فصلنامه

نوع مقاله : علمی - پژوهشی

نویسندگان

1 گروه زیست شناسی، دانشکده علوم، دانشگاه علم وهنر، یزد، ایران

2 گروه علوم و فناوری های نوین، دانشکده پیراپزشکی، دانشگاه علوم پزشکی و خدمات بهداشتی و درمانی شهید صدوقی یزد، یزد، ایران

چکیده

هدف: هدف از این مطالعه بررسی اثرات سایتوتوکسیک عصاره هیدروالکلی آشواگاندا (Withanaia somnifera) و بررسی تغییرات بیان ژنP53  در پاسخ به این ماده در سلولهای سرطان تخمدان (رده سلولی A2780) است.
مواد و روش ها: بدین منظور سلول‫های A2780 با غلظت‫های مختلف عصاره آشواگاندا به‫مدت 24، 48 و 72 ساعت تیمار شدند. اثرات این عصاره بر روی میزان بقای سلول‫ها با استفاده از MTT  و میزان بیان ژن P53 به‫روش Real-Time PCR  مورد بررسی قرارگرفت. در نهایت آنالیز آماری و تفسیر داده‫ها با استفاده از نرم افزار GraphPad Prism انجام شد.
نتایج: نتایج MTT نشان داد که عصاره آشواگاندا در غلظت‫های 5/62، 125، 250، 500، 750 µg/ml  به‫صورت وابسته به زمان و غلظت به‫طور معناداری موجب کاهش حیات سلولی شده است به‫ترتیب پس از گذشت 24، 48و 72 ساعت IC50 در غلظت‫های 6/512، 339 و 6/226 میکروگرم بر میلی لیتر به‫دست آمد و همچنین  نتایج Real Time PCR نشان داد که بیان ژن P53 طی 24 ساعت تیمار با غلظت‫های 250  و 500 میکروگرم بر میلی لیتر عصاره به‫طور معناداری افزایش یافته است. همچنین افزایش غلظت عصاره بر روی میزان بیان این ژن تاثیر معناداری داشته است.
نتیجه گیری: نتایج حاصل از این مطالعه بیانگر اثر سایتوکسیک عصاره آشواگاندا بر روی سلول‫های سرطان تخمدان بوده و با افزایش بیان ژن P53 می تواند سبب القای اثرات ضد سرطانی باشد.

تازه های تحقیق

-

کلیدواژه‌ها

dor -

عنوان مقاله [English]

Evaluation of the Effect of Ashwagandha (Withanaia somnifera) Extract on Survival Rate and Expression of P53 Gene in Ovarian Cancer (A2780 cell line)

نویسندگان [English]

  • M Mahya Modaresi 1
  • N Nikunahad Lotfabadi 1
  • F Haghirosadat 2

1 Department of Biology, Faculty of Sciences, Science and Art University, Yazd, Iran

2 Department of Advanced Medical Sciences and Technologies, Faculty of Paramedicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran

چکیده [English]

Aim: As the second leading cause of death worldwide, cancer has been a long-standing and rapidly evolving focus of biomedical research and practice. Ovarian cancer is one of the deadly malignancies of women, which is known as the "silent killer". Because its symptoms usually appear when the disease has reached advanced stages and is mostly incurable. On the other hand, currently common treatment methods are associated with various limitations, failures and side effects, which have made researchers pay more attention to the compounds extracted from plants as anti-tumor and anti-cancer agents in the last two decades. The studies conducted on the various properties of Ashwagandha (Withanaia somnifera) show that this plant has therapeutic effects and anti-cancer properties that can even be effective on the process of apoptosis mediated by different genes, including P53. Today, P53 is known as a gene It has a key role in all types of cancers and mutations in this gene have been observed in 60% of ovarian cancers. Therefore, the aim of this study is to investigate the cytotoxic effects of the hydroalcoholic extract of Ashwagandha (Withanaia somnifera) and the changes in P53 gene expression in response to this substance in ovarian cancer cells (cell line A2780).
Material and method: For this purpose, extraction of Ashwagandha plant was done using soaking method. Then, the compounds present in the extract were determined using standard phytochemical tests. Then A2780 cells were treated with different concentrations of Ashwagandha extract for 24, 48 and 72 hours. The effects of this extract on cell survival were evaluated using the MTT test, and IC50 was calculated. Then, A2780 cells were exposed to concentrations of 250 and 500 µg/ml for 24 and 48 hours, and the level of P53 gene expression was investigated by Real-Time PCR. Finally, statistical analysis and data interpretation was done using GraphPad Prism software.
Results: MTT results showed that Ashwagandha extract at concentrations of 62.5, 125, 250, 500, and 750 µg/ml significantly decreased cell viability in a time- and concentration-dependent manner. The lowest percentage of survival rate is related to the concentration of 750 μg/ml and the time of 72 hours, while the highest percentage is related to the concentration of 62.5 μg/ml and the time of 24 hours. After 24, 48, and 72 hours, respectively, IC50 was obtained at concentrations of 512.6, 339, and 226.6 μg/ml, and Real-Time PCR results showed that the expression of the P53 gene during 24 hours of treatment with concentrations of 250 and 500 μg/ml of extract had increased significantly. Also, increasing the concentration of the extract had a significant effect on the expression of this gene.
Conclusion: The results of this study indicate the cytotoxic effect of Ashwagandha extract on ovarian cancer cells, and by increasing the expression of the P53 gene, it can induce anti-cancer effects. It is hoped that by knowing the mechanisms of action of this medicinal plant and designing new drugs, it will be possible to stop the progression of ovarian cancer and thus help to increase the life span of these patients against this silent killer.

