فصلنامه

نوع مقاله : علمی - پژوهشی

نویسندگان

1 پژوهشگاه رویان، پژوهشکده زیست شناسی و فناوری سلول‌های بنیادی جهاد دانشگاهی، مرکز تحقیقات علوم سلولی، گروه سلول‌های بنیادی و زیست شناسی تکوینی، تهران، ایران

2 دانشگاه الزهرا، دانشکده علوم زیستی، تهران، ایران

3 دانشکده دامپزشکی، دانشگاه تهران، ایران

چکیده

هدف: استئوآرتریت (OA) یک بیماری ناتوان کننده‌ با بار روانی و اقتصادی  است. امروزه  استفاده از سلول‌های بنیادی  مزانشیمی (MSCs) بسیار مورد توجه است. لذا انتخاب منبع سلولی مناسب یکی از چالش‌های درمان OA است. هدف از این مطالعه بازسازی ضایعه غضروفی  ( اندازه بحرانی)  در زانوی گوسفند با استفاده از سلول‌های اتولوگ کندروسیت، MSCs حاصل از  بافت مغز استخوان (Bm-MSCs)و MSCs مشتق از بافت چربی (Ad-MSCs) که در شرایط کاملا یکسان جداسازی و کشت  شده است.  مواد و روش‌ها: در مطالعه حاضر از گوسفند نژاد Najdi 12 ماهه استفاده شد. کندروسیت‌ها از انتهای دنده، Bm-MSC از مغز استخوان  و Ad-MSCs از بافت چربی گوسفند  جدا شدند. سپس سلولهای جدا شده در محیط‫های کشت و شرایط دمای 37 درجه سانتی‫گراد یکسان کشت شدند. پس از بررسی هوییت  MSCs و کندروسیت‫ها، مقدار ۱۰۶×۵ سلول در هر میلی‌لیتر  ژل کلاژن نوع I کاشته شد. سپس به ضایعه غضروف  در زانوی گوسفند پیوند شد. دو ماه پس از پیوند، میزان ترمیم با روش ماکروسکوپی و رنگ‌آمیزی بافت‌شناسی H&E و Safranin  fast green/O بررسی شد. نتایج: هوییت سلول‫های MSCs کندروسیت تایید شد. بر اساس مشاهدات در گروه‌های درمانی، آسیب توسط بافت غضروف شبه هیالین در مقایسه با گروه‌های کنترل (untreated) و sham پر شده است. همچنین، سطح بافت تشکیل شده در Bm-MSCs و کندروسیت صاف‌تر از گروه Ad-MSCs  بودp<0.05) *). غضروف هیالین Bm-MSCs واضح‌تر از گروه Ad-MSCs است. ولی تفاوت معنی‫داری نشان داده نشد. نتیجه‌گیری: نتایج نشان داد که سه منبع سلولی برای این منظور مناسب هستند. Ad-MSCs به‫دلیل سهولت دسترسی توصیه می‫شوند.

تازه های تحقیق

-

کلیدواژه‌ها

dor -

عنوان مقاله [English]

The Best Autologous Cell Sources for Articular Cartilage Regeneration with Critical Size Defects in an Ovine Knee Joints Model

نویسندگان [English]

  • F Zarei 1
  • R Shafaghi 2
  • MM Dehghan 3
  • F Mostafaee 1
  • L Taghiyar 1
  • MR Baghaban Eslaminejad 1

1 MSC, Department of Stem Cells, Royan Institute, Tehran, Iran. E-mail: zareii.91.fatemeh@gmail.com

2 BSC, Department of Biotechnology, Alzahra University, Tehran, Iran. E-mail: raziehshafaghy2000@gmail

3 Professor, Department of Veterinary Medicine, Tehran University, Tehran, Iran. E-mail: mdehghan@ut.ac.ir

چکیده [English]

Aim: Cartilage defects of the knee such as osteoarthritis disease (OA) are one of the most debilitating and public diseases that are related to high individual and socioeconomic problems. Many recent studies have applied mesenchymal stem cells (MSCs) incorporated with tissue engineering to repair articular cartilage defects or regeneration of OA.  So, the choice of the best cell type in this regard is one of the challenging issues of tissue engineering and OA cell therapy. This study aims to find the best cell source for the regeneration of critical size defects of cartilage knee using autologous chondrocytes and bone marrow-derived MSCs (Bm-MSCs), and adipose-derived MSCs (Ad-MSCs) that were isolated, cultured, and expanded in similar in vitro conditions.
Materials and Methods: In the current study, Najdi sheep were used at 12 months of age. After standard anesthesia, cartilage was isolated from the hyaline cartilage at the end of the ribs. The Bm-MSCs and Ad-MSCs were isolated from bone marrow and tails' adipose tissue, respectively. Following the enzymatic digestion of cartilage and adipose tissues, using collagenase I enzymes, the chondrocyte, Ad-MSCs, and Bm-MSCs were cultured in growth media at 37º C with similar conditions. Then, MSCs were identified by morphology analysis and also osteogenic/adipose/chondrogenic differentiation, in vitro. In addition, chondrocytes were identified by morphology and analysis of cartilage-related gene expression such as Aggrecan, Col II, and SOX9 genes by Real-time PCR technique. After that, an amount of 5×106 cells/ml from each cell source was seeded in the type I collagen gel and transplanted into an experimentally created articular cartilage defect in the knee’s sheep model. Two months after transplantation, the animals were sacrificed in the standard ways and the implanted tissue was removed. The range of regeneration was investigated by macroscopic scoring and histological staining such as H&E and safranin o/fast green.
Results: MSCs showed spindle shape of morphology, and skeletal differentiation were confirmed the identity of MSCs and chondrocytes. The macroscopic observation showed that the defects in cell-treated groups of chondrocytes, Bm-MSCs, and Ad-MSCs were filled with hyaline cartilage-like tissue in contrast to the control groups of untreated and sham (without cell) groups. In addition, the surface of new cartilage formed in Bm-MSCs and chondrocyte groups appeared to be smoother than in the Ad-MSCs group and the hyaline cartilage of Bm-MSCs is more clearly than that of the Ad-MSCs group. Although histological scores (ranging from 1 to 4) were evaluated, there was no significant difference among the three experimental groups regarding newly formed cartilage repair tissues. Furthermore, the histological analysis of H&E and safranin O revealed that all defects were filled by chondrocyte-like cells that were enclosed in the secreted matrix (*P<0.05).
Conclusion: We used three prevalent and main autologous cell sources such as chondrocyte, BM-MSCs, and AD-MSCs cells in exactly equal conditions to find the most significant cell sources for critical size defect of cartilage in sheep’s knees. The results demonstrated that three cell sources are suitable for this purpose; Although the Ad-MSCs due to ease and more accessibility are further recommended.

کلیدواژه‌ها [English]

  • Critical-size Defect
  • Adipose-derived MSCs
  • Bone Marrow-Derived MSCs
  • chondrocytes
  • transplantation
  • مقدمه

استئوآرتریت (OA) یا آرتریت دژنراتیو یک بیماری پیش‌رونده، ناتوان‌کننده و مزمن سیستم اسکلتی است که با تخریب بافت غضروف و استخوان مفاصل همراه است (1). شایع‌ترین نوع آرتریت و علت اصلی ناتوانی افراد در سنین کار یعنی ۱۸ تا ۶۵ سالگی در سراسر جهان است که منجر به تحمیل هزینه‌های اجتماعی، روانی و اقتصادی زیادی به دولت و خانواده‌ها می‌شود (2). پیش‌بینی می‌شود آمار آرتروز زانو در ۱۰ سال آینده به دلیل نرخ رو به رشد چاقی و میانگین سنی جامعه افزایش یابد. برای مثال، مطالعات اخیر حاکی از آن است که ضخامت و حجم غضروف‌ مفصلی در بیماران با متوسط سنی ۵۰ سال و شاخص توده بدنی (BMI) ۲۵ یا بالاتر، به طور قابل توجهی رابطه عکس دارد که نشان‌ دهنده روند افزایشی آرتروز در افراد است (3).

بافت غضروف مفصلی، علی رغم اینکه بافت ساده‌ای به‫نظر می‌رسد ولی چالش‌های زیادی برای ترمیم دارد. بافت غضروف هیالین، بدون عروق خونی و لنف بوده و کندروسیت‌ها تنها سلول‌های موجود در این بافت است که دارای تراکم اندک و پتانسیل پایینی برای ترمیم و تکثیر است. در مواقع آسیب این خصوصیات منحصر به فرد و از طرفی تحمل وزن بالای بدن باعث عدم انتقال مواد مغذی و فاکتورهای ترمیمی به محل مورد نظر شده و باعث تحلیل پیش‌رونده بافت می‌شود (7-4).

تا کنون درمان قطعی برای OA گزارش نشده است و اغلب ترکیبی از درمان‌های دارویی و غیر دارویی توصیه می‌شوند. درمان‌های دارویی در مراحل اولیه بیماری کاربرد دارند و اصولا بسته به‫شدت تخریب مفاصل، شامل انواع تسکین دهنده‌های علائم درد بوده که مزایای بالینی و ترمیمی اندکی دارند. درمان‌های غیردارویی نیز منجر به کاهش درد، سفتی مفاصل و همچنین حفظ عملکرد مفاصل می‌شوند (8-11). در موارد شدیدتر، روش‌های تهاجمی‌تر مانند انواع عمل‌های جراحی مانند میکروفرکچر، کندروپلاستی و یا آرتروپلاستی زانو (TKA) است که علاوه بر هزینه‌های بالا، در بسیاری موارد بعد از چندسال برگشت‌پذیر بوده و به جراحی مجدد نیاز دارد (1و2و12).

