فصلنامه

نوع مقاله : علمی - پژوهشی

نویسندگان

1 دانشگاه لرستان، دانشکده علوم پایه، گروه زیست شناسی

2 استاد، دانشگاه لرستان، دانشکده علوم پایه، گروه زیست شناسی

3 دانشیار، دانشگاه اصفهان، دانشکده علوم پایه، گروه زیست شناسی

4 استاد، دانشگاه لرستان، دانشکده کشاورزی، گروه بیوتکنولوژی

چکیده

هدف: مسیر بیوسنتز کلروفیل یکی از اهداف مهم ایجاد تغییرات ژنتیکی به‫منظور تغییر سرعت فتوسنتز و رشد گیاهان برای تامین افزایش تقاضای غذا در جمعیت رو به رشد جهان است. در این مطالعه تاثیر فوق بیان ژن GSA یکی از ژن‌های مسیر بیوسنتز کلروفیل بر شرایط فیزیولوژیکی گیاه تنباکو مورد بررسی قرار گرفت. 5-آمینولوولینیک اسید (ALA) محصول ژن GSA است. ALA پیش‌ساز ساخت تتراپیرول‌ها است. این ترکیب نقش بسیار مهمی در سلول‌های زنده دارد مثلا به‫عنوان رنگدانه‌ها، گیرنده نور (فیتوکروم)، گروه پروستاتیک بسیاری از پروتئین‌ها (مثل سیتوکروم‌ها، هموگلوبین، میوگلوبین و لگ هموگلوبین) و آنزیم‌ها (مثل کاتالاز، آسکوربات، پراکسیداز و غیره) نقش دارند. امروزه ALA به‫دلیل استفاده گسترده از آن در کشاورزی، جنگلداری و داروسازی مورد توجه زیادی قرار گرفته است. ALA در غلظت‌های پایین فتوسنتز، رشد و نمو، عملکرد و بهره‌وری را افزایش می‌دهد. همچنین ظاهر، رنگ میوه ، کیفیت و طعم محصولات را در گیاهان تیمار شده در شرایط عادی و استرس‌زا افزایش می‌دهد. ALA همچنین ویژگی‌های آنتی اکسیدانی، جذب مواد مغذی، راندمان مصرف آب و تعادل اسمزی را در گیاهان بهبود می‌بخشد. مواد و روش‌‌ها: در این تحقیق با توجه به مطالعات بیوانفورماتیکی cDNA ژن MsGSA گیاه یونجه رقم اصفهانی برای انتقال به گیاه تنباکو رقم Xanthi انتخاب گردید. از ناقل بیانی دوگانه گیاهی ‏pBI121‎‏ که دارای ژن مقاومت آنتی‌بیوتیک کانامایسین برای انتخاب در باکتری‌ها و گیاهان، محل‌های برش برای آنزیم‌های SacI و BamHI، پروموتر CaMV35S (پرموتور ویروس موزاییک گل کلم)، توالی خاتمه دهنده­ی نسخه‌برداری nos و ژن گزارشگر β-گلوکورونیداز (GUS) استفاده شد. پس از ساخت سازه ژنی
 pBI121-GSA و تایید انتقال سازه با استفاده از سه روش کلون PCR، هضم آنزیمی و ترادف‌یابی سازه مربوطه به اگروباکتریوم تومفسینس سویه  LB4404انتقال داده شد. با استفاده از اگروباکتریوم واجد سازه ژنی، ژن مربوطه به ژنوم گیاه تنباکو منتقل و گیاهان تراریخته روی محیط گزینشی انتخاب شدند و وجود ژن با انجام PCR در گیاهان باززایی شده تایید شد. جوانه‌های تراریخته ریشه‌دار شده به خاک منتقل شدند. میزان بیان ژن GSA در گیاهان تراریخته حاصل با RT-PCR مورد ارزیابی قرار گرفت و میزان رشد و محتوای بیوشیمیایی آن‌ها مورد بررسی قرار گرفت. نتایج: نتایج نشان داد که رشد گیاهان تراریخته به‫صورت معنی‌داری بسته به میزان بیان ژن GSA افزایش یافت همچنین محتوای ALA (آمینولوولینیک اسید)، کلروفیل a، b و کلروفیل کل که محصول بیان ژن مربوطه می‌باشد. همچنین نتایج نشان می‌دهد که محتوای آنتوسیانین‌ها، فلاونوئیدها و ترکیبات فنل گیاهان تراریخته متناسب با میزان افزایش بیان ژن GSA به‫طور معنی‌داری نسبت به گیاهان تیپ وحشی افزایش پیدا کرده است.
نتیجه‌گیری: افزایش میزان رشد، محتوای کلروفیل a،b ، کلروفیل کل،  ALA، آنتوسیانین، فلاونوئیدها و فنل گیاهان تراریخته متناسب با میزان افزایش بیان ژن GSA است و این بیانگر افزایش توان رشدی و افزایش پتانسیل مقاومت در گیاهان تراریخته تحت تاثیر ژن انتقالی GSA و افزایش محتوایALA  است