کلیدواژه‌ها [English]

  • Ashwagandha
  • ovarian cancer
  • P53 gene
  • Withanaia somnifera

مقدمه

سرطان به‫عنوان دومین عامل مرگ و میر در سراسر جهان، کانون تحقیقات و عمل بیومدیکال، طولانی مدت و به سرعت در حال تکامل بوده است (1). واژه سرطان به یک بیماری اطلاق نمی‫شود، بلکه مجموعهای از بیماری های مختلف را نشان می‫دهد که با کیفیتهای خاصی مرتبط هستند. بسته به تعریف استفاده شده، میتوان حداقل صد نوع مختلف سرطان را شناسایی کرد. سلول‫های سرطانی از سلول‫های طبیعی انسان مشتق می شوند و بنابراین بسیاری از ویژگیهای سلول‫های اصلی را حفظ می‫کنند (2). این بیماری با تکثیر سلولی کنترل نشده، تهاجم، متاستاز، رگزایی و مرگ برنامه ریزی شده سلولی (آپوپتوزیس)  مشخص می‫شود  (3). فعال شدن انکوژنها و غیرفعال سازی ژن‫های سرکوب کننده تومور از علائم مهم سرطان است. تغییرات و جهش‫های ژنومی در سلول‫های سرطانی به‫عنوان مهم‫ترین نقطه عطف پیشرفت سرطان در نظر گرفته می‫شود  (4). اولین ژن سرکوبگر تومور که شناسایی شده است P53 است که اغلب در انواع مختلفی از سرطان‫های انسانی غیرفعال می‫شود  (5). تقریبا ۸۵ درصد سرطان‫ها در سلول‫های اپیتلیال رخ می‫دهد و به‫عنوان کارسینوماها دسته بندی میشوند. سرطان‫ها انواع مختلفی دارند که شایعترین آنها سرطان پستان، خون، ریه و تخمدان است (6). سرطان تخمدان دومین بدخیمی شایع زنان در کشورهای توسعه یافته و سومین بدخیمی شایع زنان در کشورهای در حال توسعه است (7) (8). سرطان تخمدان به‫دلیل شروع آهسته و خوش خیم و بی خطر بودن آن، عوارض و مرگ و میر بالایی دارد زیرا ممکن است تا زمانی که متاستاز پیدا نکند، تشخیص داده نشود (9). در سطح جهان، سالانه 313959 مورد جدید سرطان تخمدان تشخیص داده می‫شود  که 207252 مورد مرگ ناشی از سرطان است (01).

آپوپتوزیس مرگ برنامه ریزی شده ژنتیکی سلول‫هایی است که دیگر مورد نیاز نیستند یا تهدیدی برای ارگانیسم هستند. کاهش آپوپتوزیس منجر به افزایش نرخ بقای سلولی می‫شود  که منجر به ایجاد سرطان می‫شود . جهش یا حذف ژن P53 شانس ایجاد تومور را به‫طور چشمگیری افزایش می‫دهد، زیرا سلول‫های دارای DNA آسیب دیده به تقسیم کنترل نشده ادامه می‫دهند. مواد شیمیایی، تشعشعات و ویروس‫ها می‫توانند به P53 آسیب برسانند (11). علیرغم اکتشافات عمده در درمان سرطان، تاکنون، نرخ کلی مرگ و میر مرتبط با سرطان نسبتا ثابت مانده است. علاوه بر این، روش‌های سنتی و جدیدتر مورد استفاده برای درمان سرطان اثرات نامطلوبی دارند که بر کیفیت زندگی تاثیر منفی می‌گذارند. از این رو، جستجو برای درمان های موثرتر و قابل تحمل­تر ادامه دارد (12). بسیاری از روش‫ها و داروها برای درمان سرطان در دسترس هستند که بسیاری از آنها در حال مطالعه هستند. برخی از آنها مانند جراحی و پرتودرمانی درمان‌های «موضعی» هستند که برای درمان یک تومور یا ناحیه خاصی از بدن استفاده می‌شوند. درمان‌های دارویی (مانند شیمی‌درمانی، هورمون درمانی، ایمنوتراپی یا درمان هدفمند) اغلب درمان‌های «سیستمیک» نامیده می‌شوند، زیرا می‌توانند کل بدن را تحت تاثیر قرار دهند. از دیگر روشها می­توان به پیوند سلول‫های بنیادی یا مغز استخوان، استفاده از لیزر برای درمان سرطان، انتقال و اهدای خون، طب مکمل و یکپارچه، مکملهای غذایی اشاره کرد (31).

