و نیز عصاره‏های گیاهی پایه‏های فیزیولوژیکی واکنش به این تنش شناخته شود.

الگوی بیانی دو ژن فنیل­آلانین­آمونیالیاز با استفاده از روش کمی PCR زمان واقعی، بررسی شد. در این تحقیق برای بررسی میزان بیان ژن‏ها از روش کمیت سنجی نسبی استفاده شد. دو ژن مورد مطالعه شامل ژن‏های رمز کننده پراکسیدار و فنیل آلانین آمونیالیاز بودند. نتایج حاصل از بررسی بیان این ژن‏ها در نقاط زمانی مختلف نشان داد که این ژن‏ها در زمان‏های مختلف و همچنین تحت تیمارهای مختلف تغییرات بیان نشان دادند. پس از تجزیه واریانس برای هر ژن، میانگین مربوط به هر ژن با استفاده از روش دانکن مورد مقایسه قرار گرفت. نتایج حاصل از مقایسه میانگین‏ها به‏صورت نمودار بیان شده است.

فنیل­آلانین­آمونیالیاز (PAL)

بر اساس نمودار 3، الف میزان بیان ژن رمز کننده فنیل‫آلانین­آمونیالیاز در رقم متین در دو زمان اول در تمام تیمارها نسبت به شاهد تغییرات زیادی نشان نداد. در گیاهان تیمار شده با نماتد از زمان 24 ساعت تا زمان 192 ساعت (روز هشتم) بیان این ژن روند افزایشی داشت و در بالاترین میزان خود 9/9 برابر شاهد بیان شد نسبت به شاهد مایه زنی شده با عصاره افزایش بیان قابل ملاحظه‏ای نشان داد و سپس در روز دوازدهم کاهش بیان داشت. میزان بیان این ژن در مورد تیمار نماتد و عصاره در روز چهارم به بالاترین میزان خود رسید و پس از آن بیان ژن کاهش یافت. در تیمار عصاره و نماتد درچهارمین روز نمونه­برداری به بیشترین مقدار خود رسید و با وجود کاهش بیان در روزهای بعد، در روز هشتم نمونه برداری با اختلاف معنی دار بیش از سایر تیمارها در مقایسه با شاهد بیان شد. در این روز میزان بیان ژن رمز کننده آنزیم فنیل آلانین آمونیالیاز به 2/18 برابر شاهد رسید.

بر اساس نمودار 3، ب میزان بیان ژن رمز کننده فنیل‫آلانین­ آمونیالیاز در رقم حساس ارلی­اوربانا در طول 12 بعد از اولین نمونه­برداری در هر سه تیمار دارای تغییرات ناچیزی بود، از زمان نمونه برداری سوم (24 ساعت) افزایش بیان در هر سه تیمار نسبت به ساعات قبل افزایش یافت. در گیاه تیمار شده با نماتد، میزان بیان ژن فنیل­آلانین ­آمونیالیاز در روز چهارم به بالاترین مقدار خود رسید و در این زمان با اختلاف معنی‫دار، بیش از میزان بیان در دو تیمار دیگر بود. در این نقطه زمانی بیان ژن در تیمار مذکور با بیش از چهار برابر بیان در شاهد (گیاه مایه زنی شده با عصاره چریش) رسید. در روزهای هشتم و دوازدهم با وجود کاهش بیان، مقدار بیان این ژن ثابت بود. در دو تیمار نماتد و عصاره، 24 ساعت قبل و 24 ساعت بعد از مایه زنی نماتد، بیشترین میزان بیان در روز هشتم نمونه برداری و بدون اختلاف معنی‏دار با یکدیگر(تقریبا 5/7 برابر شاهد) مشاهده شد. مقدار بیان این ژن در همه تیمارها به‏مقدار چشمگیری کمتر از رقم مقاوم متین بود. میزان بیان ژن فنیل ­آلانین­ آمونیالیاز در هر دو رقم حساس و مقاوم در دو زمان ابتدایی نمونه برداری تغییرات بسیار کمی نسبت به شاهد داشت. اما در رقم مقاوم از زمان سوم میزان بیان ژن آهنگ تندتری به خود گرفت و میزان بیان در مقایسه با رقم حساس حتی در روز پایانی نمونه برداری قابل ملاحظه است.

 

 

 

 

 

 

نمودار 4: الگوی بیان ژن رمزکننده آنزیم فنیل­ آلانین ­آمونیالیاز در رقم­های محتمل متین (الف) و حساس ارلی اوربانا (ب) تحت تیمارهای مختلف در نقاط زمانی متفاوت. نماتد به ‏تنهایی، نماتد+ عصاره پس از 24ساعت، عصاره+ نماتد پس از 24 ساعت، گیاه مایه زنی شده با آب مقطر. بیان همه ژن­ها نسبت به شاهد (تیمار عصاره چریش تنها) سنجیده شد.

 

 

پراکسیداز (POX)

همانطور که نمودار 5، الف نشان می­دهد در رقم مقاوم متین، میزان بیان ژن رمز کننده پراکسیداز در طول 96 ساعت (چهار روز) پس از اولین نمونه برداری در هر سه تیمار روند افزایشی داشته است، و پس از طی این مدت در گیاهان مایه زنی شده با عصاره به بیشترین مقدار خود در بین زمان­های نمونه برداری رسیده است و سپس رو به کاهش گذاشته و این روند کاهشی تا روز دوزادهم نمونه برداری ادامه یافته است. در این روز بیشترین بیان مربوط به تیمار نماتد و عصاره به میزان 5/14 برابر شاهد بود. در تیمار گیاه مایه زنی شده با نماتد، بیشترین بیان (7/10 برابر شاهد) در روز هشتم نمونه‏ برداری اتفاق افتاد که با مقدار مربوط به تیمار نماتد و عصاره (24 ساعت پس از مایه زنی با نماتد) در این روز اختلاف معنی‏دار نداشت. میزان بیان این ژن در مورد تیمار نماتد تنها در همه مقاطع زمانی نمونه برداری بیشتر از تیمار استفاده از عصاره به تنهایی بود.