علی‫رغم روش‌های درمانی نامبرده، آسیب غیرقابل بازگشت بافت غضروف و به‫دنبال آن تخریب بافت استخوان زیرغضروفی، از معضلات پزشکی بازساختی است. اخیرا، نقش ارزنده پیوند سلول و یا به عبارتی سلول درمانی در ترمیم و بازسازی ساختار و عملکرد بافت‌های مختلف از جمله غضروف مفصلی مشخص شده است. درمان‌های مبتنی بر سلول علاوه بر شرایط محیطی، عوامل رشد، محرک‌های شیمیایی و مکانیکی، به منبع و نوع سلول‌های استفاده شده نیز بستگی دارد (15-13).

یکی از بهترین و شناخته‌شده‌ترین منابع سلولی برای غضروف آسیب‌دیده، استفاده از سلول کندروسیت اتولوگ (ACI) است (15). اگرچه ACI در بهبود بیماران تا حد زیادی موفق بوده است، ولی مشکلات و چالش‌های متعددی در رابطه با این رویکرد درمانی مطرح است. از جمله این چالش‌ها می‌توان به محدودیت در مقدار بافت غضروف بیمار برای جداسازی کندروسیت‌ها و از طرفی عمل جراحی برای برداشت بافت مورد نیاز که یک روش تهاجمی است، اشاره کرد. از همه مهم‫تر سلول‌های کندروسیت، سلول‌های بالغ و تخصص یافته بوده لذا تکثیر آن‫ها در آزمایشگاه با چالش‌های زیادی همراه است. این سلول‌ها قادر به کشت طولانی مدت ex vivo  نبوده و پس از چند پاساژ سلولی دچار تمایززدایی یا آپوپتوزیس ناخواسته شده که بر اثربخشی ACI تاثیر به‫سزایی دارد (16).

با توجه به محدودیت‌هایACI، پیشرفت‌های اخیر درمان‌های مبتنی بر سلول از جمله سلول‌های بنیادی آن را به کاندید ارزشمندی برای درمان OA تبدیل کرده است. از بین انواع سلول‌های بنیادی، سلول‌های بنیادی مزانشیمی (MSCs) به‫‌عنوان یکی از بهترین منابع سلولی جایگزین در درمان مبتنی بر سلول OA به شمار می‌رود. سلول‌های MSCs به‫طور گسترده در آزمایشگاه تکثیر شده و ویژگی‌های بنیادی خود را حفظ کرده، قادر به تمایز به یک فنوتیپ غضروفی و یا استخوانی بوده و از همه مهم‫تر تعدیل‌کننده‌ی سیستم ایمنی هستند. لذا به‫دلیل بیان سطحی کم آنتی‌ژن‌های کمپلکس اصلی سازگاری بافتی (MHC)، رد ایمونولوژیک نداشته و پیوند کارآمد و همزیستی طولانی مدت در بدن میزبان از ویژگی‌های اصلی این سلول‌ها است (17, 18). منابع اولیه سلولی و دوز سلول نیز به‫طور قابل توجهی بر اثر بخشی سلول پیوند شده و درمان تاثیرگذار است. شایع‌ترین منبع سلول‌های MSCs، بافت مغز استخوان (BM) و چربی (AT) هستند (16, 19). علاوه بر منبع اولیه MSCs، اطلاعاتی مانند روش جداسازی سلولی، حجم بافت برداشت شده و پتانسیل تمایز نیز باید در نظر گرفته شود. به‫طور مثال حجم سلول‌های بنیادی در مغز استخوان تنها 01/0 درصد است و عواملی مثل سن اهداکننده و حجم بافت استخراج شده نیز بر تعداد سلول‌های MSCs به‫دست آمده تاثیر به‫سزایی دارد. بنابراین دستیابی به تعداد کافی سلول، به ویژه در بین اهداکنندگان مسن، دشوار است. در مقابل، بافت چربی را می‌توان به راحتی با روش‌های لیپکتومی و لیپوساکشن به‫دست آورد که در مقایسه با آسپیراسیون مغز استخوان خطر کمتری داشته و تعداد سلول تک هسته بیشتری را می‌توان از آن به‫دست آورد  (20).

مطالعات بالینی و پیش بالینی نشان داده که سلول‌های بنیادی جدا شده از منابع مختلف بافتی چون مغز استخوان، بافت چربی، خون بند ناف و یا پالپ دندان همگی پتانسیل تمایز به غضروف و استخوان را در آزمایشگاه نشان داده و از طرفی در مطالعات پیش بالینی انجام شده در آسیب‌هایی با سایز بحرانی در زانو مدل حیوانی رت، خرگوش و غیره.... ترمیم قابل قبولی را نشان داده است، اگرچه هر کدام از این منابع سلولی محدودیت‌هایی دارند (21-25). اما تا کنون اثربخشی مقایسه‌ای از ترمیم آسیب مفصلی با استفاده از منابع سلول‌های اتولوگ بدست آمده در شرایط کاملا استاندارد و یکسان جداسازی، کشت، پیوند، مکانیسم انتقال و دوز سلولی و خطر ریسک کم‌تری، طراحی و ارزیابی نشده است تا با حذف حداکثری عوامل متغیر از آزمایش بتوان منبع سلولی کاملا بهینه را مشخص کرد (20). لذا در مطالعه‌ی حاضر سه منبع سلولی کندروسیت، سلول‌های بنیادی مزانشیمی جدا شده از مغز استخوان و بافت چربی، بطور همزمان، در شرایط  کاملا یکسان از مدل حیوانی گوسفند جداسازی و در شرایط کشت آزمایشگاهی کاملا یکسان کشت و تکثیر شده و در ضایعه غضروف تجربی با سایز بحرانی که به‫صورت تجربی در زانوی گوسفند ایجاد شد، پیوند و اثرات درمانی آن با هم مقایسه و بهترین منبع سلولی انتخاب شد.

2-مواد و روش­ها

حیوانات آزمایشگاهی و جداسازی نمونه مغز استخوان، بافت چربی و غضروف: مطالعه حاضر یک مطالعه آزمایشگاهی بوده و به تصویت کمیته اخلاق پژوهشگاه رویان رسیده است. در مطالعه حاضر تعداد ۸ راس گوسفند نژاد Najdi و با سن تقریبی 12 ماه مورد استفاده قرار گرفت. حیوانات در مزرعه حیوانات بزرگ پژوهشگاه رویان در منطقه هلیجرد استان کرج در شرایط استاندارد، نگه­داری شدند. برای جداسازی بافت­های چربی، مغز استخوان و غضروف دنده­ای ابتدا حیوانات با 22 میلی‌گرم به ازای هر کیلوگرم وزن کتامین و 2/0 میلی‌گرم به ازای هر کیلوگرم وزن زایلزین بی‫هوش شدند، سپس محل مورد نظر ابتدا به روش استریلاسیون عمومی با بتادین به طور کامل استریل و شیو شد. پس از استریلاسیون مجدد، بیوپسی مغز استخوان تحت بی‫هوشی کامل از استخوان تیبیا انجام شده و حدود ۴-۵ میلی‌لیتر مغز استخوان در سرنگ حاوی ۱۵۰۰۰ واحد هپارین (۷۵۰ واحد به ازاء هر میلی‌لیتر مغز استخوان) جمع آوری شد. برای بافت غضروف مشابه جداسازی مغز استخوان محل استریل و سپس نمونه غضروف از انتهای دنده حیوان به حجم ۱۰-۵ گرم جداسازی شد. مشابه موارد قبل پس از استریل کردن محل مورد نظر، ۱۰ میلی‌لیتر چربی از بافت چربی زیر پوستی در ناحیه شکم جداسازی و نمونه­ها به‫طور جداگانه در ظروف استریل و بر روی یخ نگه‌داری و بلافاصله به آزمایشگاه کشت سلول­های بنیادی پژوهشگاه رویان ارسال شدند. 