گیاهان دارویی بهترین جایگزین برای درمان و یا جلوگیری از عوارض جانبی مختلف جسمی ناشی از شیمی درمانی و پرتودرمانی می­باشند. این گزینه درمانی میتواند از آسیب رساندن به سلول‫های سالم و طبیعی در نزدیکی سلول‫های سرطانی جلوگیری کند (41). آشواگاندا یک گیاه دارویی آیورودا است که از عصاره ریشه های arefinmos ainahtiW ، درختچه ای همیشه سبز کم رشد که بومی هند و آسیای جنوب شرقی است، به دست میآید. arefinmos ainahtiW که به آن ahdnagawhsA، gnesnic naidnI یا retniWnaidnI نیز گفته می‫شود  در مطالعات مختلف آزمایش شده است و ویژگی‫های ضد توموری قابل توجهی را نشان داده است که چندین عامل افزایش تومورزایی را هدف قرار می‫دهد (51).  تاکنون برای آشواگاندا ابعاد گستردهای از فعالیت های دارویی مانند خواص آنتی اکسیدانتی، ضد باکتری، ضد قارچ، ضد سرطان، ضد التهاب، ضد استرس، ضد پارکینسون، ضد آلزایمر، محافظ قلبی، تقویت کننده سلامت عصبی و فیزیکی، آرام بخش، محافظت از سلول عصبی، ضد دیابت،داروی قابض، مقوی کبد، لاغری، آسم، برونشیت، زخم، افزایش قوای جنسی و تقویت حافظه ثبت شده است. پتانسیل آنتی اکسیدانتی بالای آن ممکن است به‫دلیل وجود فنلها و فلاونوئیدها باشد، اما فعالیت درمانی آن عمدتا توسط ویتانولیدها اعطا می‫شود. پتانسیل آنتی اکسیدانتی نیز به‫طور مستقیم با پتانسیل ضد سرطانی آن در ارتباط است (61). این گیاه از خانواده گیاهان گلدار متنوع eaecanaloS است (71). دارای خواص آنتی اکسیدانتی قوی است که به محافظت در برابر آسیب سلولی ناشی از رادیکالهای آزاد کمک می‫کند. طی تحقیقات اخیر مشخص شده است که ترکیبات موجود در این گیاه دارای اثرات ضد سرطانی بهتری نسبت به برخی از داروهای معمول مورد استفاده در شیمی درمانی می‫باشد. همچنین اخیرا به‫عنوان درمان اولیه در عفونت های ویروسی، عفونت مزمن ریه و VIH پیشنهاد شده است (81). این گیاه مخزنی از ترکیبات گیاهی متنوع مانند آلکالوئیدها، استروئیدها، فلاونوئیدها، فنل‫ها، ترکیبات حاوی نیتروژن و عناصر کمیاب است. ترکیبات بیولوژیکی اصلی که از قسمت‌های مختلف گیاه یافت می‌شوند، تری‌ترپنوئیدهای لاکتون استروئیدی C-28 هستند که به ویتانولیدها نیز شناخته می‌شوند که بیشتر از ویتافرین A تشکیل شده‌اند (91) ویتانولیدها، آلکالوئیدهای اصلی هستند که به‫دلیل ماهیت بسیار اکسیژن دار، پتانسیل ضد سرطانی خود را نشان میدهند. این گیاه در مبارزه با انواع سرطان‫ها بسیار موثر است. روده بزرگ، پستان، ریه، پروستات، پوست، خون، کبد و کلیه. مطالعات قبلی نشان می‫دهد که این گیاه در برابر سرطان پستان و به‫دنبال آن سرطان روده بزرگ، ریه، پروستات و خون موثرتر است (61). باتوجه به خواص ضد سرطانی و آنتی اکسیدانتی ترکیبات آشواگاندا، هدف از انجام این مطالعه بررسی اثر عصاره آشواگاندا بر بقا و بیان ژن 35P در رده سلولی 0872A سرطان تخمدان می باشد.

2- مواد و روش ها

این تحقیق از نوع تجربی آزمایشگاهی است که مراحل انجام آن به شرح ذیل می باشد.

عصاره گیری با روش خیساندن: جهت تهیه عصاره آشواگاندا از روش خیساندن استفاده شد. در ابتدا پودر ریشه آشواگاندا تهیه و به‫منظور گرفتن عصاره، گیاه پودر شده با حلال هیدروالکلی (با نسبت 50/50 شامل 50 درصد اتانول ۹۶ درصد و 50 درصد آب مقطر استریل)  مخلوط شده و در دستگاه شیکر انکوباتور برای مدت زمان 48 ساعت در دمای 37 درجه سانتی‫گراد قرار داده سپس عصاره حاصله فیلتر شده، درون انکوبانور 37 درجه سانتی گراد قرار داده شد تا عصاره صمغ مانند به‫دست آید. بعد از گذشت 2 روز عصاره خشک جمع آوری و در یخچال نگه‫داری شد.

تستهای کیفی تشخیص حضور ترکیبات فیتو شیمیایی در عصاره گیاهی: با استفاده از تست‫های استاندارد فیتوشیمیایی وجود یا عدم وجود ترکیباتی شامل فلاونوئید، ترپنوئید، آلکالوئید، تانن، استروئید، ساپونین، استرول، گلیکوزید، پروتئین و ویتامین C در عصاره بررسی شد.

کشت سلول: رده سلولی سرطان تخمدان انسان (A2780) از بانک سلولی انستیتو پاستور (تهران، ایران) خریداری شد. برا ی کشت سلول از محیط کشت RPMI حاوی 10 درصد سرم جنین گاوی (FBS) استفاده شد و سلول‫ها درون انکوباتور با دمای 37 درجه سانتی‫گراد و  5 درصد CO2 و  رطوبت 95 درصد  نگه‫داری شدند.

بررسی اثر سمیت سلولی عصاره آشواگاندا (تست MTT): در این مرحله تعداد 10 هزار سلول A2780 در هر چاهک از پلیت 96 خانه کشت داده شد. پس از 24 ساعت زمان دهی جهت چسبیدن سلول‫ها به کف، محیط کشت رویی تخلیه و 200 میکرولیتر از عصاره با غلظت‫های 5/62، 125، 250، 500 و 750 میکروگرم بر میلی لیتر به هر چاهک اضافه و این تست برای بازه زمانی 24، 48 و 72 ساعت انجام شد. پس از طی هر بازه زمانی سلول‫ها در معرض MTT و سپس DMSO (Dimethyl sulfoxide) قرار داده شدند. در نهایت، جذب نوری در طول موج 570 نانومتر  با دستگاه الایزا مدل ELx800 (ساخت کمپانی Biotek آمریکا) بررسی شد. در تست MTT میزان بقای سلولی با فرمول زیر به دست می آید.  