بر اساس نمودار 4، ب میزان بیان ژن رمز کننده پراکسیداز در رقم حساس ارلی­اوربانا در طول 24 ساعت بعد از اولین نمونه برداری در هر سه تیمار دارای نوسان در تغییر بیان ژن بود، ولی از این زمان به بعد دارای روند افزایشی بود و این روند تا هشت روز (292 ساعت) بعد از اولین نمونه برداری ادامه داشت و در این روز در تیمار عصاره و نماتد بیشترین میزان بیان ژن (9/3 برابر شاهد) ثبت شد و این مقدار دارای اختلاف معنی دار با سایر تیمارها در این زمان بود. میزان بیان ژن در مورد تیمار نماتد تنها 96 ساعت بعد از اولین نمونه برداری میزان بیان ژن به بیشترین مقدار خود رسید سپس در مقطع زمانی بعد کاهش (در روز هشتم) و دوباره افزایش (در روز دوازدهم) یافت.

 

 

 

 

 

 

نمودار 5: الگوی بیان ژن رمزکننده آنزیم پراکسیداز در رقم متحمل متین (الف) و حساس ارلی اوربانا (ب) تحت تیمارهای مختلف در نقاط زمانی متفاوت. نماتد به تنهایی، نماتد+ عصاره پس از24ساعت، عصاره+ نماتد پس از 24 ساعت، گیاه مایه زنی شده با آب مقطر. بیان همه ژن­ها نسبت به شاهد (تیمار عصاره چریش تنها) سنجیده شد.

 

 

بحث

نماتدهای ریشه گره­ای با ایجاد تغییرات ساختمانی، فیزیولوژیک و بیوشیمیایی موجب اختلال در سیستم ریشه و کاهش جذب آب و املاح و در نتیجه کاهش رشد اندام­های گیاه خواهند شد. پیامد این تغییرات عدم توازن میان میزان جذب آب و املاح و میزان نیاز گیاه جهت رشد ریشه و بخش هوایی خواهد بود. ﺑﻨﺎﺑﺮاﯾﻦ ﻃﻮل رﯾﺸﻪﻫﺎی آﻟﻮده ﺑﻪ ﻧﻤﺎﺗﺪ ﻧﺴﺒﺖ ﺑﻪ رﯾﺸﻪﻫﺎی ﺳﺎﻟﻢ ﮐﻮﺗﺎهﺗﺮ اﺳﺖ. همچنین ﮐﺎﻫﺶ رﺷﺪ رﯾﺸﻪ را ﻣﯽﺗﻮان ﺑﻪ اﺧﺘﻼﻻت اﯾﺠﺎد ﺷﺪه در ﻧﻮک رﯾﺸﻪ ﻧﺴﺒﺖ داد. ﺑﻪ ‏اﯾﻦ‏ﺗﺮﺗﯿﺐﮐﻪ ﻧﻤﺎﺗﺪ رﯾﺸﻪﮔﺮﻫﯽ ﺑﺎ ﺣﻤﻠﻪ ﺑﻪ ﻧﻮک رﯾﺸﻪ ﺑﺎﻋﺚ ﺗﻮﻗﻒ رﺷﺪ ﻃﻮﻟﯽ در ﻗﺴﻤﺖﻫﺎی ﻣﻮرد ﺣﻤﻠﻪﮔﺮدﯾﺪه و ﮔﯿﺎه را ﺑﻪ ﺗﻮﻟﯿﺪ رﯾﺸﻪﻫﺎی ﻓﺮﻋﯽ ﺗﺤﺮﯾﮏ ﻣﯽﮐﻨﺪ. ﺑﻪ‏دﻟﯿﻞ ﮐﺎﻫﺶ ﻃﻮل رﯾﺸﻪ ﺟﺬب ﻣﻮاد ﻏﺬاﯾﯽ ﻧﯿﺰ ﮐﻤﺘﺮ ﻣﯽﺷﻮد (17).