 

جداسازی، کشت و تکثیر سلول­های MSCs مشتق از مغز استخوان: کشت و جداسازی سلول­های MSCs از نمونه مغز استخوان مشابه تحقیقات پیشین گروه حاضر انجام شد(26, 27). به‫طور خلاصه، هر ۱ میلی‌لیتر از خون مغز استخوان به ظروف کشت ۱۵۰ سانتی متر مربع منتقل شده و ۱۰ میلی لیتر محیط کشت DMEM (UAD؛ sigma Dubleco’s Modified Eagles Medium,) حاوی ۱۵ درصد FBS(USA؛ Fetal Bovine Serum, Gibco) و ۱۰ واحد آنتی بیوتیک پنی­سیلین و استرپتومایسین اضافه گردید و به انکوباتور با دمای ۳۷ درجه سانتی‫گراد و ۵ درصد  منتقل گردید. ۳ تا ۴ روز پس از آغاز کشت، محیط رویی به آرامی تخلیه و پس از یکبار شستشو با محلول PBS- (USA؛ Gibco) ۱۰ میلی لیتر محیط کشت تازه اضافه شد. با این عمل سلول­های خونی و غیرچسبنده از محیط کشت حذف شدند. محیط کشت هر ۳-۴ روز یک‫بار تعویض شد تا زمانی که سلول­ها ۶۰  الی ۷۰ درصد ظرف کشت را پر کردند. سپس پاساژ اول صورت گرفت به این ترتیب که محیط رویی‌ سلول­ها تخلیه‌ و پس از شستشو سلول­های چسبیده با بافر PBS- (آمریکا؛ Gibco)، ۵ میلی‫لیتر  آنزیم Trypsin/ EDTA  (USA؛ Gibco)  ۲ درصد به‌ سلول­ها اضافه‌ و به‫مدت‌ ۴-۳ دقیقه‌ درانکوباتور قرار داده شده تا سلول­ها از کف‌ ظرف‌ جدا گردد. سپس آنزیم با ۳ میلی‫لیتر محیط DMEM خنثی شد.‌ سلول­ها به‌ لوله‌ ۱۵ میلی‌لیتر منتقل و با دور  g۱۲۰۰ به‌‫مدت‌ ۵ دقیقه‌ سانتریفوژ شد. سپس محیط رویی‌ سلول­ها تخلیه‌ و پلت سلولی در ۱ میلی‌لیتر محیط  DMEM سوسپانس گردید و به نسبت ۱ به ۳ به‌ فلاسک کشت ۱۵۰ سانتی‌متر مربع منتقل شدند. در ادامه با انجام چند پاساژ سلولی، تعداد کافی سلول MSCs تکثیر و برای انجام آزمایشات بعدی در تانک ازت دارای دمای منهای ۱۹۵ منجمد و نگه­داری شدند.

 

جداسازی و تکثیر سلول­های بنیادی مزانشیمی از بافت چربی: سلول‫های AD-MSCs مطابق روش Ejaz و همکاران جداسازی و کشت شد (35). به این ترتیب که نمونه چربی تحت شرایط استریل و در محلول سرم فیزیولوژی حاوی ۱ درصد آنتی­بیوتیک به پژوهشگاه رویان منتقل شد. بافت چربی ۳-۴ بار با محلول PBS- شستشو شد تا خون و آلودگی­های احتمالی از نمونه جدا شود. سپس بافت چربی به کمک تیغ اسکالپل تا حد امکان تکه تکه شد. سپس ترکیب به‫دست آمده به محلول کلاژناز (USA؛ sigma) 2/0 درصد منتقل و به‫مدت ۲۰ دقیقه در دمای ۳۷ درجه سانتی‌گراد در انکوباتور نگه­داری شد. در طی این مدت هر ۵ دقیقه یکبار نمونه­ها بر روی ورتکس به‫مدت ۱۰-۲۰ ثانیه لیز شد تا زمانی که بافت به حالت محلول کاملا بی­شکل و یکدست تبدیل شد. سپس آنزیم کلاژناز با ۴ میلی‌لیتر محیط کشت حاوی سرم خنثی شد و سپس در دور g۱۵۰۰ به‫مدت ۵ دقیقه سانتریفوژ شد. سلول­های تک هسته که به‫صورت پلت سلولی در کف لوله سانتریفیوژ ته‫نشین شده بودند، به آهستگی و به‫کمک پیپت ۵ میلی‌لیتر جمع آوری شدند. سپس به لوله ۱۵ میلی‌لیتر منتقل و به‫کمک ۵ میلی­لیتر محیط کشت سوسپانس شدند. سلول­ها در نهایت به‫کمک سانتریفیوژ جداسازی و به ظرف کشت ۷۵ سانتی‌متر مربع منتقل شدند و محیط کشت DMEM حاوی ۱۵ درصد سرم گاوی به سلول­ها اضافه و به انکوباتور با دمای ۳۷ درجه سانتی‌گراد منتقل شد.

 

بررسی مورفولوژی و پتانسیل تمایز سلول­های Bm-MSCs  و Ad-MSCs به دودمان­های اسکلتی: به منظور اثبات مزانشیمی بودن سلول­های جدا شده از مغز استخوان و بافت چربی، ابتدا مورفولوژی آن‌ها بررسی و سپس پتانسیل تمایز آن‌ها به دودمان­های اسکلتی بررسی شد. سلول­های  Bm-MSCsو Ad-MSCs هر دو مورفولوژی دوکی شکل و فیبروبلاستی کشیده داشته و با ایجاد کلنی­های سلولی تکثیر شده و جمعیت همگن و یکدست را تولید کردند. برای بررسی تمایز این سلول­ها به غضروف‌ از روش‌ کشت‌ پلت (Micro mass) به این ترتیب استفاده شد که ۱۰۵×۲-۳ سلول‌ حاصل‌ از پاساژ ۳ بوسیله لام نئوبار شمارش شد و در لوله‌ ۱۵ میلی‌لیتر سانتریفوژ شد تا پلت‌ سلولی تشکیل شد، سپس‌ محیط رویی‌ تخلیه‌ شده‌ و محیط تمایز کندروژنیک شامل محیط DMEM حاوی ۱۰۰ میکروگرم پیرووات، ۲۵/۶ میلی­گرم انسولین (ایران؛ SUPA)، ۱۰ نانوگرم فاکتور رشد TGF- 3 (Transforming Growth Factor Beta 3)، ۱۰ مولار دگزامتازون (آمریکا؛ sigma)، ۲۵/۶ میلی­گرم ترانسفرین، ۲۵/۶ میلی­گرم سلنیوس اسید، ۵۰ میکروگرم اسکوربیک ۲-فسفات، ۳۵/۳ میلی­گرم لینولئیک اسید و ۱۰ نانوگرم BMP-6 و ۱ درصد سرم گاوی اضافه ‌شد.‌ محیط تمایز هر ۴-۳ روز یکبار به‫مدت ۳ هفته‌ تعویض شد. برای ارزیابی تمایز به غضروف از روش رنگ­آمیزی اختصاصی تولوئیدین بلو استفاده شد. برای این منظور، نمونه­ها به‫روش روتین بافتی پردازش و برش­های ۵ میکرومتری از آن‌ها تهیه شد. به‫طور خلاصه، سلول­ها به مدت ۲ ساعت در پارا فرمالدهید ۴ درصد فیکس شدند. سپس‌ به‫ترتیب با استفاده از الکل و زایلول آب‫گیری و شفاف­سازی و در انتها در پارافین‌ قالب­گیری شدند و با استفاده از میکروتوم، برش­های‌ ۵ میکرومتری تهیه‌ شد. به‫منظور رنگ­آمیزی، رنگ تولوئیدین بلو به‌‫مدت‌ ۳۰ ثانیه‌ در دمای‌ اتاق‌ به‌ سلول­ها اضافه‌ و در انتها رنگ اضافی با آب مقطر شسته شد. بـرش­های رنگ شده با استفاده از میکروسکوپ نوری مشاهده شدند.

برای بررسی تمایز به استخوان و چربی سلول­های حاصل از پاساژ دوم، پس از ذوب، در ظرف کشت ۶ خانه­ای کشت شدند. پس از پر شدن ۸۰-۷۰ درصد ظرف کشت، محیط تمایز استخوان و چربی، به صورت مجزا جایگزین محیط کشت سلولی شد. محیط استئوژنیک شامل محیط DMEM، ۱۰ درصد سرم FBS، ۱۶/۲ گرم در لیتر ۶-گلیسرول فسفات و ۱۹۶۰ میکرولیتر دگزامتازون و محیط آدیپوژنیک شامل محیط DMEM حاوی ۱۰ درصد سرم گاوی و ۰۵۰/۰ میلی­گرم ‌ اسکوربیک اسید، ۱۹۶۰ میکرولیتر دگزامتازون، ۰۵۰/۰ میلی­گرم ایندومتاسین استفاده شد. محیط هر ۴-۳ روز یکبار به‫مدت ۲۱ روز تعویض شد. در پایان هفته سوم، تمایز سلول­ها به استخوان با استفاده از رنگ‌آمیزی‌ اختصاصی‌ آلیزارین رد (Alizarin red) و تمایز به چربی با رنگ­آمیزی اویل رد (Oil red) ارزیابی شد. به این ترتیب که ابتدا سلول­ها به‫مدت ۲۰ دقیقه‌ با فرمالین ۱۰ درصد در دمای اتاق فیکس‌ شدند. سپس سلول­ها به‫مدت ۲۰ دقیقه‌ با رنگ آلیزارین رد، برای بررسی تمایز به استخوان و با رنگ ۵/۰ درصد اویل رد در متانل، برای بررسی تمایز به چربی رنگ‌آمیزی‌ شدند. در آخر نیز شستشو با آب‌ مقطر انجام شد تا رنگ‌ اضافی‌ خارج‌ شد. تشکیل مواد معدنی استخوانی و یا قطرات چربی با استفاده از میکروسکوپ نوری بررسی شد.