تازه های تحقیق

-

کلیدواژه‌ها

dor -

عنوان مقاله [English]

Overexpression of Alfalfa Glutamate Semialdehyde Aminotransferase Gene in Tobacco and Analysis of its Physiological Results

نویسندگان [English]

  • M Ghasemzadeh 1
  • H Amiria 2
  • M Khozaei 3
  • A Ismaili 4

1 Department of Biology, Lorestan University, Khorramabad, Iran

2 Department of Biology, University of Isfahan, Isfahan, Iran

3 Department of Biology, University of Isfahan, Isfahan, Iran

4 Department of Biotechnology, Faculty of Agriculture, Lorestan University, Khorramabad, Iran

چکیده [English]

Aim: The chlorophyll biosynthesis pathway is a main target for genetic modification to change plant photosynthesis and growth rate to support a greater demand for food in the growing world population. In this study, the effect of overexpression of GSA gene one of gene involved in biosynthesis pathway of chlorophyll on physiological condition of tobacco plant was investigated. 5-Aminolevulinate (ALA) is product of GSA gene. ALA is a precursor for all tetrapyrrole, these components have impotent roles in living cell, as pigments, light receptor (Phytochrome), prosthetic group of many different proteins (like cytochromes, hemoglobin, myoglobin, and leghemoglobin) and enzymes (for example Catalase, Ascorbate, Peroxidase and etc.). Nowadays, ALA has received wide attention for its widespread usage in agriculture, forestry and medication. ALA at low concentrations increases photosynthesis, growth, development, yield and productivity, also promoted fruit color appearance and quality and taste of products in treated plants under both normal and stressful conditions. ALA also improves antioxidant features, absorption of nutrient, water use efficiency and osmotic balance in plants.
Materials and methods: In this research, according to bioinformatics studies, MsGSA gene cDNA of Alfalfa (Medicago sativa L. cv. Isfahani) was selected to transfer to Xanthi tobacco (Nicotiana tabacum) plant, the binary expression vector pBI121 which has Kanamycin antibiotic resistance gene for selection in bacteria and plants, cutting sites for SacI and BamHI enzyme, CaMV35S promoter (cauliflower mosaic virus promoter), nos transcription termination sequences and ß-glucuronidase (GUS) reporter gene was used. After constructing the gene construct pBI121-GSA and confirming the transfer of the construct using PCR cloning methods, enzymatic digestion and sequencing were performed, then the corresponding construct was transferred to Agrobacterium tumefaciens strain LB4404 using Agrobacterium with the gene construct. The corresponding gene was transferred to the tobacco plant genome and the transgenic plants were selected on the medium containing kanamycin and the presence of the gene was confirmed by performing PCR in the regenerated plants. The rooted transgenic sprouts were transferred to the soil. The level of GSA gene expression in the resulting transgenic plants was evaluated by real-time PCR, and their growth rate and biochemical content were also evaluated.
Results: It was observed that the growth of transgenic plants increased significantly depending on the level of GSA gene expression, and the content of ALA (aminolevulinic acid) and chlorophyll a, b and total chlorophyll, which are the products of the corresponding gene expression. The results also showed the content of anthocyanin, flavonoids and phenol of plants have significantly increased in proportion to the increase in GSA gene expression compared to wild type tobacco plants.
Conclusion: The growth rate as well as the content of chlorophyll a, b, total chlorophyll, ALA, anthocyanin, flavonoids and phenol of transgenic GSA plants is proportional to the increase in the expression of the GSA gene. The results from this study indicate that an increase in transgenic growth rate as well as an increase in the secondary metabolites content in transgenic plants were influenced by GSA transferred gene and an increase in the content of ALA. These results imply that transgenic tobacco plants expressing MsGSA gene had higher resistance potential to stresses than the wild type tobacco plants.