با توجه به‏موارد فوق الذکر در گیاهان آلوده به نماتد قاعدتا افزایش وزن ریشه و کاهش رشد گیاه و در نتیجه کاهش وزن اندام‏های هوایی قابل پیش­بینی است. البته باید توجه داشت که عکس العمل گیاهان و ارقام مختلف تحت شرایط مختلف یکسان نیست وهمیشه نمی­توان انتظار نتیجه یکسان در گیاهان متفاوت را داشت. نتایج تحقیق انجام شده توسط مختاری و اولیا (18) نشان داد که ﮔﯿﺎﻫﺎن گوجه فرنگی دارای ﺗﯿﻤﺎر ﻧﻤﺎﺗﺪ و ﺟﺪاﯾﻪﻫﺎی ﻗﺎرچ Pochonia chlamydosporia var. chlamydosporia ﺷﻤﺎره 504، 1131و ﺟﺪاﯾﻪ ﻫﻤﺪان ﺗﻘﺮیبا ﻣﯿﺰان رﺷﺪ ﯾﮑﺴﺎﻧﯽ را ﻧﺸﺎن دادند و از ﺑﯿﻦ اﯾﻦ ﭼﻬﺎر ﺟﺪاﯾﻪ، ﺟﺪاﯾﻪی ﺷﻤﺎره 676 ﻋﻤﻠﮑﺮد ﮐﻤﺘﺮی داﺷﺖ. ریشۀ ﮔﯿﺎﻫﺎن آﻟﻮده ﺑﻪ ﻧﻤﺎﺗﺪ از وزن ﺑﯿﺸﺘﺮی ﺑﺮﺧﻮردار ﺑﻮدﻧﺪ ﮐﻪ در اﯾﻦ ﻣﻮرد ﺑﻌﺪ از ﺗﯿﻤﺎر ﻧﻤﺎﺗﺪﺗﻨﻬﺎ، ﺗﯿﻤﺎر ﺟﺪایه ﺷﻤﺎره‏ی676 ﺑﯿﺸﺘﺮﯾﻦ وزن رﯾﺸﻪ را ﻧﺸﺎن داد. وزن ﺗﺮ و ﻃﻮل ﺷﺎﺧﺴﺎره ﺑﻪ‏دﻟﯿﻞ ﮐﺎﻫﺶ ﺟﺬب ﻣﻮاد ﻏﺬاﯾﯽ و ﮐﺎﻫﺶ ﻣﯿﺎﻧﮕﺮهﻫﺎ در ﺗﯿﻤﺎرﻫﺎی آﻟﻮده ﮐﺎﻫﺶ ﯾﺎﻓﺖ.

بر اساس نتایج بررسی وزن تر و خشک ریشه در ارقام متین و ارلی اوربانا در یک نگاه کلی رقم متین بوته­های قوی­تر و دارای وزن بیشتری را در مدت زمان یکسان، نسبت به‏رقم ارلی اوربانا به‏دست می­دهد.

در رقم ارلی اوربانا وزن تر ریشه شاهد آلوده به نماتد افزایش معنی­داری نسبت به شاهد غیر آلوده نشان داد. افزایش وزن ریشه‏های آلوده نسبت به ریشه‏های سالم احتمالا در اثر هیپرتروفیو هیپرپلازی سلول‏ها و همچنین افزایش ریشه­های فرعی به‏عنوان واکنش میزبان به ‏نماتد می‏باشد.

ﻧﺘﺎﯾﺞ ﻣﻄﺎﻟﻌﺎت ﻣﺘﻌﺪد ﻧﺸﺎن می­دﻫﺪ ﺷﺪت اﺛﺮ ﺑﺎزدارﻧﺪﮔﯽ ﻣﻮاد ﺷﯿﻤﯿﺎﯾﯽ ﺑﺮ روی رﺷﺪ ﮔﯿﺎه ﻫﺪف ﺑﺴﺘﻪ ﺑﻪ ﻧﻮع ﮔﯿﺎه ﻣﺘﻔﺎوت ﻣﯽﺑﺎﺷﺪ. ﻣﻮاد ﺑﺎزدارﻧﺪه­ای ﮐﻪ در ﻏﻠﻈﺖ ﻣﺸﺨﺺ ﻣﻨﺠﺮ ﺑﻪ ﮐﺎﻫﺶ رﺷﺪ ﯾﮏ ﮔﯿﺎه ﻣﯽ‫شوند در ﻫﻤﺎن ﻏﻠﻈﺖ ﻣﻤﮑﻦ اﺳﺖ ﻣﻨﺠﺮ ﺑﻪ اﺛﺮات ﺑﺎزدارﻧﺪﮔﯽ ﮐﻤﺘﺮ ﯾﺎ توقف رشد در گیاه دیگر ﺷﻮﻧﺪ (19).

ﺣﺴﺎﺳﯿﺖ ﻣﺘﻔﺎوت ﮔﻮﻧﻪﻫﺎی ﻣﺨﺘﻠﻒ ﮔﯿﺎﻫﯽ ﺑﻪﻣﻮاد ﺑﺎزدارﻧﺪه رﺷﺪ ﻣﯽﺗﻮاﻧﺪ ﺑﻪ‏دﻟﯿﻞ ﺧﺼﻮﺻﯿﺎت ﻓﯿﺰﯾﻮﻟﻮژﯾﮑﯽ و ﺑﯿﻮﺷﯿﻤﯿﺎﯾﯽ ﻣﺘﻔﺎوت ﮔﻮﻧﻪﻫﺎ باشد (20). اﺛﺮ ﺑﺎزدارﻧﺪﮔﯽ ﻋﺼﺎره آﺑﯽ ﺣﺎﺻﻞ از اﻧﺪامﻫﺎی ﻣﺨﺘﻠﻒ ﮔﯿﺎﻫﯽ ﺑﺮ روی رشد سایر گیاهان در آزماﯾﺶﻫﺎی ﻣﺘﻌﺪدی ﺑﺮرﺳﯽ ﺷﺪه اﺳﺖ. ﺳﯿﻨﮓ و ﻫﻤﮑﺎران (21) ﮔﺰارش ﻧﻤﻮدﻧﺪ ﮐﻪ ﻋﺼﺎره ﺣﺎﺻﻞ از ﺑﺮگ ﮔﯿﺎه Ageratum conyzoides L. ﻃﻮل ﮔﻨﺪم و ﺗﺮﺑﭽﻪ را ﮐﺎﻫﺶ داد. در آزﻣﺎﯾﺶ دﯾﮕﺮی ﺑﺎﺗﯿﺶ و ﻫﻤﮑﺎران (22) ﺑﯿﺎن داﺷﺘﻨﺪﮐﻪ ﻋﺼﺎرهﻫﺎی ﺣﺎﺻﻞ از رﯾﺸﻪ و ﺑﺮگ Anisomeles indica رﺷﺪ ﻃﻮﻟﯽ رﯾﺸﻪ و ﺳﺎﻗﻪ ﻋﻠﻒ ﻗﻨﺎری را به‫طور ﻣﻌﻨﯽداری کاهش داده و ﮐﺎﻫﺶ ﺷﺪت اﺛﺮﺑﺎزدارﻧﺪﮔﯽ در ارﺗﺒﺎط ﻣﺴﺘﻘﯿﻢ ﺑﺎ ﻏﻠﻈﺖ ﻋﺼﺎره  ﺑﻮده اﺳﺖ.