100× جذب متوسط نمونههای کنترل/ جذب متوسط نمونههای تیمار شده = درصد بقای سلولی

محاسبه IC50: داده‫های به‫دست آمده  طی زمان های 24، 48، 72 ساعت به کمک نرم افزار Excel مورد بررسی قرار گرفته و میزان غلظت IC50 جهت به‫دست آوردن در صد توان حیاتی سلول‫های A2780 در مقابل دوز های مختلف تیمار با استفاده از نرم افزار prism محاسبه شد.

بررسی بیان ژن P53: ابتدا سلول‫ها به تعداد 500 هزار عدد درون هر چاهک از پلیت 6 خانه کاشته و پس از 24 ساعت زمان‫دهی جهت چسبیدن سلول‫ها به کف، غلظت‫های250 و 500 میکروگرم بر میلیلیتر از عصاره به هر چاهک اضافه شد. سلول‫ها با این غلظت‫ها به‫مدت 24 و 48 ساعت تیمار شدند سپس مطابق دستور العمل کیت (شرکت پارس توس زیست فن آور، مشهد، ایران) استخراج ANR انجام شد. جهت اطمینان از کیفیت ANR استخراج شده، نمونه‌ها روی ژل آگارز 2 درصد مشاهده شدند. و برای تعیین میزان غلظت ANR استخراج شده، از دستگاه نانودراپ  (Analytica Jena,Germany ynamreG,aneJ acitylanA) استفاده شد. جهت بررسی تغییرات بیان ژن در سطح رونویسی، AND مکمل توسط آنزیم نسخه بردار معکوس از نمونهی ANR ساخته می‫شود . جهت سنتز AND c از کیت سنتز AND c (شرکت پارس توس زیست فن آور، مشهد، ایران) استفاده شد. سپس طبق برنامه دمایی جدول 1 با استفاده از دستگاه PCR سنتز cDNA انجام شد. جهت تکثیر قطعه ژنی مورد نظر، یک جفت آغازگر(remirP) اختصاصی برای ژن‫های 35P و HDPAG طراحی شد که شامل آغازگرهای  drawrof و esreveR است. توالی آغازگرها مطابق جدول 2 می باشد. ژن HDPAG به‫عنوان کنترل داخلی منظور شد. در واکنش RCP-TR، جهت تکثیر ژن هدف از آغازگرهای اختصاصی ژن 35P استفاده شد و از ژن HDPAG به‫عنوان eneg gnipeekesuoH مورد استفاده قرار گرفت. هدف از انجام واکنش RCP emit-laeR سنجش میزان بیان ژن 35P تحت تاثیر عصاره آشواگاندا می باشد. در این تحقیق از )k.n( xiM retsam PCPq neergrebyS qaT toH ساخت شرکت پارس طوس (مشهد، ایران) استفاده گردید و طبق برنامه دمایی جدول 3 واکنش در دستگاه ریل تایم انجام شد. پس از پایان واکنش بهمنظور تایید اختصاصی بودن محصول و عدم حضور محصولات غیر اختصاصی، آنالیز منحنی ذوب صورت گرفت. جهت ارزیابی تغییرات بیان ژن مورد نظر از روش (ΔΔCT)2 استفاده شد.

جدول 1: سیکلهای دمایی سنتز AND c

دما

زمان

25 درجه سانتی‌گراد

10 دقیقه

47 درجه سانتی‌گراد

60 دقیقه

85 درجه سانتی‌گراد

5 دقیقه

4 درجه سانتی‌گراد

2 دقیقه

 

جدول:2  مشخصات آغازگرها

TM

توالی

نام ژن

59

TGCAGCTGTGGGTTGATTCC

P53 F

AAACACGCACCTCAAAGCTGTTC

P53 R

60

AGCCACATCGCTCAGACAC

GAPDH F

GCCCAATACGACCAAATCC

GAPDH R

جدول 3: برنامه زمانی و دمایی واکنش Real Time PCR

تعداد سیکل

زمان

دما

مرحله

1

10 دقیقه

94°C

Pre-denaturing

35

15 ثانیه

95°C

Denaturing

30 ثانیه

57°C

Annealing

30 ثانیه

72°C

Extension

1

5 دقیقه

72°C

Final extension

3- آنالیز آماری

داده‫ها به‫صورت Mean ± SD گزارش شدند. آنالیز آماری داده های حاصل از این مطالعه با استفاده از نرم افزار Prism Graph Pad صورت گرفت. جهت بررسی تفاوتهای ایجاد شده ناشی از عصاره آشواگاندا بر میزان بقای سلول‫های تخمدان (0872A) و بیان ژن 35P در سلول‫های تیمار شده با عصاره آشواگاندا از آزمون تحلیل واریانس (AVONA) و -test -T در سطح معناداری 50/0 (05/0≤ p) استفاده شد.

4- نتایج

بررسی حضور ترکیبات فیتوشیمیایی در عصاره

آزمون های فیتوشیمیایی انجام شده بیانگر وجود ترکیبات متفاوتی مانند الکالوئیدها، تری ترپنوئید ها، ویتامین C، پروتئین‌ها، گلیکوزیدها، استرول ها، ساپونین ها، فلاونوئید، تانن ها و استروئیدها در عصاره ریشه آشواگاندا مطابق جدول 4 میباشد.