بررسی بیان ژنی با استفاده از تکنیک RT-PCR: بررسی بیان ژن­های اختصاصی بافت­های استخوانی، چربی و غضروفی مشابه مطالعه پیشین گروه حاضر انجام شد(26). در ابتدا با استفاده‌ از کیت Nucleospin RNA II kit (740955; Macherey-Nagel, Germany) کل‌RNA  سلول­های تمایز یافته به استخوان، چربی و غضروف استخراج‌ شد. نمونه‌های‌RNA  استخراج‌ شده‌ با (104132.Roch) Dnase I تحت‌ تیمار قرار گرفتند تا آلودگی‌های‌ احتمالی‌ مربوط به ‌ DNAژنومیک‌ از نمونه‌های‌RNA  حذف‌ شود. سپس‌ خلوص و غلظت‌ RNA استخراج‌ شده‌ با روش‌ اسپکتروفوتومتری‌ تعیین‌ شد. در ادامه یک میکروگرم‌ از RNA استخراج‌ شده با استفاده ‌از پرایمر Random Hexamer وکیت‌(K (Fermentas) Revert AidTMH Minus First Strand cDNA Synthesis  نسخه‌برداری‌ معکوس‌ شد. سپس‌ ازcDNA  تولیدشده‌ به‫عنوان الگو برایPCR  استفاده شد. برای‌ این‌ منظور حجم 2 μl cDNA(100ng/μl)، 2/5 μl(10x) PCR Buffer (AMS)، 0/75 μlMgC  (50mM) و 0/5dNTPmix μl(10mM) از هر پرایمر 1 μl (5 μM)، 0/5Smar Taq μl (5unit/1 μl) (سیناژن، TA8110C) در یک لوله PCR با هم ترکیب شده و  در نهایت‌ با استفاده‌ از آب‌ دوبار تقطیر به‌ حجم ۲۵ میکرولیتر رسانده‌ شد. برای پی­بردن به بیان ژن­های مورد مطالعه در این تحقیق از پرایمرهای جدول ۱ استفاده شد.

 

جدول 1: لیست پرایمرهای استفاده شده در مطالعه حاضر

Aannealing Time

Sequence

Gene Name Primer

Accession Number

59

F: 5' ttg gac ttt ggc aga ata cc 3'

R: 5'ctt cca cca atg tcg tat cc 3'

Aggrecan

FJ200438

58

F: 5' gcg gag act act gga ttg

R: 5' ttt ctt gtc ctt gct ctt gc 3'

Collagen II

FJ200439

60

F: 5' agaacaaggaagcggaagtc 3'

R: 5' atcccgtctttgttcatcac 3'

PPAR alpha

FJ200440

60

F: 5' aagagcagagcaaagaggtg3'

R: 5' gggcttcacattcaacaaac 3'

PPAR gama

FJ200441

59

F: 5’ ccc aga aca tca cct acc ac 3’

R: 5’ gga ggg agt tta cag gaa gc 3’

Coll I

FJ200442

60

F: 5' tct ctt ggg ata cag cct tg 3'

R: 5' atg ccc tac tgg ttt ctg 3'

LPL

FJ200435

58

F: 5' act gag cga tac caa aca cc 3'

R: 5'ggt cca ttt agt cct ctc tcc 3'

Coll X

XM001504101.1

60

F: 5' gga gaa acc tgc caa gta tg 3'

R: 5' tga gtg tcg ctg ttg aa gtc 3'

GAPDH

DQ152956.1

59

F: 5'agc gag gtg gtg aag aga c 3'

R:5'gct cat cac agt cag ggt tg 3'

Osteocalcin

NM-001040009.1

60

F: 5' ttg atg gtg cta ctt tga a 3'

R: 5' aac atc ctc ctt caa cag c 3'

Collagen type III

XM-001917620.1

 

 

جداسازی، کشت و تکثیر سلول­های کندروسیت: بافت غضروف هیالین تحت بی­حسی موضعی از انتهای دنده آخر گوسفند در شرایط استریل جداسازی شد سپس در محلول PBS- حاوی یک درصد آنتی بیوتیک به  پژوهشگاه رویان منتقل شد. پس از ۳ تا ۴ بار شستشوی نمونه­ها با PBS- در زیر هود لامینار کلاس II بافت­های همبند موجود در اطراف غضروف به‫طور کامل جدا و لایه غضروف به تکه­های کوچک تقسیم شد. کشت و تکثیر سلول­های کندروسیت مشابه روشی که مطالعه پیشین گروه حاضر ارائه شده است، انجام شد (28). به این‫ترتیب که بافت غضروف ابتدا  به تکه­های ۳-۲ میلی­متری برش شده و  سپس یک میلی­لیتر محلول ۲/۰ درصد کلاژناز تیپ I و ۱/۰ درصد پروناز (حل شده در محیط بدون سرم) به‫مدت ۲۴ ساعت در انکوباتور در دمای ۳۷ درجه سانتی گراد نگه­داری شد. سپس کندروسیت‌های رها شده از غضروف به‫کمک فیلتر مش ۲/۰ میکرومتری جدا شده و در فلاسک‌های کشت ۷۵ سانتی‫متری کشت شد و ۱۰ میلی لیتر محیط کشت حاوی ۱۵% سرم گاوی اضافه و سپس به انکوباتور منتقل شد. کندروسیت‌ها پس از ۲۴ ساعت به کف ظرف چسبیده و شروع به تکثیر کردند. پس از یک هفته کندروسیت‌ها به‫کمک Trypsin-EDTA  2/0 درصد از کف ظرف کنده شدند و به ظرف جدید انتقال یافتند. یک هفته پس از پاساژ اول، پاساژ دوم انجام شد.

 

آماده­سازی سلول­ها برای انجام پیوند:  برای انجام پیوند سلولی نیاز به کشت سه بعدی آن‫ها بود. بنابراین سلول­های کندروسیت­ها، Bm-MSCs و Ad-MSCs به‫روش سه بعدی در ژل کلاژن I مشابه مطالعه قبلی گروه حاضر کشت شدند (29). ابتدا سلول­های حاصل از پاساژ ۲-۳ به‫کمک محلول Trypsin-EDTA  2/0 درصد از کف ظرف کنده شد و پس از رنگ‌آمیزی با رنگ حیاتی PKH (Sigma, USA) به‫کمک لام نئوبار شمارش سلولی انجام گرفت و سلول­ها با تراکم ۱۰۶×۳-۲ در ۱ میلی­لیتر محلول کلاژن I (Koken ،Japan) شناور شده و سپس با توجه به اندازه آسیب تجربی ایجاد شده در غضروف مفصلی زانوی گوسفند، ۲ میلی‌لیتر کلاژن حاوی سلول در محلول ژل­کننده کلاژن (ایجاد شده بر اساس دستورعمل شرکت تولید کننده) منتقل شده و به فرم ژل در آمد. این مراحل به‫طور کامل بر روی یخ انجام شد و سپس ژل حاوی سلول به انکوباتور در دمای ۳۷ درجه سانتی­گراد به‫مدت ۲۰ دقیقه منتقل شد و پس از اطمینان از بسته شدن ژل، بافر PBS-حاوی ۱ درصد سرم گاوی به سازه مورد نظر اضافه شد و سپس در شرایط آسپتیک با استفاده از انکوباتور پورتابل دستی به محل نگه­داری حیوانات، جهت انجام عمل جراحی منتقل شد.

ایجاد مدل کندگی غضروف و پیوند سازه­های سلولی: برای این منظور تحت شرایط استریل و توسط جراح دامپزشک ابتدا بی‫هوشی کامل حیوانات مشابه روش قبلی انجام شد. هم‫زمان  با ایجاد کندگی غضروف، پیوند سازه سلولی آماده شده از قبل در محل پیوند مورد نظر انجام شد. به این‫ترتیب که ابتدا حیوانات تحت بیهوشی عمومی بیهوش شده و سپس زانوی حیوان پس از انجام استریل سازی با محلول بتادین و شیو محل، از قسمت میانی کشکک باز شد. تمام بافت­های پوشاننده زانو در ناحیه فمور برداشته شدند. سپس به‫کمک دستگاه میکروموتور دندانپزشکی و سر مته مخصوص دفکتی با ابعاد ۴×۴×۲ میلی‫متر بر روی دو کندیل جانبی و میانی فمورال ایجاد شد. در مرحله بعد سازه سلولی در محل دفکت مورد نظر قرار داده شد. سپس توسط  بافت پریوستئال  که از سطح قدامی تیبیای خود حیوان برداشته شده بود، کاور شده و با سوچورهای قابل جذب به غضروف سالم اطراف فیکس شد. حیوانات تحت نگه‫داری در شرایط استریل و آب و غذای در دسترس تا  ۶ ماه برای التیام بافت نگه‫داری شدند. سپس نمونه­ها پس از انجام مرگ استاندارد جمع‫آوری و برای آنالیزهای بافتی، پاتولوژی و مولکولی استفاده شدند.

 

شکل 1: عمل جراحی قبل و بعد از پیوند سازه‌ی سلولی. A) آماده­سازی و کشت سلول­های Bm-MSCs، Ad-MSCs و کندروسیت­ها در ژل کلاژن I، B) رنگ­آمیزی H&E زنده­مانی سلول­ها در ژل کلاژن را نشان می­دهد.C ) ایجاد آسیب مدل کندگی غضروف با سایز بحرانی، D وE) پیوند سازه سلولی در محل آسیب ایجاد شده و بخیه لایه بافت پرییوست بر محل پیوند، F) نمونه غضروف مفصلی پس از ۸ هفته از زمان پیوند سازه سلولی.