وزن تر ریشه در شاهد سالم و آلوده رقم متین اختلاف معنی­داری با یکدیگر نداشتند که این نتیجه می­تواند نشان دهنده این موضوع باشد که فاکتورهای رشدی رقم مورد بررسی در بازه زمانی انجام پژوهش تاثیری از عامل بیماری نپذیرفته است. اما با افزایش غلظت عصاره در برخی تیمارها شاهد کاهش وزن تر ریشه در مقایسه با شاهد بودیم. با بررسی وزن تر اندام‏های هوایی در همان تیمارها متوجه افزایش وزن تر متناسب با افزایش غلظت عصاره می­شویم. در چنین تیمارهایی که کاهش وزن تر ریشه داشته­ایم اما در مقابل شاهد افزایش وزن تر اندام‫های هوایی در مقایسه با شاهد آلوده و حتی سالم هستیم، احتمال تاثیر منفی عصاره بر گیاه رد می­شود. عصاره‏های 75 درصد و 100 درصد چریش موجب افزایش معنی دار وزن تر در مقایسه با شاهد آلوده شدند. عصاره­ 50 درصد چریش باعث افزایش معنی دار وزن تر اندام‏های هوایی در مقایسه با شاهد آلوده شدند. با توجه به عکس ­العمل­های متفاوت دو رقم متین و ارلی اوربانا نسبت به تیمار با عصاره‏های گیاهی و یا تلقیح با نماتد، می­توان نتیجه گرفت که با توجه به فیزیولوژی متفاوت ارقام باید انتظار نتایج متفاوتی را از تیمارهای یکسان در شرایط مشابه را داشت.

حسینی نژاد (23) اثرمشتقات چریش بر نماتد مولد غده Meloidogyne javanicaدرگوجه ­فرنگی مورد بررسی قرارداده و علی‏رغم مشاهده کاهش معنی­دار جمعیت نهایی، تعدادگره و توده‏های تخم نماتد در تمامی تیمارهای چریش، بیشترین افزایش رشد گیاه را درمقایسه با شاهد در تیمار پودر مغزدانه چریش گزارش نموده است.

مطالعات رائو و همکاران (24) نشان داد که استفاده از برگCalotropis procera  به‏همراهGlomus fasciculatum Tul. در خاک علیه نماتد غده ریشه M. incognita سبب کاهش تعداد گال و تعداد تخم در هر کیسه تخم شد و علاوه‏براین سبب بهبود رشد گیاه گوجه فرنگی و افزایش کلنیزاسیون آن توسط قارچ مایکوریز شد.

تاکنون کشاورزان به‏صورت موفقی از فرمولاسیون‏های مختلف چریش جهت مدیریت نماتدهای پارازیت گیاهی استفاده کرده­اند. علاوه بر چریش تاثیر نماتدکشی گیاهان دیگری مثل میخک،گل جعفری افریقایی، توتون، چای، مارچوبه، زنجبیل، خرزهره و خردل مورد بررسی قرارگرفته و این گیاهان اثر قابل ملاحظه­ای درکاهش جمعیت نماتد مولد گره داشته­اند (25). اثربازدارندگی عصاره­ها ممکن است به‏دلیل وجود مواد شیمیایی موجود در عصاره باشد که دارای خواص جنین و تخم­کشی می­‏باشند. این موادشیمیایی یا برروی رشدجنین تاثیرگذاشته یا موجب کشته شدن جنین موجود در تخم‏ها شده و یا حتی تو ده تخم‏ها را در خود حل کرده است (26).

نماتدهای مولد گره ریشه با ایجاد گال بر روی سیستم ریشه گیاه و تجمع آب و مواد غذایی در ریشه سبب افزایش وزن تر ریشه گیاهان آلوده می‏شوند در حالی‏که وزن خشک ریشه نسبت به وزن تر آن کاهش می‏یابد.

وزن خشک ریشه در هر دو رقم مورد مطالعه، در شاهد آلوده به نماتد کمتر از شاهد سالم بود.

در رقم متین برخلاف رقم ارلی اوربانا وزن شاهد سالم و آلوده اختلاف معنی­دار نداشتند. بسیاری از تیمارها با شاهد اختلاف معنی‫دار نداشتند و با وجود کاهش آلودگی وزن خشک تغییر معنی‏داری نداشت. غلظت‫های بالای عصاره رازیانه و کرچک و استبرق باعث کاهش معنی‏دار وزن خشک شدند که با توجه به اینکه وزن خشک اندام‫های هوایی در آن گیاهان نسبت به شاهد سالم کاهش نداشته است، نمی­توان گفت که عصاره اثر سوء بر رشد گیاه داشته است.

در رقم ارلی اوربانا وزن خشک ریشه شاهد آلوده به‏طور معنی­داری در مقایسه با شاهد سالم کاهش یافت که این حالت موید اطلاعاتی است که در خصوص اثر آلودگی به نماتد مولد گره ریشه بر کاهش وزن خشک گیاه وجود دارد. اما تفاوت نتایج بین دو رقم گوجه فرنگی ارلی اوربانا و متین نشان می­دهد که حتی در یک میزبان خاص نمی‏توان انتظار نتایج ثابت و قابل پیش­بینی داشت، چرا که در یک سیستم زنده و پویا پاسخ و عکس العمل می‫تواند کاملا متفاوت باشد.