جدول 4: ترکیبات شیمیایی اصلی موجود در ریشه آشواگاندا

نام ترکیب شیمیایی

نتیجه آزمون عصاره‌ی ریشه آشواگاندا

ترکیبات فلانوئید

+

ترکیبات تری ترپنوئید

+

ترکیبات آلکالوئید

+

تانن

+

استروئید

+

ساپونین ها

+

استرول

+

گلیکوزید

+

پروتئین ‌ها

+

ویتامین C

+

بررسی اثر عصاره آشواگاندا بر رشد رده ی سلولی A2780

با استفاده از آزمون MTT اثر عصاره بر بقای رده‫ی سلولی بررسی شد. بدین ترتیب، تاثیر عصاره بر درصد بقای سلولی در سه زمان 24 ساعت (شکل 1)، 48 ساعت (شکل 2) و 72 ساعت (شکل 3) به‫دست آمد. نتایج نشان داد که میزان سایتوتوکسیسیتی عصاره آشواگاندا وابسته به دوز و زمان می باشد. پس از گذشت 24، 48 و72 ساعت، درصد بقای سلول (Viability) با افزایش غلظت عصاره، به‫طور معناداری کاهش یافت که این کاهش درصد بقای سلولی متناسب با افزایش غلظت عصاره بوده است (05/≤0P). نتایج نشان می‫دهد که درصد بقای سلولی در مقایسه با گروه کنترل منفی در غلظت‫های 62.5، 125، 250، 500، 750 µg/ml کاهش معناداری نشان می‫دهد (05/0p ≤). کمترین میزان بقای سلولی 3/21 درصد پس از 72 ساعت در غلظت 750 میکروگرم بر میلی لیتر بود. جدول 5 میزان 05CI عصاره آشواگاندا پس از تاثیر بر سلول‫های 0872Aدر زمان های 42، 84 و27 ساعت را نشان می‫دهد.

 

جدول 4 : IC50 ناشی ازاثر گذاری عصاره آشواگاندا بر سلول‫های سرطان تخمدان

IC50 (µg/ml)

Time

6/512

24 ساعت

339

48 ساعت

4/226

72 ساعت

 

 

 

شکل 1 تاثیر عصاره آشواگاندا بر درصد بقای سلولی در زمان 24 ساعت

 * (05/0p ≤ ) اختلاف معنادار با گروه کنترل را نشان می‫دهد.

 

 

 

شکل 2: تاثیر عصاره آشواگاندا بر درصد بقای سلولی در زمان 48 ساعت

* (05/0p ≤ ) اختلاف معنادار با گروه کنترل را نشان می‫دهد.

 

 

شکل 3: تاثیر عصاره آشواگاندا بر درصد بقای سلولی در زمان 72 ساعت

* (05/0p ≤ ) اختلاف معنادار با گروه کنترل را نشان می‫دهد.

 

نتایج استخراج RNA و بیان ژن  P53 تحت تاثیر عصاره آشواگاندا

به‫منظور تعیین غلظت و خلوص RNA استخراج شده، با دستگاه نانودراپ جذب RNA گرفته شد و به‫عنوان رفرنس از DEPS Water  استفاده شد. طبق جدول6 نمونه های mRNA استخراج شده، از غلظت خوب برخوردار بودند. جهت اطمینان از دمای Annealing آغازگرها، محصولات PCR حاصل از دماهای 58 الی 63 درجه سانتی‫گراد  را بر روی ژل آگارز 5/1 درصد برده شد، باند مورد نظر مشاهده و دمای قطعی بهدست آمد. به این‫صورت که دمای 59 درجه سانتی‫گراد برای آغازگر در نظر گرفته شد. شکل های 4 و 5 منحنی ذوب هر یک از ژن ها را نشان می­دهد که نمایانگر دمای یک محصول PCR است.  با آنالیز منحنی ذوب می توان وجود باندهای غیراختصاصی و پرایمر دایمر را تشخیص داد که در این مطالعه با استناد به منحنی­های ذوب به‫دست آمده محصولات کاملا اختصاصی و فاقد پرایمر دایمر می­باشند. نتایج آنالیز بیان ژن P53 در سلول‫های تیمار شده با عصاره آشواگاندا نشان از افزایش میزان بیان این ژن داشت. همان‫طور که در شکل 6 نشان داده شده است بیان ژن P53 با افزایش غلظت عصاره نسبت به گروه کنترل به‫طور معناداری افزایش یافته است (05/0≤p ). بدین‫صورت که در غلظت 500 میکروگرم برمیلیلیتر عصاره بیان ژن p53 به‫طور قابل توجهی در مقایسه با گروه کنترل افزایش یافته است.

 

جدول 6:  نتایج غلظت RNA استخراجی از سلول 2780 A

 

H24

H48

کنترل

5/139

78/510

سلول‫های 2780 A تیمار شده با عصاره ی آشواگاندا  غلظت mg/ml250

2/511

32/690

سلول‫های 2780 A تیمار شده با عصاره ی آشواگاندا  غلظت mg/ml500

06/281

25/291

 

 

 

شکل 4: منحنی ذوب ژن p53 در سلول‫های تیمارشده با عصاره آشواگاندا

 

 

 

 

شکل 5:  منحنی ذوب ژن GAPDH در سلول‫های تیمارشده با عصاره آشواگاندا

 

 

شکل 5: مقایسه بیان ژن P53 در سلول‫های تیمار شده با عصاره آشواگاندا در مقایسه با گروه کنترل

* (05/0P ≤ ) اختلاف معنا دار با گروه کنترل را نشان می‫دهد.