کلیدواژه‌ها [English]

  • 5-Aminolevulinic acid (ALA)
  • chlorophyll
  • antioxidant
  • stress resistance

مقدمه

GSA یک ژن درگیر در مسیر بیوسنتز ALA است. ALA یک پیش‌ساز برای تمام تتراپیرول‌ها مانند کلروفیل، هم، سیروهم، ویتامین B12، فیتوکروموبلین می‌باشد. این اجزا در سلول زنده عملکردهای حیاتی دارند، مانند رنگدانه‌ها (کلروفیل، فیکوبیلی‌پروتئین‌ها)، گیرنده نور (فیتوکروم)، گروه پروستاتیک بسیاری از پروتئین‌های مختلف (مانند سیتوکروم‌‌ها، هموگلوبین، میوگلوبین و لگ‌هموگلوبین) و آنزیم‌هایی (مانند کاتالاز(CAT) ، آسکوربات APX))، پراکسیداز (POD)) و غیره. امروزه ALA بهدلیل استفاده گسترده از آن در کشاورزی، جنگلداری و پزشکی مورد توجه قرار گرفته است (1).‌ به هم پیوستن دو مولکول ALA تولید مونوپیرولی تحت عنوان پورفوبیلینوژن (Porphobilinogen) می‌کند. سپس چهار مولکول پورفوبیلینوژن با هم ترکیب می‌شوند و تتراپیرول حلقوی اوروپورفیرینوژن III  (Uroporphyrinogen III)را تشکیل می‌دهند. مسیر در این نقطه منشعب می‌شود که در یک انشعاب سیروهِم (کوفاکتور نیتریت و سولفیت ردوکتاز که در جذب نیتروژن و گوگرد عمل می‌کند) و کوبالامین (ویتامین B12) تشکیل می‌شود (2). با دکربوکسیلاسیون و اکسیداسیون اوروپورفیرینوژن III تبدیل به پروتوپورفیرین IX (Protoporphyrin IX) که یک مولکول گیرنده نور بسیار قوی (Photosensitizer) است می‌شود. فروکلاتاز (Ferrochelatase) یون Fe2+ و منیزیم کلاتاز  (Magnesium Chelatase) نیز یون Mg2+ را وارد Proto IX می‌کند تا Fe-Proto IX و Mg-Proto IX تولید شود. واکنش‌های بعدی به ترتیب Fe-Proto IX و Mg-Proto IX را به هِم و کلروفیل تبدیل می‌کنند. فیتوکروم هم از تغییر و تبدیلات هِم ایجاد می‌شود (1،3).