 

بررسی ترمیم بافت غضروف: میزان ترمیم غضروف مفصلی به دو روش ماکروسکوپی و سیستم امتیاز دهی پاتولوژی و همچنین بررسی میکروسکوپی و تهیه نمونه بافتی انجام شد. بررسی نمونه­ها از نظر نوع بافت تشکیل شده در محل یعنی بافت غضروف هیالین و یا غضروف فیبرو انجام شد.

بررسی ماکروسکوپی: برای بررسی ترمیم بافتی، توسط پاتولوژیست حاذق چهار score بافتی تعریف شد و نمونه‌های تمام گروه‌ها بر اساس مشاهدات ۵ فرد، score و شماره­دهی شد. چهار متغیر اصلی در هر یک از ۳۲ نمونه بافت شناسی اندازه­گیری شدند. متغیر اول (Score 1) میزان "غضروف تازه تشکیل شده" در هر ضایعه بود که به‫صورت درصد بیان شد. این متغیر توسط عکس­برداری از مناطق مختلف ضایعه و سپس محاسبه میانگین درصد سطح غضروف تشکیل شده نسبت به کل سطح به‫دست آمد. متغیر دوم (Score 2) "میزان داربست باقی­مانده" در هر ضایعه است. ماده کلاژن که به‫عنوان داربست به‫همراه سلول­های بنیادی استفاده شد، به مرور تحلیل می­رود تا غضروف جدید جایگزین آن شود. این متغیر نیز به‫وسیله عکس برداری از مناطق مختلف هر ضایعه و محاسبه میانگین درصد سطحی کلاژن به‫دست آمد. همچنین Score 3 "صاف و صیقلی بودن سطح بافت ترمیم شده" یکی از شاخص­های اصلی در نظر گرفته شد و در نهایت Score 4  "پر شدن کامل دفکت" مد نظر بود (جدول ۲).

 

 

جدول 2. بررسی ماکروسکوپی ترمیم غضروف مفصلی به صورت ماکروسکوپی براساس امتیاز دهی در 4-Score

groups

Score 1

Score 2

Score 2

Score 4

BmMSCs

0

2

2

4

AdMSCs

0

3

2

2

Chondrocyte

0

1

2

5

Control

6

2

0

0

 

بررسی هیستوپاتولوژی نمونه­ها: ابتدا آماده­سازی نمونه‌های بافتی، کلسیم‌زدایی و تهیه‌ی لام بافتی انجام شد. به این‫ترتیب که نمونه­های جدا شده به محلول تثبیت‌کننده‌ی فرمالین ۱۰ درصذ انتقال یافت. به‌دلیل وجود کلسیم در نمونه‌ها، قبل از تهیه‌ی نمونه‌ی بافتی، نیاز به عمل کلسیم‌زدایی است. لذا بر اساس مطالعات و بررسی‌های به‌عمل آمده برای این منظور از محلول کلسیم‌زدای اسید نیتریک ۵ درصد استفاده شد.

برای انجام رنگ­آمیزی ابتدا برش­های بافتی به‌مدت ۱۰ دقیقه با زایلین شفاف‌سازی شدند و پارافین اضافه در اطراف بافت‌ها برداشته شد. سپس در شیب غلظت الکل ۱۰۰ تا ۷۰ درصد و آب به‫مدت ۳ دقیقه آب‌دهی شدند. پس از آن نمونه­ها به‌مدت ۴ دقیقه در هماتوکسیلین قرار داده شدند تا هسته‌ی سلولی نمایان شده و سپس به‌مدت ۲ دقیقه در ائوزین شناور شد تا سیتوپلاسم سلول نمایان شد. رنگ‌آمیزی فست گرین-سافرانین O به‫طور اختصاصی برای رنگ آمیزی بافت‌های حاوی کلاژن همانند استخوان (رنگ سبز و بافت غضروف (رنگ قرمز) استفاده شد. برای این منظور پس از غوطه­ورسازی در رنگ هماتوکسیلین، به‌مدت ۳ دقیقه شستشو با آب انجام شد. سپس نمونه‌ها به‌مدت ۹-۸ دقیقه در رنگ فست گرین غوطه‌ور شدند تا رشته‌های کلاژن به‌طور اختصاصی به رنگ سبز درآمدند. سپس شستشو با آب مقطر صورت گرفت و لام‌ها ۲۰-۱۰ ثانیه در سافرانین O قرار داده شدند تا بافت غضروف قرمز رنگ شد. در نهایت شستشو با آب مقطر به‫مدت ۳ دقیقه انجام شده و نمونه‌ها به ترتیب داخل الکل ۷۰ تا ۱۰۰ درصد آب‌‌گیری و برای شفاف‌تر شدن، ۱۰ دقیقه در زایلین قرار داده شد و سپس در زیر میکروسکوپ نوری مشاهده و بررسی شدند.

3-آنالیز آماری

حجم نمونه با توجه به نتایج مطالعات گذشته و با سطح اطمینان ۹۵ درصد و مقدار خطای مجاز ۰۵/۰ برابر با ۱۲ محاسبه شد. بعد از جمع­آوری اطلاعات، ابتدا داده­ها وارد نرم افزار آماری prism شد و میانگین درصد تشکیل غضروف، میانگین داربست باقی­مانده و میزان التهاب در هر ضایعه و برای هر گروه تعیین شد. سپس میزان تفاوت آماری میانگین ترمیم هر ضایعه با استفاده از آنالیز آماری One way ANOVA بررسی و همچنین برای مقایسه دو گروه با هم از scheffe post hoc multiple comparison استفاده شد.

 

4-نتایج

سلول­های بنیادی مزانشیمی Bm-MSCs و Ad-MSCs و بررسی خصوصیات آن

حدود ۵-۴ روز پس از آغاز کشت، سلول­های Bm-MSC و Ad-MSC به کف ظرف چسبیدند. هر دو نوع سلول در کشت اولیه، مورفولوژی شبه فیبروبلاستی(دوکی) و موجی شکل داشتند (شکل2 - A). سپس با انجام پاساژ سلولی، سلول­ها تکثیر شدند و جمعیت آن­ها افزایش یافت. هر دو نوع سلول Bm-MSCs وAd-MSCs  پتانسیل تمایز به غضروف را نشان دادند. گلیگوزآمینوگلیکان­های ماده زمینه غضروفی با استفاده از رنگ تلوئیدن بلو به رنگ بنفش نمایان شدند که نشان­دهنده ترشح ترکیبات گلیکوپروئینی سولفاته از جمله اگریکان بود. همچنین بر اساس بررسی­های Real-time PCR ژن­های اختصاص بافت غضروف یعنی COL II، ACAM و COL X در سلول­های تمایزیافته بیان شده بود. در تمایز به استخوان ندول­های معدنی و ترشح کلسیم در بین سلول­ها از هفته اول مشاهده شد. این ندول­ها پس از ۲۱ روز افزایش یافته و به‫دنبال رنگ آمیزی آلیزارین رد، قرمز رنگ شدند که حاکی از معدنی شدن ماتریکس بود. همچنین نتایج Real-time PCR حاکی از بیان معنی­دار ژن­های COL I و COL III و ژن OCN بود (شکل 2 - B). هر دو نوع سلول همچنین پتانسیل تمایز به چربی را به‫خوبی نشان دادند و قطرات چربی ۴ روز بعد از القای آدیپوژنیک در سیتوپلاسم سلول­ها شروع به تشکیل کردند. سپس طی ۲۱ روز اندازه این قطرات افزایش سایز دادند و در رنگ‫آمیزی اویل رد به رنگ قرمز درآمدند. بررسی Real-time PCR نشان داد که در توده­های سلولی تمایزیافته، ژن­های اختصاصی بافت چربی از جمله LPL، PPR-g و PPr-a بi‫طور معنی­داری بیان شده است.

 

 

شکل 2: سلول­های بنیادی مزانشیمی و مشخصه یابی آن‫ها، A) تصویر سلول­های بنیادی مزانشیمی جدا شده از مغز استخوان (a) و تمایز به استخوان (b)، چربی (c) و غضروف (d)را نشان می­دهد. تصویر سلول­های بنیادی مزانشیمی جدا شده از بافت چربی (e) و تمایز به استخوان (f)، چربی (g) و غضروف (h) را نشان می­دهد. B) بررسی Real-time PCR ، بیان ژن­های استخوانی (a)، چربی (b) و غضروفی (c) را نشان می­دهد *)p<0.05(.  

کشت و تکثیر کندروسیت­ها و بررسی خصوصیات آن

پس از کشت کندروسیت­های جدا شده و تکه­های باقی­مانده بافت غضروف، کندروسیت­های آزاد به کف ظرف کشت چسبیده و کندروسیت­های موجود در تکه­های بافت نیز از نواحی حاشیه‌ای بافت چسبیده به کف ظرف شروع به مهاجرت کرده و کف ظرف کشت پراکنده شدند. کندروسیت­ها در کشت اولیه مورفولوژی پنج و شش ضلعی و در برخی موارد گرد داشتند و از نظر اندازه بسیار کوچک بودند. در طی پاساژهای بعدی مورفولوژی کندروسیت­ها از فرم گرد به سلول­های کشیده و دوکی شکل تغییر کرد و از نظر اندازه ۳-۲ برابر بزرگ‫تر از کندروسیت­ها در کشت اولیه شدند.