ترکیبات فنیل­پروپانوئیدی از اسیدسینامیک مشتق می‏شوند که خود اسیدسینامیک از اسیدآمینۀ فنیل­آلانین تشکیل شده است (27). آنزیم فنیل­آلانین­آمونیالیاز (PAL) واکنش تبدیل فنیل­آلانین را به ترانس­اسید‫ ‫سینامیک را هدایت می­کند. این مرحله، اولین قدم در مسیر فنیل­پروپانوئید است و به‏عنوان یک گلوگاه تنظیمی مهم بین متابولیسم اولیه و ثانویه است (28). PAL آنزیمی القا شونده است که در پاسخ به تنش­های زنده و غیرزنده مانند بیمارگرها، تابش اشعۀ UV و دمای پایین القا می­شود (29).

در گیاه Arabidopsis thaliana آنزیم PAL به‏وسیلۀ چهار ژن PAL1 تا PAL4 رمز می­شود (28). ریشه‏های گوجه فرنگی مقاوم کشت داده شده در دمای 27 درجه سانتی‏گراد دارای مجموعه‏ای از ترکیبات فنلی‏اند که به‏عنوان عوامل دفاعی عمل می‏کنند. آلودگی ریشه در 27 درجه سانتی‏گراد ( شرایط مقاومت) میزان فنل آزاد کاهش و سبب افزایش فعالیت PPO و PAL می‏‫شود. به‏نظر می‏رسد افزایش فعالیت PAL با واکنش فوق حساسیت ارتباط نزدیکی داشته باشد، که ممکن است مکانیزمی برای توقف توسعه نماتدهای حمله کننده باشد. مایه زنی نشاهای مقاوم در 32 درجه سانتی‏گراد (شرایط حساس) سبب کاهش فعالیت PAL و کاهش سریع ترکیبات فنلی می گردد. کاهش ترکیبات فنلی و PAL ریشه‏ها را برای آلودگی به نماتد مستعد می سازد (30).

ژن‏های PAL1، PAL2 و PAL4 به‏مقدار زیادی در اندام­های گل دهنده که دارای تجمع لیگنین هستند بیان می­شوند در حالی‫که ژن PAL3 دارای بیان کمی در این اندام­هاست. در غده­های سیب­زمینی که به‏وسیلۀ قارچ بیمارگرPhytophthora infestans (Mont.) de Bary آلوده شده بودند مقدار فعالیت آنزیم ­PAL و همچنین فرم باند شونده و آزاد اسیدسالیسیلیک در بافت‏های آلوده شده در تعامل ناسازگار افزایش نشان دادند (31)  .آنزیم PAL توسط عوامل زنده و غیر زنده مختلف القا می‫گردد که نتیجه آن تجمع ترکیبات فنلی؛ مثل اسیدهای فنلی و فلاونوئیدها می‏باشد. فعالیت ممانعت کننده PAL (2- آمینو- 2- ایندافونیک اسید (AIP) می تواند فعالیت PAL را کاهش دهد. در نتیجه میزان محتوای فنلی به طرز محسوسی کاهش و مقاومت به استرس‏ها ضعیف می‏شود. این نتایج نشان می‏دهد که PAL با تنظیم ترکیبات مختلف فنلی موجب مقاومت به استرس‏ها می‏‫شود. زمانی­که گیاه گندم و جو به‏وسیله ایزوله غیربیمارزای بیمارگر B. sorokiana آلوده شدند تغییری در میزان آنزیم PAL مشاهده نشد، اما جدایه‏های بیماری­زای این قارچ باعث القای سطوح بالای این آنزیم در گیاه گندم و جو ­شد (32).

یافته‏های این تحقیق با نتایج بررسی انجام شده روی تاثیر گونه M. javanica بر فعالیت آنزیم فنیل آلانین آمونیالیاز در ریشه گوجه فرنگی در تعامل با قارچ عامل پژمردگی آوندی مطابقت نشان داد (33). از آن‫جایی‏که فنیل آلانین آمونیالیاز، آنزیمی کلیدی در متابولیسم فنل پروپانوئید است که تبدیل L- فنیل­آلانین به ترانس‫سینامیک اسید، اولین مرحله در متابولیسم فنولیک‫ها را برعهده دارد، این مرحله یک واکنش بیوشیمیایی کلیدی در دفاع گیاهی به‏شمار می‏رود (34).

پراکسیدازها می­توانند سوبستراهای مختلفی را در حضور پراکسید­هیدروژن (H2O2) اکسید کنند (6). آنزیم­های پراکسیداز در ایزوفرم­های متعدد در گیاهان و جانوران وجود دارند (35). دیواره سلولی یکی از اولین سطوح دفاعی گیاه علیه حمله بیمارگر می­باشد و پراکسیداز یک آنزیم کلیدی در فرآیند سنتز دیواره سلولی است. پراکسیدازها در فرآیند ساختن دیواره سلولی مثل اکسیداسیون فنل، سوبرینی­کردن و لیگنینی­شدن سلول گیاهی در حین دفاع علیه عامل بیماری­زا شرکت دارند. آنزیم‌های آنتی اکسیدانت مثل پراکسیداز، سوپراکساید دیسموتاز و کاتالاز، ترکیباتی مثل  H2O2را به آب تبدیل می‌کنند (36) افزایش فعالیت پراکسیداز با القا مقاومت ارتباط دارد. آنزیم پراکسیداز به‏صورت ایزوفرم­های متفاوت باعث جذب اکسیژن فعال در سلول می‏شوند (37).