تتراپیرول‌هایی چون کلروفیل، هِم و سیروهِم کوفاکتور پروتئین‌های ضروری درگیر در عملکردهای مهم سلول‌ها هستند. تصور می‌شود حدود 2 درصد از پروتئین‌هایی که توسط ژنوم آرابیدوبسیس تالیانا کدگذاری شده‌اند به تتراپیرول‌ها متصل می‌شوند که این میزان پروتئین‌‌های تتراپیرولی نقش محوری آن‌‌ها را در متابولیسم گیاه نشان می‌دهد. پروتئین‌‌‌های متصل به تتراپیرول‌ها تقریبا در همه جای سلول‌های گیاهان وجود دارند (شکل 1). در غشاهای تیلاکوئیدی کلروپلاست‌ها، اغلب پروتئین‌ها متصل به کلروفیل هستند که بر اساس سطح تشکیل دهنده تیلاکوئیدها حدود 80 درصد سطح آن‌‌ها را شامل می‌‌شوند (4). پروتئین‌های آنتن‌های گیرنده نور هر دو کلروفیل a و b را متصل می‌‌ کنند، در حالی که پلی‌‌پپتیدهای مرکز واکنش در فتوسیستم‌ها فقط واجد کلروفیل a هستند. مرکز واکنش فتوسیستم II همچنین حاوی فئوفیتین a است، که در واقع یک کلروفیلید است که فاقد یون مرکزی Mg2+ است. علاوه بر این نشان داده شده است که زیرواحد IV کمپلکس سیتوکروم b6/f به یک مولکول کلروفیل a متصل می‌‌‌‌‌‌‌‌‌شود (5). همچنین کمپلکس سیتوکروم b6/f دارای هِم به عنوان گروه پروستاتیک در سیتوکروم های نوع  bو f است. نیتریت ‌‌ردوکتاز و سولفیت‌‌ ردوکتاز در پلاستید دارای نوع دیگری از تتراپیرول تحت عنوان سیروهِم هستند که واسطه انتقال الکترون از مراکز [4Fe-4S] این آنزیم‌‌‌‌‌‌‌‌‌‌‌‌ها برای احیای نیتریت یا سولفیت است که واسطه‌‌‌‌‌‌‌‌‌‌‌‌های کلیدی در جذب نیتروژن و گوگرد هستند. خانواده گیرنده‌‌های نوری فیتوکروم از یک کروموفور خطی تتراپیرول تحت عنوان فیتوکروموبلین برای دریافت نور قرمز و مادون قرمز (Infrared) استفاده می‌‌کنند. فیتوکروموبلین با آپوپروتئین‌های فیتوکروم در سیتوزول ترکیب می‌شود، اما با فعال شدن توسط نور، فیتوکروم‌ها به هسته‌ منتقل می‌شوند (6).

 

 

 

شکل 1: حضور پورفیرین‌ها در همه مکان‌های سلول و محل استقرار تتراپیرول‌ها در سلول‌های گیاهان عالی. پروتئین‌های شناخته شده متصل شونده به تتراپیرول با توجه به کوفاکتور تتراپیرول مربوطه خود با رنگ‌های متفاوتی مشخص شده‌اند: آبی، فیتوکروموبلین؛ قرمز، هِم؛ سبز، کلروفیل و قهوه‌ای، سیروهم. تتراپیرول‌ها به‫صورت شماتیک نشان داده شده‌اند و ساختار دقیق‌تر آن‌ها در قسمت پایین شکل نشان داده شده است. *پروتوپورفیرینوژن (با یک حلقه تتراپیرول بدون رنگ مشخص شده است) برای سنتز هِم از پلاستیدها به میتوکندری ارسال می‌شود. **کلروفیل‌ها به کاتابولیت‌های کلروفیل غیرفلورسنت (Non-Fluorescent Chlorophyll Catabolites: NCC) تجزیه می‌شوند و به واکوئل فرستاده می‌شوند. فلش‌های خط‌چین مسیرهای بیوسنتزی را نشان می‌دهد. فلش‌های یک‌پارچه انتقال تتراپیرول را نشان می‌دهد و علامت سوال نشان ‌دهنده نبود شواهد کافی برای مسیر انتقال است [5].