4- بحث

      سرطان نگرانی رو به رشد بهداشتی در سراسر جهان است. در این بین، سرطان تخمدان یکی از شایعترین بدخیمیهای تشخیص داده شده در زنان و یکی از عوامل مرگ و میر در آنها می باشد (02) . مقاومت به شیمی درمانی سدی در برابر درمان موفق سرطان تخمدان می باشد. بنابراین یافتن داروهایی موثرتر یا مکمل درمان، همراه با عوارض جانبی کمتر برای افزایش طول عمر این بیماران ضروری است. گیاهان دارویی سازگاری بهتری با بدن دارند و معمولا عوارض جانبی آنها نیز کمتر است (12). hsiwraD و همکار (22) پس از تحلیل حجم عظیمی از داده‌های موجود در مورد منابع قومی-دارویی ضد سرطان بیان کردند که گیاهان دارویی غالبترین فرمول قومی دارویی هستند که در میان بیماران سرطانی در شرق استفاده میشود. داده‌های به‌دست‌آمده برای اولین بار متداول‌ترین گیاهان دارویی در منطقه شرق از جمله arefinmos ainahtiW  برای درمان سرطان را نشان می‌دهد که اهمیت آنها را بهعنوان عوامل ضد سرطان طبیعی مطرح می­کند. بررسی آنها نشان می‌دهد که arefinmos ainahtiW  یکی از پرمصرف‌ترین گیاهان در میان بیماران سرطانی می­باشد. روشهای مولکولی که برای عصارههای گیاهی و ترکیبات جدا شده از شرق بررسی شده است شامل توقف چرخه سلولی و القای آپوپتوزیس با مشارکت عاملان اصلی در این فرآیندها مانند پروتئین 35P و غیره است. آپوپتوزیس یک فرایند مرگ فعال است که از نظر ژنتیکی رمزگذاری شده است. شواهد اخیر نشان میدهد که شکست آپوپتوزیس ناشی از دارو ممکن است دلیل اصلی مقاومت در برابر دارو باشد. مکانیسمهای مولکولی آپوپتوزیس ناموفق در سلولهای سرطانی تخمدان مقاوم شیمیایی شامل جهشهای p53، بیان غیر طبیعی پروتئین­های خانواده 2-lcB و گلیکوپروتئینهای P و تنظیم زیاد دیگر مهارکنندههای آپوپتوزیس است که کاسپازها را مسدود کرده و منافذ نفوذپذیری میتوکندری را تثبیت میکند. راه انداختن آپوپتوزیس یکی از استراتژیهای بالقوه برای غلبه بر مقاومت شیمیایی است (32).

P53 یکی از ژنهای بسیار مهم در تنظیم فرایند آپوپتوزیس است. از آنجا که میزان و فعالیت 35P  یک عامل تعیین کننده در حساسیت به داروهایی نظیر سیس پلاتین در سلولهای سرطانی از جمله سرطان تخمدان است، کاهش فعالیت و مقدار 35P میتواند در مقاومت به شیمی درمانی نقش داشته باشد (12). در مطالعات مختلف آزمایش شده است که آشواگاندا ویژگیهای ضد توموری قابل توجهی را نشان داده، که چندین عامل افزایش تومورزایی را هدف قرار میدهد (51). همچنین مشخص شده است که بسیاری از مارکرهای citotpopaorp و citotppaitna توسط arefinmos .W  برای تحریک مرگ برنامه ریزی شده سلولهای سرطانی تعدیل شدهاند. arefinmos .W  بر فرآیندهای اصلی مولکولی درگیر در توسعه و پیشرفت سرطان اثر میگذارد.  arefinmos .W  پتانسیل چند مدلی را برای الف) ارتقا مرگ سلولی، ب) تداخل در سیگنالینگ سلول سرطانی و ج) مهار پیشرفت متاستاتیک فراهم میکند. خاصیت آداپتوژنیک arefinmos .W  بهعنوان یک عامل تعدیل کننده بیماری است و ثابت شده است که arefinmos .W  یک کمکی برای درمان های معمول سرطان است. عصاره arefinmos .W  باعث بهبود فعالیت دارویی پاکلیتاکسل در شیمی درمانی در مدل حیوانی شده است. از اینرو، فعالیتهای چند حالته arefinmos .W  آن را بهعنوان یک محصول طبیعی ضد سرطان غالب ارائه میدهند (4). همچنین urugayillaP و همکاران (71) اعلام کردند  arefinmos .W  بهعنوان یک گیاه مبتنی بر آیورودا، توانایی جلوگیری از نشانههای علائم سرطان را دارد. همانطور که در این تحقیق عصاره هیدروالکلی ریشه این گیاه وابسته به غلظت و زمان باعث مرگ سلولهای سرطانی گشت. طی یک مطالعه redlaH و همکاران (3) برای اولین بار اثر سایتوتوکسیک عصاره ریشه گیاه آشواگاندا را بر سلول‌های ملانومای بدخیم انسانی (رده سلولی 573A) بررسی کردند. نتایج نشان داد که عصاره خام ریشه ainahitW این قدرت را دارد که تعداد سلول های زنده را از نظر دوز و همچنین به روشی وابسته به زمان کاهش دهد. آپوپتوز در سلول‌های رنگ‌آمیزی شده با IPAD در زیر میکروسکوپ فلورسانس و نردبانی از AND تکه تکه شده در سلول های تیمار شده مشاهده شد. بنابراین می توان گفت که عصاره arefinmos ainahtiW  دارای اثر سایتوتوکسیک قوی بر سلول های ملانومای بدخیم انسان است (3). با توجه به مطالعات گذشته، در این تحقیق برای بررسی تاثیر و تعییین سمیت عصاره الکلی آشواگاندا بر سلول های سرطانی تخمدان در محیط کشت از آزمون TTMکه یک ازمون استاندارد برای ارزیابی میزان بقاء سلول به شمار می رود؛ استفاده شد. نتایج حاصل از این پژوهش به طور کلی، اثرات مهاری عصاره آشواگاندا را بر رده سلولی سرطان تخمدان از نظر وابسته به دوز و زمان نشان داد. نتایج تحقیقات اخیر نشان دهنده این است که آشواگاندا و مشتقات آن گسترش برخی از سلول های توموری را مهار می کند در سال 2014، Kim و Singh تاثیر درمان با ویتافرینA  ) AW (، یک لاکتون استروئیدی مشتق شده از گیاه arefinmos ainahtiW  ، درمهار رشد سرطان پستان در یک مدل موش تراریخته را بررسی کردند و  AW را بهعنوان یک عامل قوی ضد سرطان پستان گزارش کردند که منجر به مهار قابل‌توجهی از بار تومور پستانی و همچنین بروز متاستاز در موش‌های تراریخته بدون هیچ گونه عوارض جانبی آشکاری شد (42). در نتیجه A nirefahtiW) AW ( که یک جزء فعال زیستی اصلی گیاه هندی arefinmos ainahtiW  است باعث مرگ سلولی (آپوپتوزیس/نکروزیس) در انواع مختلف سلول‌های تومور می‌شود (25). در این مطالعه ما نیز با توجه به آنالیز شیمیایی انجام شده بر روی گیاه آشواگاندا متوجه حضور ترکیبات فلاونوئید، تری ترپنوئید، آلکالوئید، استروئید، ساپونینها، استرول، تانن، گلیکوزید، پروتئینها، ویتامین c و دیگر ترکیبات مفید و موثر شدیم که به اعمال بیولوژیکی آن، به ویژه خاصیت ضد سرطانی کمک می کنند. rakaK و همکاران  (62) عنوان کردند A nirefahtiW) AW( به تنهایی یا به‌ویژه در درمان ترکیبی، در درمان سرطان تخمدان اثربخشی فوق‌العاده‌ای نشان داده است. همچنین Fong MY و همکاران (72) در سال 2012 گزارش کردند در اثر درمان ترکیبی دوکسوروبیسین با AW برای سرطان تخمدان منجر به افزایش تولید SOR و اتوفاژی ناشی از آن می شود. همچنین در مدل موشهای زنوگرافت ، هنگامی که دوکسوروبیسین و AW در موشهای آزمایش نسبت به گروه شاهد یا حیواناتی که با هر دو دارو تحت درمان قرار گرفتند، 70 تا 80 درصد کاهش در حجم تومور وجود داشت.