گزارش‏های زیادی در مورد فعالیت آنزیم پراکسیداز در افزایش مقاومت گیاهان وجود دارد که در واکنش ناسازگار افزایش فعالیت آنزیم پراکسیداز در مقاومت حاصله دخیل شناخته شده و نشان داده شده است که در واکنش ناسازگار فعالیت این آنزیم چند برابر واکنش سازگار است (38).

افزایش فعالیت پراکسیداز در گوجه فرنگی های مقاوم پس از مایه زنی با بیمارگرهای مختلف اعم از قارچ‏ها، باکتری‏ها و نماتدها مشاهده شده است، گیاهان ترانس ژنیک توتون، توتون زینتی، گوجه فرنگی و ذرت بیان کننده پراکسیداز آنیونی، مقاومت بیشتری به‏عوامل بیماری‫زای گیاهی و حشرات دارند. محققین معتقدند، مقاومت با ترکیبی از سه فاکتور تولید شده از پراکسیداز حاصل می‏گردد: 1) سخت‏تر شدن بافت، 2)نقصان کیفیت تغذیه، 3) افزایش سمیت. افزایش سطح فعالیت پراکسیداز آنیونی در گوجه فرنگی مقاوم پس از مایه زنی با نماتد اثبات شد و نشان داده شده است که، ژنP7X مسئول سنتز پراکسیداز مقاومت به نماتد مولد گره ریشه را در لاین اصلاح شده ذرت MP307 القا می‏نماید. پراکسیدازها در فرآیند ساختن دیواره ‌سلولی مثل اکسیداسیون فنل، سوبرینی کردن و لیگنینی شدن سلول گیاهی در حین دفاع برعلیه عامل بیماری زا شرکت دارند. آنزیم‌های آنتی اکسیدانت مثل پراکسیداز، سوپراکساید دیسموتاز و کاتالاز، ترکیباتی مثل H2O2 را به آب تبدیل می‏کنند (39).

بیمارگر سفیدک سطحی خیارSphaerotheca fuliginea ،  Pseudomonas syringaepv pisiو سالیسیلیک اسید فعالیت آنزیم های کیتیناز، بتا 1، 3 گلوکاناز، پراکسیداز، پلی فنل اکسیداز و PAL را در بافت‏های برگ توتون 2 تا 3 روز پس از مایه زنی افزایش می‏دهند. همچنین این آنزیم ها با تیمار عصاره گیاهان مختلف و اتیلن فعال شدند. برخی مطالعات نشان می‏دهند که کاهش مقاومت (در دماهای مختلف) می‏تواند با کاهش ترکیبات فنلی، PAL و فعالیت POX مرتبط باشد. کاهش سطح این آنزیم ها و سوبستراهایشان توانایی دفاع فعال را در سلول کاهش داده و گیاه را برای حمله بیمارگر مستعد می‏سازد (40).

مشخص شده است که افزایش فعالیت POX با القای مقاومت سیستمیک در خیار و توتون در مقابل بسیاری از بیمارگرها مرتبط می باشد (41).

در واقع می‌توان گفت که تجمع پراکسیداز اغلب با شروع القا مقاومت ارتباط دارد. این آنزیم در دفاع علیه پاتوژن‌ها بسیار فعال عمل می‌کند.در گیاهانی که دفاع خیلی دیر اتفاق می‌افتد، پاتوژن به‏راحتی بافت گیاه را کلونیزه می‏کند (42).

پراکسیداز در ترکیبات ساختاری دیواره سلولی و پلی مریزاسیون لیگنین باعث سفت شدن دیواره سلولی می‏شود، در نتیجه سدهای مکانیکی افزایش یافته و سرعت نفوذ عامل بیماری زا کاهش می‫یابد و به سلول‏های گیاه اجازه داده می‏شود که واکنش‏های دفاعی خود را که برای فعال شدن به زمان بیشتری نیاز دارد (43) تنظیم کند.

در بررسی انجام شده توسط Campos و همکاران (44) تاثیر  PPOو POX در مقاومت به آنتراکنوز در چهار رقم لوبیا، نشاها با SA و نژاد دلتای Colletotrichom lindemuthianum (قارچ القاگر) ارزیابی گردیدند. فعالیت آنزیمی و میزان فنل سه روز پس از کاربرد القاگر قارچی و پنج روز پس از مایه زنی با پاتوتیپ مهاجم اندازه گیری شده است. گیاهان تیمار شده با SA و القاگر قارچی افزایش فعالیت دو آنزیم را در همه ارقام نشان دادند. بیشترین فعالیت آنزیمی در ارقام مقاوم به بیماری مشاهده شده است.

در یک تحقیق انجام شده گزارش شد که تیمار درختان مانگو با باکتری  P. fluorescensبه‏علاوه کیتین بعد از 15 روز موجب افزایش میزان فنل و فعالیت آنزیم‏های پراکسیداز، پلی فنل اکسیداز و PAL می‫شود (45).