ALA در غلظت‌های پایین (30-100 میلی‌گرم در لیتر) می‌تواند فتوسنتز، رشد، نمو، عملکرد و بهره‌وری را افزایش دهد، همچنین ظاهر، رنگ میوه (7-9)، کیفیت و طعم محصولات را در گیاهان تیمار شده (9) را هم در شرایط عادی و هم شرایط استرس‌زا بهبود می‌بخشد. ALA همچنین جذب مواد مغذی (11، 10) ، ویژگی‌های آنتی‌اکسیدانتی (12) و تعادل اسمزی و کارایی مصرف آب را در گیاهان بهبود می‌‌بخشد. مطالعات متعدد نشان داده است که ALA مقاومت گیاهان مختلف را به طیف وسیعی از تنش‌های زیستی (13) و غیرزیستی مانند علف‌‌‌‌‌‌کش‌‌‌‌‌‌ها (14)، سایه (15)، گرما (16)، سرما (17)، یخبندان (18)، خشکسالی (19)، نمک (20) و فلزات سنگین (21)، غرق‌آب (22)، کمبود مواد مغذی (10) وUV-B  (23) را افزایش داده است. ALA همچنین جوانه زنی بذر را تسریع می‌کند (24) و نیز به‫عنوان یک تنظیم کننده جدید رشد گیاه (NPGR New plant growth regulator:) و محرک رشد (25) شناخته شده است. مطالعات نشان داده که ALA تاثیر مستقیم در بیان ژن‌های هسته‌ای (Nuclear gene expression: NGE) دارد (26). ALA در غلظت‌های بالا به‫عنوان یک علف‌کش یا حشره‌کش سازگار با محیط‌زیست و زیست تخریب‌پذیر شناخته می‌شود (28 ،27). ALA علاوه بر استفاده فراوان در کشاورزی و جنگلداری، در پزشکی، تغذیه و لوازم آرایشی نیز کاربرد گسترده‌ای دارد (30 ،29).

با توجه به فواید متعدد ALA و نیز نقش بالقوه آن در گیاهان و مطالعات بیوانفورماتیک مبنی بر جایگاه ژن GSA (31) این ژن جهت فوق‌بیان انتخاب شد. برای برخورداری بیان بالاتری از ژن GSA مطالعات و بررسی میزان تولید بیوماس در گیاهان مختلف همراه با بررسی‌های بیوانفورماتیکی انجام گرفت تا گیاهی با بیان بالایی از ژن GSA انتخاب شود. مطالعات قبلی نشان می‌داد که از یک‫طرف گیاه یونجه داری رشد و بیوماس بالایی می‌باشد (32) و از طرف دیگر مطالعات بیوانفورماتیکی انجام شده با نرم افزار Genevestigator بر اساس داده‌های ریزآرایه‌ای (Microarray data) نشان داده بود که بیان ژن GSA در گیاه یونجه در مراحل تمایزی (Developmental stages) و نیز اندام‌های آناتومیکی (Anatomical stages) مختلف بیان بالایی دارد (31) و لذا جهت برداشت ژن GSA این گیاه انتخاب شد.

شکل 1 درخت فیلوژنتیک ژن GSA. کلادوگرام ارتباط ژن‌های GSA را در 73 ژن GSA در گونه‌های گیاهی خشکی‌زی نشان می‌دهد. هم‌ترازی توالی‌ها با استفاده از روش ClustalW و گروه‌بندی آن‌ها به روش Neighbor-Jining انجام شد. مقادیر بوت استرپ از 1000 شبه تکرار برای ایجاد کلادوگرام و برای تعیین دقت درخت فیلوژنتیک استفاده شد. درخت فیلوژنیک توسط MEGA7 طراحی شده است. ده کلاد مختلف در میان این گونه مشخص هستند. کلادهایی که مشابه ژن‌های گیرنده و اهداکننده هستند، پررنگ نشان داده شده‌اند. یونجه (M. sativa) به عنوان گیاه دهنده ژن با رنگ قرمز و تنباکو (Nicotiana tabacum) به عنوان گیاه گیرنده ژن با رنگ قرمز و به صورت زیر خط دار نشان داده شده است.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

در این مطالعه، ژن GSA گیاه یونجهMedicago sativa L.  برای افزایش فعالیت GSA و مطالعه عملکرد رشد گیاه و سنتز رنگدانه به ژنوم تنباکو معرفی شد.