Dom و همکاران (28) در مطالعه پروتئومیک در سلول‌های میلوما نشان دادند که اهداف پروتئینی ویتافرین A با آپوپتوز مرتبط است. Tang و همکاران (29) اظهار کردند برخی مطالعات گزارش داده اند که W. somnifera و ترکیبات فعال آن با کاهش نشانگرهای ضد آپوپتوتیک و فعال سازی نشانگرهای پرواپوپتوتیک در انواع مختلف سرطان و مدل های مختلف، فعالیت آپوپتوز را دوباره برنامه ریزی می کنند. نتایج این مطالعات با یافته های این پژوهش که نشان دهنده توان ترکیبات آشواگاندا در تغییر میزان بیان ژن پروآپوپتوتیک و افزایش مرگ سلول های سرطان تخمدان می باشد، مطابقت دارد. Sundar و همکاران (30) در طی مطالعهای گزارش کردند که ویتانولید ها که اصلی ترین آلکالوئید های گیاه آشواگاندا هستند می تواند فعالیت عملکردی جهش 53P  در سلول های سرطانی کبد را بازسازی کند. در این تحقیق نتایج آنالیز بیان ژن 53P در سلول های تیمار شده با عصاره آشواگاندا بیانگر افزایش میزان بیان این ژن می باشد. بنابراین نتایج مطالعه حاضر نشان می دهد که عصاره آشواگاندا به طور قابل توجهی سبب افزایش میزان بیان ژن 53P می شوند. یافته های مطالعات گذشته با نتایج پژوهش مطابقت دارد. البته شایان ذکر است محدودیت مطالعه حاضر، عدم بررسی اثر بخشی ترکیب مورد استفاده در شرایطoviv ni می باشد.

6- نتیجه گیری

نتایج حاصل از تحقیق انجام شده، نشان می‫دهد که احتمالا مصرف گیاه آشواگاندا به‫دلیل وجود ترکیباتی همچون ویتانولیدها به‫صورت قابل توجهی منجر به افزایش بیان ژن مولد آپوپتوزیس P53 و احتمالا محدود کردن رشد تومورهای سرطانی می‫شود. در این مطالعه تیمار با عصاره آشواگاندا باتوجه به ویژگی آنتی اکسیدانیش خاصیت کشندگی بر روی سلول‫های رده A2780 و اثر بر کاهش بقای این سلول‫های سرطانی را تایید کرد و نشان داد که ترکیبات موجود در آشواگاندا دارای فعالیت توکسیک علیه سلول‫های سرطان تخمدان بوده و در کشتن سلول‫های سرطانی در محیط کشت نقش دارد. به علاوه، این عصاره احتمالا می‫تواند دارای خاصیت آپوپتوتیک باشد و به‫عنوان عامل موثری در نابودی سلول‫های سرطانی در سرطان تخمدان معرفی شود. با در نظر گرفتن پتانسیل ضد سرطانی این گیاه، مطالعات بیشتری برای بررسی دقیق تر اثرات بالینی آن لازم به‫نظر می‫رسد. هم چنین در مطالعات بعدی می‫توان اثر بخشی عصاره آشواگاندا را بر سایر ژن‫های آپوپتوتیک و مسیر سیگنالینگ دیگری در هر دو شرایط in vitro و in vivo مورد بررسی قرار داد.

7- تشکر و قدردانی

از دانشگاه علم و هنر به خاطر فراهم کردن امکانات این مطالعه صمیمانه تشکر می‫شود .