 

 

 

شکل 3: تصویر کندروسیت‌های جدا شده از بافت غضروف دنده‌ای و بررسی بیان ژن­های غضروفی. A) تصویر کشت اولیه و اتصال کندروسیت­ها به سطح ظرف کشت را نشان می­دهد (a)، اتصال اکسپلنت غضروفی و مهاجرت کندروسیت­ها از بافت در کف ظرف (b)، تکثیر و تراکم کندروسیت­ها در کف ظرف پس از کشت دوم (c)، B) نمودار بیان ژن­های اختصاص بافت غضروفی را در مقایسه با سلول­های Bm-MSCs نشان می­دهد ***: p<0.001, ****: p<0.0001)). 

بررسی ترمیم بافت غضروف

یک هفته بعد از عمل جراحی و پیوند سازه سلولی، محل زخم بهبودی کامل یافته و در هیچ مورد عفونت زخم مشاهده نشد. تنها در دو مورد به‫دلیل مشکل گوارشی ناشی از مصرف آنتی­بیوتیک کوآموکسی کلاو نیاز به تزریق زیر جلدی سرم قندی نمکی ایجاد شد.

 بررسی ماکروسکوپی ترمیم: بررسی ظاهری در گروه Untreated نشان داد که ترمیم خودبخودی و تشکیل بافت غضروف صورت نگرفته است. در حالی‫که در نمونه­های دریافت کننده سلولی یعنی Bm-MSCs، Ad-MSCs و کندروسیت تشکیل غضروف جدید مشاهده شد. سطح برخی از نمونه­ها به‫طور کامل صاف، پر و صیقلی شد. در حالی‫که در برخی از نمونه­ها این ترمیم کم‫تر مشاهده شد. برای هر گروه آزمایشی تعداد سه پیوند انجام شده بود که بررسی­های ظاهری برای هر گروه در شکل 4 مشخص شده است. بررسی­های ظاهری نشان داد که ایجاد غضروف جدید در تمام گروه­های آزمایشی مشاهده شد. اگرچه این ترمیم نسبت به گروه کنترل معنی­دار بود ولی اختلاف معنی­داری بین گروه­های آزمایشی Bm-MSCs، Ad-MSCs و کندروسیت مشاهده نشد.

 

 

شکل 4:  بررسی ماکروسکوپیک ترمیم آسیب مفصلی. A) گروه سالم،B ) در گروه Untreated آسیب مفصلی ترمیم مشاهده نشد، C) در گروه Sham (دریافت کننده ژل( ترمیم مشاهده نشد، D, E) در گروه­های دریافت کننده Bm-MSCs و Ad-MSCs نیز پرشدگی و ایجاد غضروف شبه هیالین مشاهده شد.، F) در گروه کندروسیت آسیب مفصلی پر شده غضروف شفاف و صیقلی شبه هیالین مشاهده شد.

 

 

همچنین بررسی شاخص‫های مهم ترمیم از جمله تشکیل بافت غضروف جدید، سختی و صاف و صیقلی بودن سطح بافت (درجه­بندی ترمیم بافت از نظر پاتولوژیست) در ۳۲ نمونه بافتی اندازه­گیری شدند و نتایج نشان داد که بین گروه‫های مختلف دریافت کننده سلول تفاوت معنی‫داری وجود ندارد.

 

شکل 5:  بررسی شاخص­های ترمیم از نظر پاتولوژی. نمودار نشان دهنده شاخص‌های ترمیم، از جمله تشکیل بافت غضروف جدید، سختی و صاف و صیقلی بودن سطح بافت ایجاد شده است.

 

بررسی هیستوپاتولوژی نمونه­ها: رنگ‌آمیزی H&E برای بررسی‌های هیستوپاتولوژی، زنده‌مانی سلول‌های پیوند شده و ایجاد بافت­های جدید در محل پیوند استفاده شد. نتایج حاصل از این رنگ‌آمیزی نشان داد که تمامی نمونه‌ها دارای سلول‌های زنده بوده و نشانی از آپوپتوزیس سلولی و نکروزیس بافتی مشاهده نشد. در گروه Untreated و sham گروه دریافت­کننده ژل کلاژن بدون سلول تشکیل بافت جدید غضروف مشاهده نشد و استخوان ساب کندرال باقی‌مانده قابل مشاهده بود. در گروه Bm-MSCs و Ad-MSCs و کندروسیت تشکیل توده‌ی غضروفی جدید مشاهده شد و نشانی از تحلیل استخوان ساب کندرال مشاهده نشد. تشکیل غضروف جدید غیرطبیعی (abnormal) در هیچ گروهی مشاهده شد. اگرچه تشکیل بافت غضروف جدید در تمام گروه­های دریافت ­کننده سلول مشاهده شد؛ بررسی بیشتر در گروه Bm-MSCs و کندروسیت نشان داد که بافت جدید تشکیل شده شباهت بیشتری با ساختار غضروف هیالین دارد. همچنین بافت غضروف شبه فیبروز روی استخوان ساب کندرال در گروه sham تشکیل شده بود که احتمالا به‫دلیل مهاجرت سلول­های بنیادی مزانشیمی از استخوان ساب کندرال در درون ژل کلاژن بود. رنگ‌آمیزی Safranin O/Fast green بافت‌های دارای رشته‌های کلاژن نوع ، از جمله استخوان را سبز و غضروف را قرمز متمایل به نارنجی نمایان کرد. از این رنگ‌آمیزی برای مشخص نمودن و تفکیک بهتر اجزای بافتی و همچنین نمایش بافت استخوان استفاده شد. در تمامی نمونه‌ها بافت استخوان سبز، بافت غضروف به رنگ قرمز نمایان شد. در گروه Bm-MSCs و Ad-MSCs غضروف تازه تشکیل شده بیش‌ترین شباهت را به غضروف هیالین داشت.

 

شکل 6:  بررسی هیستوپاتولوژی ترمیم غضروف مفصلی. a) نمونه سالم که بافت غضروف هیالین سالم مشاهده شد، b) بر اساس رنگ­آمیزی H& E در گروه Untreated هیچ‫گونه ترمیم بافتی و پرشدگی مشاهده نشد، C) در گروه Sham بافت شبه فیبری در محل پیوند ژل کلاژن بدون سلول مشاهده شد، d,e) در گروه­های دریافت کننده سلول بنیادی تا حدود زیادی بافت شبه غضروف هیالین ایجاد شد و سلول­ها در ساختارهای شبه لاکونا مشاهده شد، f) در گروه دریافت کننده کندروسیت بیشترین میزان تشکیل بافت شبه غضروفی مشاهده شد.

 

5-بحث

در سال­های اخیر استفاده از سلول­های MSCs برای ترمیم انواع بیماری­ها مورد استفاده شده و نتایج قابل قبولی در بسیاری موارد مشاهده شده است (30). به‫طور مثال استفاده از این سلول­ها در درمان آسیب­های مفصلی بافت استخوان و غضروف از جمله استئوآرتریت ((OA و روماتوئید آرتریت (RA) نتایج چشم­گیری نشان داده است (3, 12-14, 16, 19, 20, 30). با توجه به این‫که سلول­های MSCs جدا شده از منابع مختلف سلولی اثربخشی متفاوتی در مطالعات مشابه نشان داده است، یکی از چالش­های اصلی در سلول درمانی بیماری OA انتخاب منبع سلولی مناسب است (20). این تفاوت­ها نه تنها در منابع سلولی آلوژن بلکه در منابع سلولی اتولوگ هم مشاهده شده است. لذا بررسی منابع مختلف سلولی در شرایط کاملا یکسان یکی از روش­هایی است که می­توان تا حدودی نتیجه­گیری منطقی و قابل قبولی برای یافتن بهترین منبع سلولی ارائه دهد. علاوه بر سن، گونه منبعی که سلول MSCs از آن جداسازی می­شود، کشت سلول­های بنیادی در آزمایشگاه­های مختلف با استفاده از ترکیبات، مواد و تجهیزات آزمایشگاهی متفاوت بر کیفیت و خصوصیات تکثیری و تمایزی آن سلول تاثیر به‫سزایی دارد (31). برای این منظور در مطالعه حاضر تمام متغیرهای نامبرده که باعث تغییر در نتیجه تحقیقات می­شود، حذف شده است و سلول‫ها در شرایط کاملا یکسان جداسازی، کشت و آماده­سازی نمونه و هم‫چنین پیوند سازه سلولی انجام شد. همچنین در این مطالعه برای حذف عوامل تاثیرگذار حاصل از منابع آلوژن و حفظ تمام شرایط یکسان و خطر ریسک آلودگی در پیوند و پتانسیل بهتر در ترمیم، از منابع سلولی اتولوگ استفاده شد. لذا با توجه به مطالعات پرکاربردترین منابع سلولی برای سلول درمانی OA یعنی سلول­های کندروسیت، سلول­های Bm-MSCs و Ad-MSCs انتخاب، به‫صورت هم‫زمان از بافت مربوطه جداسازی و در شرایط کاملا یکسان آزمایشگاهی تکثیر و در ضایعه تجربی غضروف ایجاد شده با سایز بحرانی در زانوی گوسفند پیوند زده شد.