2- مواد و روش‌ها:

مواد گیاهی و ضدعفونی سطحی: در این مطالعه از گیاه یونجه M. sativa L. به‫عنوان دهنده ژن استفاده شد. بذرهای گیاه یونجه از شرکت پاکان بذر تهیه شد سپس این بذرها در گلدان کشت داده شد و وقتی رشد گیاه به مرحله 5 برگی رسید از یکی از برگ‌های جوان 3-4 نمونه گیاهی جهت استخراج RNA استفاده شد. از گیاهNicotiana tabacum L. Xanti   نیز به‫عنوان گیرنده ژن استفاده شد. بذر گیاه تنباکو جهت تهیه نمونه برگی برای تلقیح با اگروباکتریوم به‫منظور حذف آلودگی‌ها و عوامل بیماری‌زا ضدعفونی شدند، بذور به‫ترتیب با اتانول 70 درصد (به‫مدت 30 ثانیه)، آب مقطر استریل، هیپوکلریت سدیم‎‏ 5درصد (به‫مدت ده دقیقه) و در نهایت سه بار متوالی شستشو ‏با آب مقطر استریل ضد عفونی شدند. بذرها بعد از خشک شدن بر روی کاغذ صافی استریل به محیط کشت جوانه‌زنی ‏که حاوی ‏محیط کشت ‏MS‏ کامل (33) بود منتقل گردیدند و ‏در اتاق رشد با دوره‌ی نوری 16 ساعت روشنایی و هشت ساعت تاریکی با شدت نوری 500 تا 600 میکرومول فوتون بر متر مربع بر ثانیه (µmol m-2 s-1) و درجه‌ی حرارت 25 درجه‌ی ‏سانتی‌گراد نگه‌داری شدند.‏

 طراحی آغازگرها با نرم افزار Primer 3 : طراحی آغازگرها با استفاده از نرم افزار پرایمر 3 (Primer 3) و با استفاده از اطلاعات بدست آمده از ترادف ژن  GSAگیاه یونجه (با شماره دسترسی HQ244440.1) در پایگاه NCBI انجام گرفت. این آغازگرها با نرم‌‌افزارهایOligoanalyzer  به طور کیفی بررسی شدند. توالی اولیگونوکلئوتیدهای مورد استفاده به‫عنوان آغازگرها و نیز جایگاه‌های برشی طراحی شده برای آنها در جدول 1  نمایش داده شده است. در این جدول آغازگرهای طراحی شده برای PCR کیفی این مطالعه نیز ارائه شده است.

 

جدول 1: آغازگرهای و جایگاه برشی ژنGSA  گیاه یونجه.

نوع آغازگر

جایگاه برشی

ترادف

آغازگر پیشرو ژن GSA گیاه یونجه

BamHI

5'> GGATCCAAAATGGCTGCTTCGGGTATT <3'

آغازگر معکوس ژن GSA گیاه یونجه

SacI

5'> GAGCTCTCAGATCTCCCTAAAGA <3'

آغازگر پیشرو ژن GSA برای ریل تایم

-

5´>GATTCCGTCAAAGGTGCTCG<3´

آغازگر معکوس ژن GSA برای ریل تایم

-

5´>GTGGCAGCTTTAGGAACACC<3´

آغازگر پیشرو ژن actin برای ریل تایم

-

5´>TTTCCTGGCATTGCAGATCG<3´

آغازگر معکوس ژن actin برای ریل تایم

-

5´>TTTGCGGTGGACAATGGAAG<3´

 