بر اساس نتایج این مطالعه عصاره گیاه چریش قادر بود شاخص گال را به‏عنوان یکی از شاخص‏های بیماریزایی نماتد کاهش دهد. این عصاره بر روی میزان بیان ژن‏های دفاع پراکسیداز و فنیل­آلانین­آمونیالیاز تاثیر مثبت گذاشته و افزایش بیان این ژن­ها را به‏دنبال داشته است. همان­طور که در تحقیقات متعدد بارها به اثبات رسیده است برای اینکه گیاه بتواند در برابر عوامل بیماری­زا از خود مقاومت نشان دهد باید میزان بیان ژن­های دفاعی خود را در روزها و حتی ساعات ابتدایی بعد از حمله بیمارگر افزایش دهد، از طرفی ما در این تحقیق به‏وضوح مشاهده نمودیم که عصاره گیاه چریش قادر است به خوبی میزان بیان این دو ژن را در ساعات ابتدایی بعد از حمله بیمارگر افزایش دهد. نتایج این تحقیق نشان داد این عصاره گیاهی علاوه‏براین‏که به‏صورت مستقیم اثر نماتدکشی دارد می‏تواند با تاثیر بر روی میزان بیان ژن­­های دفاعی، باعث القای آن­ها و افزایش مقاومت گیاه در برابر بیمارگرهای گیاهی شود، لذا پیشنهاد می­شود که بر روی شناسایی مواد موثره این ترکیب و همچنین ایجاد فرمولاسیون­های قابل استفاده به‏وسیله کشاورزان بیشتر مطالعه شود.

با توجه به نتایج این تحقیق می‏توان عصاره گیاه چریش را به‏عنوان یک ترکیب صددرصد طبیعی با خاصیت ضد نماتدی بالا معرفی نمود و بعد از رسیدن به فرمولاسیون مناسب به‏صورت یک محصول قابل عرضه آن‫را وارد بازار نمود.

1. Ahmadi K, Gholizadeh H. Ebadzadeh H. Husseinpoor R. Hatami F. Fazli B. Kazemian A. and Rafiei M. Annual Agricultural Statistical Yearbook of Iran. Field Crops.Publication of Ministry of Jihad-eAgriculture of Iran. 2015; 1(2): 1-398. (amar.maj.ir).

2. Kayani MZ, Mukhtar T, Hussain MA. Evaluation of nematicidal effects of Cannabis sativa L. and Zanthoxylum alatum Roxb. against root-knot nematodes, Meloidogyne incognita. Crop Prot. 2012; 39: 52-56.

3. Naserinasab F, Sahebani NA, Etebarian HR. Biological control of Meloidogyne javanica by Trichoderma harzianum BI and salicylic acid on Tomato. African Journal of Food Science. 2011; 5(3): 276 – 280.

4. Trudgill DL, Blok VC. Apomictic, polyphagous root-knot nematodes: Exceptionally successful and damaging biotrophic root pathogens. Annual Review of Phytopathology. 2001; 39: 53-77.

5. Gholamnezhad J. Effect of plant extracts against apple gray mold caused by Botrytis cinerea. Applied Microbiology in Food Industry. 2017; 3(4): 41-54.

6. Gholamnezhad J, Sanjarian F, Mohammadi goltapeh E, Safaei N, et al. Effect of salicylic acid on enzyme activity in wheat in immediate early time after infection with Mycosphaerella graminicola. Scientia agriculturae bohemica, 2016; 47(1): 1-8.

7. Gholamnezhad J. Effect of plant extracts on activity of some defense enzymes of apple fruit in interaction with Botrytis cinerea. Journal of Integrative Agriculture. 2018; 17(0): 1-10.

8. Cristobal-Alejo J, Tun-Suarez JM, Moguel-Catzin S, Marban-Mendoza S, et al. In vitro sensitivity of Meloidogyne incognita to extracts from native yucatecan plants, Nematropica. 2006; 36(1): 89-96.

9. Wang X, Tang C, Zhang G, Li Y, et al. cDNA-AFLP analysis reveals differential gene expression in compatible interaction of wheat challenged with Puccinia striifonnis f. sp. tritici. BMC genomics. 2009; 10: 289-304.

10. Schaffrath U, Zabbai F, Dudler R. Characterization of RCI-1, a chloroplastic rice lipoxygenase whose synthesis is induced by chemical plant resistance activators. European Journal of Biochemistry. 2000; 267(19): 5935-5942.

11. Gholamnezhad J, Sanjarian F, Mohammadi goltapeh E, Safaei N, et al. Study of defense genes expression profile pattern of wheat in response to infection by Mycosphaerella graminicola, Iranian Journal of Plant Biology. 2016b; 8(30): 43-55.

12. Eisenback JD. Detailed morphology and anatomy of second_stage juveniles, males, and females of the genus Meloidogyne(Root_knot nematode). Biology and control. 1985; 1: 47-77.

13. Hussian SI, Masood A. Effects of some plant extracts on larval hatching of Meloidogyneincognita; Acta Bot. 1976; 3: 142-146.

14. Ranjitsingh KN, Sucheta KR. Effect of root extracts to control root knot nematode (Meloidogyne spp) of Soybean (Glycine max). Biological Forum- An International Journal. 2009; 1(1): 65- 68.

15. Huang J, Gu M, Lai Z, Fan B, et al. Functional analysis of the Arabidopsis PALgene family in plant growth, development, and response to

 

environmental stress.Plant Physiology. 2010; 153(4):1526–1538.

16. Livak KL, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2∆∆-CT T.Method.METHODS. 2001; 25(4): 402–408.

17. Kamalwanshi RS, Khan A, Srivastava AS. Reaction of tomato germplasm against root knot nematode, Meloidogyne incognita . Indian Journal of Nematology, 2004; 34(1): 94-95.

18. Mokhtari F, Oliae M. Biological containment of native root nematode (Meloidogyne javanica) using isolates of Pochonia chlamydosporia var. chlamydosporia in tomatoes. Plant protection . 2015; 37(3): 85-104.

19. Stafford HA, Galston AW. Ontogeny and hormonal control of polyphenoloxidase isoenzymes in tobacco pith. Plant Physiol. 1970; 46(6): 763-767.