از آن‫جایی‫که تنها سلول موجود در بافت غضروف مفصلی کندروسیت است، مطالعات نشان داده که این سلول­ها بهترین منبع سلولی برای درمان ضایعات و آسیب­های مفصلی است. از طرف دیگر چالش­های استفاده از کندروسیت­ها در آزمایشگاه مثل کمبود بافت قابل استفاده، ایجاد آسیب ثانویه برای جداسازی بافت، تمایززدایی سلول­ها در آزمایشگاه در زمان تکثیر، از معایب عمده و محدودکننده استفاده از این منبع است (32-34). در مطالعه حاضر ما این سلول‫ها را بافت غضروف هیالین انتهای دنده گوسفند جداسازی کردیم. نتایج ما نشان داد کندروسیت‌های کشت شده در شرایط آزمایشگاهی نه تنها ظاهر چندوجهی و گرد اختصاصی کندروسیت ها را حفظ کردند بلکه ژن‫های اختصاصی بافت غضروف که با روش Real-time PCR بررسی شد را نیز به‫طور معنی‫داری بیان کردند (شکل 3). از طرفی نتایج حاصل از مطالعه حاضر نیز نشان داد بهترین میزان ترمیم و ایجاد بافت شبه هیالین در گروه کندروسیت اتفاق افتاده است (شکل ۳-۶). لذا نتایج تاییدی بر مناسب بودن سلول­های کندروسیت به‫عنوان اولین منبع سلولی برای درمان بیماری­های غضروفی است. اما با توجه به مشکلات نامبرده در استفاده از کندروسیت­ها، انتخاب یک منبع سلولی جایگزین با نتایج قابل قبول و بدون محدودیت استفاده از کندروسیت­ها می­تواند تا حدود زیادی برای بیماران رضایت­بخش باشد. از طرفی چالش­های استفاده از کندروسیت­ها در مواردی که آسیب وارده به بافت غضروف وسیع باشد بسیار بغرنج­تر خواهد بود.

سلول­های MSCs حاصل از منابع سلولی در دسترس یا اتولوگ برای بیماران مثل بافت مغز استخوان و چربی می­تواند کاندید مناسبی برای جایگزینی سلول­های کندروسیت باشد. در مطالعه حاضر استفاده از سلول­های Bm-MSCs و Ad-MSCs در شرایط کاملا یکسان نشان داد که هر دوی این سلول­ها توانایی تکثیر و پتانسیل تمایز به استخوان و غضروف بالایی را دارند (شکل ۱). در واقع خصوصیات این سلول­ها در آزمایشگاه کاملا یکسان بوده و برتری نسبت به هم نداشت، با توجه به اینکه این سلول­ها از یک حیوان جداسازی شده بودند و متغیرهای موثر برای ایجاد خطا حذف شده بود، می­توان نتیجه گرفت که هر دوی این سلول­ها برای مطالعات مشابه مناسب هستند. در مطالعات قبلی هر دو منبع سلولی Bm-MSCs و Ad-MSCs برای ترمیم OA در مدل‫های حیوانی و همچنین کارآزمایی بالینی استفاده شده است اگرچه نتایج در تمام مطالعات نشان دهنده مناسب بودن سلول و اثر بخشی آن در ترمیم بوده است. (39-36). اما به‫دلیل اینکه مطالعات در شرایط مجزایی و در مدل‫های حیوانانی متفاوتی انجام شده است نمی‫توان نتیجه گیری قطعی برای انتخاب بهترین منبع سلولی را ارائه داد. ما در شرایط کاملا یکسان و در یک مدل حیوانی هر سه گروه سلولی را پیوند زدیم پس تمام عوامل متغیر از مطالعه حذف شده است. همانطور که در شکل 4 تصاویر ماکروسکوپی نشان می‫دهد در تمامی گروه‫های سلول درمانی (D-F) پرشدگی محل آسیب نسبت به گروه های کنترل (A-C) به‌طور واضح مشخص است. لذا برای اطمینان از نتیجه به‫دست آمده با توجه به تعداد تکرارها برای هر گروه آزمایشی و امتیاز دهی میزان ترمیم توسط پاتولوژیست از لحاظ  میزان غضروف جدید تشکیل شده، صافی سطح غضروف تشکیل شده و ضخامت بافت تشکیل شد، در شکل 5 نتایج به‫صورت نمودار ترمیم ترمیم و مقایسه شد. نتایج این بررسی نشان داد محل آسیب با استفاده از سلول­ها نسبت به گروه Untreated و Control  (دریافت کننده ژل) کاملا پر شده و سطح صاف و صیقلی ایجاد شده است، اما اختلاف معنی­داری بین گروه­های کندورسیت، Bm-MSCs و Ad-MSCs مشاهده نشد. از طرفی مهم است که نتایج از نظر بافت شناسی و پاتولوژی نیز تایید شود و مشخص شود که پرشدگی از طریق تشکیل بافت غضروف هیالین اتفاق افتاده یا بافت غضروف فیبرو لذا برای بررسی دقیق تر ما برش‫های بافتی تهیه کرده و به چند روش اختصاصی رنگ آمیزی بافتی انجام دادیم (شکل 6). نتایج این بررسی نشان داد که در تمامی گروه‫های دریافت کننده سلول بافت غضروف شبه هیالین تشکیل شده است و آسیب غضروفی کاملا پر شده است. در نمونه های دریافت کننده کندروسیت ضخامت بافت تشکیل شده بیشتر بوده و بافت جدید ایجاد شده به‫طور مشخص ظاهر غضروف هیالین دارد که همان‫طور که در مطالعات قبلی هم اشاره شده بود کندروسیت بهترین منبع برای بازسازی غضروف مفصلی است (40). اما برای معرفی یک جایگزین سلول بنیادی نتایج این مطالعه نشان داد که اختلاف معنی‫داری بین گروه دریافت کننده سلول BM-MSCs و گروه AD-MSCs وجود ندارد.

 

6-نتیجه گیری

نتایج ما همانند سایر مطاعات گذشته تایید می‫کند که سلول‫های کندروسیت به‫عنوان بهترین منبع سلولی برای ترمیم ضایعات غضروف مفصلی است. ولی با توجه به محدودیت‫های ذکر شده در بالا در استفاده از کندروسیت‫ها مطالعات نیاز به منبع سلولی جایگزین با محدودیت‫های کمتر و اثربخشی بالا را نشان می دهد. لذا سلولهای MSCs از جمله BM-MSCs و AD-MSCs منابع جایگزین مناسبی هستند اگر چه تا کنون بررسی جامعی صورت نگرفته تا مشخص شود از بین این دو منبع سلولی کدام مناسب‫تر است. مطالعه حاضر برای پاسخ به این سوال طراحی و انجام شد و نتایج بررسی‌های ماکروسکوپی و هیستوپاتولوژی اختلاف معنی داری بین دو گروه BM-MSCs و AD-MSCs را از لحاظ میزان ترمیم نشان نداد لذا با توجه به اینکه دسترسی به بافت چربی و جداسازی Ad-MSCs نسبت به سلول­های Bm-MSCs راحت‫تر و کم خطرتر بوده و همچنین عوارض کم‫تری دارد، می­توان نتیجه گرفت که سلول­های Ad-MSCs نیز منبع سلولی مناسب و کارآمدی برای ترمیم آسیب­های بافتی است. هم‫چنین برای نتیجه­گیری بهتر نیاز است که توانایی تکثیر و ترمیم آسیب غضروف مفصلی بین دو منبع سلولی Ad-MSCs  اتولوگ و آلوژن نیز بررسی شود.

 

                                                                                                                                 8- تشکر و قدردانی

نویسندگان این مقاله مراتب تشکر و قدردانی خود را از مزرعه نگه‫داری و مراقبت از حیوانات بزرگ پژوهشگاه رویان (هلیجرد) برای همکاری در نگه‫داری از حیوانات، در اختیار قرار دادن اتاق عمل و وسایل مورد نیاز جراحی طرح حاضر و همچنین پژوهشگاه رویان برای حمایت‫های مالی در جهت انجام طرح حاضر دارند.