-

  1. Yin W, Wang J, Jiang L, James Kang Y. Cancer and stem cells. Exp Biol Med (Maywood). 2021;246(16):1791-801.]
  2. Fung DJ. The Cancer Code: A Revolutionary New Understanding of a Medical Mystery. 1 ed: Thorsons; ‎ Harper Wave; 2020. 400 p.
  3. Halder B, Singh S, Thakur SS. Withania somnifera Root Extract Has Potent Cytotoxic Effect against Human Malignant Melanoma Cells. PLoS One. 2015;10(9):e0137498.
  4. Saggam A, Tillu G, Dixit S, Chavan-Gautam P, et al. Withania somnifera (L.) Dunal: A potential therapeutic adjuvant in cancer. J Ethnopharmacol. 2020;255:112759.
  5. Jain AK, Barton MC. p53: emerging roles in stem cells, development and beyond. Development. 2018;145(8):dev158360.
  6. Pecorino L. Molecular Biology of Cancer Mechanisms, Targets, and Therapeutics2021. 472 p.
  7. Torre LA, Bray F, Siegel RL, Ferlay J, et al. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65(2):87-108.
  8. Epithelial carcinoma of the ovary, fallopian tube, and peritoneum: Clinical features and diagnosis [Internet]. 2022.
  9. Chacón E, Dasí J, Caballero C, Alcázar JL. Risk of Ovarian Malignancy Algorithm versus Risk Malignancy Index-I for Preoperative Assessment of Adnexal Masses: A Systematic Review and Meta-Analysis. Gynecol Obstet Invest. 2019;84(6):591-8.
  10. Sung H, Ferlay J, Siegel RL, Laversanne M, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-49.
  11. Akhtar F, Bokhari SRA. Apoptosis. StatPearls. Treasure Island (FL): StatPearls Publishing Copyright © 2022, StatPearls Publishing LLC.; 2022.
  12. Mun EJ, Babiker HM, Weinberg U, Kirson ED, et al. Tumor-Treating Fields: A Fourth Modality in Cancer Treatment. Clin Cancer Res. 2018;24(2):266-75.
  13. Jovčevska I, Muyldermans S. The Therapeutic Potential of Nanobodies. BioDrugs. 2020;34(1):11-26.
  14. Kurra P. Natural and Herbal Remedies for Cancer Treatment. Inventi Impact: Planta Activa. 2016;2016:140-7.
  15. Hsu JH, Chang PM, Cheng TS, Kuo YL, et al. Identification of Withaferin A as a Potential Candidate for Anti-Cancer Therapy in Non-Small Cell Lung Cancer. Cancers (Basel). 2019;11(7).
  16. Singh N, Yadav SS, Rao AS, Nandal A, et al. Review on anticancerous therapeutic potential of Withania somnifera (L.) Dunal. J Ethnopharmacol. 2021;270:113704.
  17. Palliyaguru DL, Singh SV, Kensler TW. Withania somnifera: From prevention to treatment of cancer. Mol Nutr Food Res. 2016;60(6):1342-53.
  18. Singh N, Bhalla M, de Jager P, Gilca M. An overview on ashwagandha: a Rasayana (rejuvenator) of Ayurveda. Afr J Tradit Complement Altern Med. 2011;8(5 Suppl):208-13.
  19. Dutta R, Khalil R, Green R, Mohapatra SS, et al. Withania Somnifera (Ashwagandha) and Withaferin A: Potential in Integrative Oncology. International Journal of Molecular Sciences. 2019;20(21):5310.
  20. Kasper DL. Harrison's principles of internal medicine. edition t, editor: New York : McGraw Hill Education Medical, [2015]; 2015.
  21. Vahedi F, Fathi Najafi M, Bozari K. Evaluation of inhibitory effect and apoptosis induction of Zyzyphus Jujube on tumor cell lines, an in vitro preliminary study. Cytotechnology. 2008;56(2):105-11.
  22. Abu-Darwish MS, Efferth T. Medicinal Plants from Near East for Cancer Therapy. Front Pharmacol. 2018;9:56.
  23. Tu Y, Kim E, Gao Y, Rankin GO, et al. Theaflavin-3, 3'-digallate induces apoptosis and G2 cell cycle arrest through the Akt/MDM2/p53 pathway in cisplatin-resistant ovarian cancer A2780/CP70 cells. Int J Oncol. 2016;48(6):2657-65.
  24. Kim S-H, Singh SV. Mammary Cancer Chemoprevention by Withaferin A Is Accompanied by In Vivo Suppression of Self-Renewal of Cancer Stem Cells. Cancer Prevention Research. 2014;7(7):738-47.
  25. Nishikawa Y, Okuzaki D, Fukushima K, Mukai S, et al. Withaferin A Induces Cell Death Selectively in Androgen-Independent Prostate Cancer Cells but Not in Normal Fibroblast Cells. PLOS ONE. 2015;10(7):e0134137.
  26. Kakar SS, Parte S, Carter K, Joshua IG, et al. Withaferin A (WFA) inhibits tumor growth and metastasis by targeting ovarian cancer stem cells. Oncotarget. 2017;8(43):74494-505.
  27. Fong MY, Jin S, Rane M, Singh RK, et al. Withaferin A synergizes the therapeutic effect of doxorubicin through ROS-mediated autophagy in ovarian cancer. PLoS One. 2012;7(7):e42265.
  28. Dom M, Offner F, Vanden Berghe W, Van Ostade X. Proteomic characterization of Withaferin A-targeted protein networks for the treatment of monoclonal myeloma gammopathies. J Proteomics. 2018;179:17-29.
  29. Tang Q, Ren L, Liu J, Li W, et al. Withaferin A triggers G2/M arrest and intrinsic apoptosis in glioblastoma cells via ATF4-ATF3-CHOP axis. Cell Prolif. 2020;53(1):e12706.
  30. Sundar D, Yu Y, Katiyar SP, Putri JF, et al. Wild type p53 function in p53(Y220C) mutant harboring cells by treatment with Ashwagandha derived anticancer withanolides: bioinformatics and experimental evidence. J Exp Clin Cancer Res. 2019;38(1):103.