20. Stampar F, Solar A, Hudina M, Veberic R, et al. Traditional walnut liqueur -cocktail of phenolics. Food Chemistry. 2006; 95: 627–631.

21. Singh HP, Batish DR, Kaur S, Kohli RK. Phytotoxic interference of Ageratum conyzoides with Wheat (Triticum aestivum). Journal of Agronomy and Crop Science. 2003; 189(5): 341-346.

22. Batish DR, Kaur M, Singh HP, Kohli RK. Phytotoxicity of a medicinal plant, Anisomeles indica, against Phalaris minor and its potential use as natural herbicide in wheat fields. Crop Protection. 2007a; 26(7): 948-952.

23. Hosseininejad SA. Effect of neem products, Azadirachta indica, on root-knot nematode, Meloidogyne javanica, infesting. Enthomology and phytopathology. 2004; 72(1): 69-89.

24. Rao MS, Reddy PP, Das SM. Effect of integration of Calotropis procera leaf and Glomus fasciculatum on the management of Meloidogyne incognita infesting tomato.Nematol. Medit. 1996; 24: 59-61.

25. Javed N, Gowen SR, El-Hassan SA, Inam-ul-Haq M, et al. Efficacy of neem (Azadirachta indica) formulations on biology of root-knot nematodes (Meloidogyne javanica) on tomato. Crop Protection . 2008; 27(1): 36- 43.

26. Adegbite AA, Adesiyan SO, Root extracts of plants to control root-knot nematode on edible soybean. World Journal of Agriculthral Sciences. 2005; 1(1): 18-21.

27. Vogt T. Phenylpropanoid biosynthesis. Molecular Plant. 2010; 3(1): 2-20.

28. Huang J, Gu M, Lai Z, Fan B, et al. Functional analysis of the Arabidopsis PALgene family in plant growth, development, and response to environmental stress. Plant Physiology 2010; 153(4): 1526–1538.

29. Mandal S. Induction of phenolics, lignin and key defense enzymes in eggplant (Solanummelongena L.) roots in response to elicitors. African Journal Biotechnology. 2010; 9(47): 8038–8047.

30. Zacheo G, Orlando C, Bleve _Zacheo T. Characterization of anionic Peroxidase in tomatos isolines infected by Meloidogyne incognita. J. Nematology. 1993; 25: 249-256.

31. Panina Y, Frave DR, Baker CJ,  Shcherbakova LA, et al. Biocontrol and plant pathogenic Fusarium oxysporum-induced changes in phenolic compounds in tomato leaves and roots. Journal of Phytopathology. 2007; 155(7-8): 475-481.

32. Peltonen S, Karjalainen R. Phenylalanine ammonia-lyase activity in barley after infection withBipolaris sorokinianaor treatment with its puri®ed xylanase. Journal of Phytopathology. 1995; 143: 239-245.

33. Sahebani N, Hadavi NS, Omranzadeh F. The effects of b-amino-butyric acid on resistance of cucumber against root-knot nematode, Meloidogyne javanica.Acta Physiol Plant. 2011; 33(4): 443– 450.

34. Chang DS, Kuo YC, Chen TY. Productivity measurement of the manufacturing process for outsourcing decision: the case of a Taiwanese printed circuit board manufacturer. Int J Prod Res. 2008; 46(24): 6981-6995.

35. Chandru HK, Kim E, Kuk Y, Cho K, et al. Kinetics of wound- induced activation of antioxidative enzymes in Oryza sativa: differential activation at different growth stages, Plant Sci. 2003; 164(6): 935-941.

36. Gholamnejad J, Etebarian HR,  Roustaee A, Sahebani  N.  Biological control of apple blue mold by   isolates of Saccharomyces cerevisiae.  Journal of  Plant Protection  research, 2009;  49(3): 270-275.

37. Prusky D. Mechanism of resistance of fruits and vegetables to postharvest diseases. In: Bartz, J., Brecht, J., (Eds), Postharvest Phisiology and Pathology of Vegetables; 2003; 581-598.

38. van Loon LC, RepMand CMJ. Significance of inducible defense-related proteins in infected plants. Annul Review Phytopathology. 2006; 44: 135-162.

39. Gong M, Li Y, Dai X, Tian M, et al. Involvment of calcium and calmodulin in the acquisition of HS inuced thermotolerance in maize seeding, Journal of Plant Physiology. 1997; 150(5): 615-621.

40. Gholamnezhad J, Sanjarian F, Mohammadi goltapeh E, Safaei N, et al. Evaluation of housekeeping gene expression of wheat interaction against Mycosphaerella graminicola with Reverse northern dot blot method. Crop Biotechnology. 2016; 12:1-10.

41. Yu Q, Tsao R, Chiba M, Potter J. Elucidation of the nematicidal activity of bran and seed meal of oriental mustard (Brassica juncea) under controlled conditions. J Food Agric Environ. 2007; 5(3-4): 374–379.

42. Kuc J. Concepts and direction of induced systemic resistance in plants and its application. Eur J Plant Pathology, 2001; 107(1): 7-12.

43. Durner J, Shah J, Klessig DF. Salicylic acid and disease in plants. Trends Plant Sci. 1997; 2(7): 266–274.

44. Campos AD, Ferreira AG, hamper MMV, Antune HF, et al. Induction of chalcone synthase and phenylalanine ammonia-lyase by salicylic caid and Colletotrichum lindemathianum in common bean. Plant Physiology. 2004; 12: 961-970.

45. Vivekananthan R, Ravi M, Ramanathan A. Pre-harvest application of a new biocontrol formulation induces resistance to post-harvest anthracnose and enhances fruit yield in mango. Phytopathol Mediterr. 2006; 45: 126–138.