-

  1. Chow YY, Chin KY. The Role of Inflammation in the Pathogenesis of Osteoarthritis. Mediators Inflamm. 2020:8293921.
  2. Emami A, Namdari H, Parvizpour F, Arabpour Z. Challenges in osteoarthritis treatment. Tissue and cell. 2022:101992.
  3. Moretti L, Maccagnano G, Coviello M, Cassano GD, Franchini A, Laneve A, et al. Platelet rich plasma injections for knee osteoarthritis treatment: a prospective clinical study. Journal of Clinical Medicine. 2022;11(9):2640.
  4. Armiento A, Stoddart M, Alini M, Eglin Biomaterials for articular cartilage tissue engineering: Learning from biology. Acta biomaterialia. 2018;65:1-20.
  5. Ostrowska M, Maśliński W, Prochorec-Sobieszek M, Nieciecki M, Sudoł-Szopińska I. Cartilage and bone damage in rheumatoid arthritis. Reumatologia/Rheumatology. 2018;56(2):111-20.
  6. Medvedeva EV, Grebenik EA, Gornostaeva SN, Telpuhov VI, Lychagin AV, Timashev PS, et al. Repair of damaged articular cartilage: current approaches and future directions. International journal of molecular sciences. 2018;19(8):2366.
  7. Jung CK. Articular cartilage: Histology and physiology. Techniques in cartilage repair surgery. 2014:17-21.
  8. Wenham CY, Conaghan PG. New horizons in osteoarthritis. Age and ageing. 2013; 42(3):272-8.
  9. Cai X, Yuan S, Zeng Y, Wang C, Yu N, Ding C. New trends in pharmacological treatments for osteoarthritis. Frontiers in Pharmacology. 2021;12:645842.
  10. Abramoff B, Caldera FE. Osteoarthritis: pathology, diagnosis, and treatment options. Medical Clinics. 2020;104(2):293-311.
  11. Zhang M, Hu W, Cai C, Wu Y, Li J, Dong S. Advanced application of stimuli-responsive drug delivery system for inflammatory arthritis treatment. Materials Today Bio. 2022;14:100223.
  12. Wiggers TG, Winters M, Van den Boom NA, Haisma HJ, Moen MH. Autologous stem cell therapy in knee osteoarthritis: a systematic review of randomised controlled trials. British Journal of Sports Medicine. 2021; 55(20):1161-9.
  13. Dubey NK, Mishra VK, Dubey R, Syed-Abdul S, Wang JR, Wang PD, et al. Combating osteoarthritis through stem cell therapies by rejuvenating cartilage: a review. Stem Cells International. 2018; 2018.
  14. Wang J, Zhou L, Zhang Y, Huang L, Shi Q. Mesenchymal stem cells-a promising strategy for treating knee osteoarthritis: a meta-analysis. Bone & Joint Research. 2020;9 (10): 719-28.
  15. Taghiyar L, piriyaee A, Baghaban Eslaminejad Mr. Studying the cartilage structure derived from the differentiation of rat mesenchymal stem cells in comparison with costal hyaline cartilage. Kosar Journal. 2007; 2 (2):97-106
  16. Harrell CR, Markovic BS, Fellabaum C, Arsenijevic A, Volarevic V. Mesenchymal stem cell-based therapy of osteoarthritis: current knowledge and future perspectives. Biomedicine & pharmacotherapy. 2019;109: (23)18-26.
  17. Jovic D, Yu Y, Wang D, Wang K, Li H, Xu F, et al. A brief overview of global trends in MSC-based cell therapy. Stem Cell Reviews and 2022;18 (5):1525-45.
  18. Loo SJQ, Wong NK. Advantages and challenges of stem cell therapy for osteoarthritis. Biomedical reports. 2021;15 (2):1-12.
  19. Lam AT, Reuveny S, Oh SK-W. Human mesenchymal stem cell therapy for cartilage repair: review on isolation, expansion, and constructs. Stem Cell Research. 2020;44:101738.
  20. Shariatzadeh M, Song J, Wilson SL. The efficacy of different sources of mesenchymal stem cells for the treatment of knee osteoarthritis. Cell and tissue research. 2019; 378: 399-410
  21. Hulme CH, Perry J, McCarthy HS, Wright KT, Snow M, Mennan C, et al. Cell therapy for cartilage repair. Emerging topics in life sciences. 2021;5(4):575-89.
  22. Brondeel C, Pauwelyn G, De Bakker E, Saunders J, Samoy Y, Spaas JH. Mesenchymal stem cell therapy in canine osteoarthritis research:“experientia docet”(experience will teach us). Frontiers in Veterinary Science. 2021; 8.
  23. Zhu C, Wu W, Qu X. Mesenchymal stem cells in osteoarthritis therapy: A review. American journal of translational research. 2021;13(2):448.
  24. Khan WS, Johnson DS, Hardingham TE. The potential of stem cells in the treatment of knee cartilage defects. The Knee. 2010;17 (6): 369-74.
  25. Diekman BO, Guilak F. Stem cell-based therapies for osteoarthritis: challenges and Current opinion in rheumatology. 2013; 25(1):119.
  26. Baghaban Eslaminejad Mr, Nikmahzar Ab, Taghiyar L, Dehghan MM, Farrokhi A, Eftekhari Yazdi P. Studing of Differentiation of Mesenchymal stem cells-derived from canines bone marrow into Bone, Cartilage and Adipose. Yakhteh; 2007; 1:13-38.
  27. Hosseinzadeh M, Hosseini S, Eslaminejad MB. The Impact of Different Ratios of Chondrocytes and Mesenchymal Stem Cells on Condrogenic Potential of Extracellular Vesicles Derived from Coculture of Chondrocytes and Mesenchymal Stem Cells. Journal of Cell & Tissue 2023; 13 (4).
  28. Baghaban Esmalinejad Mr, Taghiyar L, Falahi F. Investigating the expression level of cartilage genes in monolayer and three-dimensional cultures Rat articular chondrocytes with Real-time PCR. Anatomical Sciences Journal 200; 31: 107-116.
  29. Baghaban Eslaminejad Mr, Taghiyar L, Kiani Sahar, Piriyaee Abass. Subcutaneous transplantation of mouse mesenchymal stem cells cultured in alginate and their differentiation into cartilage. Jounal of Blood 2007; 2 (4): 105-114.
  30. Song Y, Zhang J, Xu H, Lin Z, Chang H, Liu W, et al. Mesenchymal stem cells in knee osteoarthritis treatment: A systematic review and meta-analysis. Journal of orthopaedic translation. 2020; 24:121-30.
  31. Jang S, Lee K, Ju JH. Recent updates of diagnosis, pathophysiology, and treatment on osteoarthritis of the knee. International journal of molecular sciences. 2021;22 (5):2619.
  32. Iturriaga L, Hernáez-Moya R, Erezuma I, Dolatshahi-Pirouz A, Orive G. Advances in stem cell therapy for cartilage regeneration in osteoarthritis. Expert Opinion on Biological Therapy. 2018;18 (8):883-96.
  33. Akkiraju H, Nohe A. Role of chondrocytes in cartilage formation, progression of osteoarthritis and cartilage regeneration. Journal of developmental biology. 2015;3 (4):177-92.
  34. Demoor M, Ollitrault D, Gomez-Leduc T, Bouyoucef M, Hervieu M, Fabre H, et al. Cartilage tissue engineering: molecular control of chondrocyte differentiation for proper cartilage matrix reconstruction. Biochimica et Biophysica Acta (BBA)-General Subjects. 2014;1840 (8):2414-40.
  35. Ejaz R. Dar, Mudasir B. Gugjoo, Moien Javaid, Shahid Hussain, Mujeeb R. Fazili, Kuldeep Dhama, Taha Alqahtani, Ali M. Alqahtani, Riaz A. Shah, and Talha Bin Emran. Adipose Tissue- and Bone Marrow-Derived Mesenchymal Stem Cells from Sheep: Culture Characteristics. Animals (Basel). 2021 Aug; 11(8): 2153.
  36. Ji Eun Kim, Sang Mok Lee, Soo Hyun Kim, Phil Tatman, Albert O Gee, Deok-Ho Kim, Kyung Eun Lee, Youngmee Jung, Sang Jun Kim. Effect of self-assembled peptide-mesenchymal stem cell complex on the progression of osteoarthritis in a rat model. Int J Nanomedicine; 2014 May 7;9 Suppl 1(Suppl 1):141-57.
  37. Yves-Marie Pers, Lars Rackwitz, Rosanna Ferreira, Oliver Pullig, Christophe Delfour, Frank Barry, Luc Sensebe, Louis Casteilla, Sandrine Fleury, Philippe Bourin , Danièle Noël, François Canovas, Catherine Cyteval, Gina Lisignoli, Joachim Schrauth, Daniel Haddad, Sophie Domergue, Ulrich Noeth, Christian Jorgensen. Adipose Mesenchymal Stromal Cell-Based Therapy for Severe Osteoarthritis of the Knee: A Phase I Dose-Escalation Trial. Stem Cells Transl Med, 2016 Jul;5(7):847-56.
  38. Damia E, Chicharro D, Lopez S, Cuervo B, Rubio M, Sopena JJ, Vilar JM, Carrillo JM. Adipose-Derived Mesenchymal Stem Cells: Are They a Good Therapeutic Strategy for Osteoarthritis? Int J Mol Sci. 2018 Jun 30;19(7):1926. doi: 10.3390/ijms19071926.
  39. Fanglong Song, Jilei Tang, Rui Geng, Hansheng Hu, Chunhui Zhu, Weiding Cui, Weimin Fan. Comparison of the efficacy of bone marrow mononuclear cells and bone mesenchymal stem cells in the treatment of osteoarthritis in a sheep model. Int J Clin Exp Pathol, 2014 Mar 15;7(4):1415-26.
  40. Alessandra Colombini, F Libonati, S Lopa, G M Peretti, M Moretti, L de Girolamo. Autologous chondrocyte implantation provides good long-term clinical results in the treatment of knee osteoarthritis: a systematic review. Knee Surg Sports Traumatol Arthrosc; 2023 Jun;31(6):2338-2348.