استخراج RNA : استخراج RNA کل با استفاده از کیت‌های ایرایزول (RNA Biotech Co.، اصفهان، ایران) طبق دستورالعمل مربوطه انجام شد. بدین ترتیب 100 میلی‌گرم از بافت برگ همراه با نیتروژن مایع پودر شد، 1 میلی‌لیتر بافر استخراج RNA به آن اضافه شد. سپس مخلوط  به‫مدت 5 دقیقه در دمای اتاق (28 درجه سانتی‫گراد) انکوبه شد و 200 میکرولیتر کلروفرم اضافه شد و به‫مدت 30 ثانیه به‫شدت تکان داده شد. مخلوط مزبور  به‫مدت 5 دقیقه در دمای اتاق انکوبه شد و سپس با سرعت 10000 دور در دقیقه  به‫مدت 8 دقیقه سانتریفیوژ (مدل MPW) شد که منجر به تشکیل دو لایه جداگانه گردید. لایه شفاف بالایی که حاوی RNA بود به‫دقت جدا شد و به یک میکروتیوب عاری از نوکلئاز منتقل شد و سپس 1 میلی‌لیتر اتانول 100درصد سرد اضافه شد و در دمای 20- درجه سانتی‫گراد به‫مدت 15 تا 20 دقیقه انکوبه شد. در نهایت نمونه  به‫مدت 8 دقیقه در 10000 دور در دقیقه سانتریفیوژ شد. سپس مایع رویی دور ریخته شد و 50 میکرولیتر آب فاقد RNase به رسوب خشک شده اضافه شد. غلظت و خلوص RNA با نانو اسپکتروفتومتر (Epoc، Biotech، USA) و الکتروفورز با استفاده از ژل آگارز 1 درصد تعیین شد.

سنتز cDNA و تکثیر قطعه ژن: RNA استخراج شده باDNase I  شرکت زیست فناوران رنا اصفهان تیمار شد و سنتز cDNA با استفاده از کیتRB MMLV Reverse Transcriptase  همان شرکت طبق دستورالعمل انجام شد. ابتدا 5 میکرولیتر از RNA تیمار شده با پرایمر، 1 میکرولیتر الیگو (dT) و 1 میکرولیتر dNTP و 2 میکرولیتر آب دو بار تقطیر مخلوط شد. این مخلوط  به‫مدت 10 دقیقه در 65 درجه سانتی‫گراد حرارت داده شد و سپس به سرعت  به‫مدت 10 دقیقه روی یخ قرار گرفت. سپس 1میکرولیتر آنزیم MMLV و 3 میکرولیتر بافر آنزیم به میکروتیوب اضافه شد. مخلوط  به‫مدت 60 دقیقه در دمای 50 درجه سانتی‫گراد حرارت داده شد و سنتز cDNA در نهایت در دمای 72 درجه سانتی‫گراد به‫مدت 15 دقیقه به پایان رسید. PCR جهت تکثیر قطعه مزبور از آنزیم pfu DNA Polymerase که دارای خاصیت اصلاح خطا است، استفاده شد و دمای تخصصی برای هر جفت پرایمر پیش‌بینی شد. برای واسرشت اولیه در دمای 95 درجه سانتی‫گراد به‫مدت 5 دقیقه و سپس در دمای 94 درجه سانتی‫گراد  به‫مدت 30 ثانیه فرایند واسرشت سازی تکمیل شد. در ادامه مرحله‌ی اتصال پرایمر در دمای تخصصی هر جفت پرایمر  به‫مدت 60 -30 ثانیه بسته به طول ژن مورد نظر انجام می‌گیرد. فرایند سنتز یا پلیمر شدن قطعه مورد نظر در دمای 72‫ به‫مدت 2 دقیقه برای هر ژن نهایی ‌گردید. در پایان تکمیل فرایند سنتز در تک دمای 72 درجه سانتی‫گراد و تک زمان 10 دقیقه PCR مورد نظر را به پایان ‌رساند. محصول PCR بر روی ژل آگارز 1درصد با استفاده از TBE الکتروفورز شد.

باکتری‌ها: در این تحقیق از دو باکتری  Eschrichia coliسویه  DH5αکه از انستیتو پاستور ایران تهیه شد و Agrobacterium tumefaciens سویه LBA4404 که از پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری تهیه شد استفاده شد. از باکتری  E. coli به‫عنوان میزبان برای نگه‫داری و تکثیر ناقل واجد سازه ژن (PBI121+GSA) استفاده شد و از
A. tumefaciens جهت انتقال ژن مورد نظر و جایگزینی آن در ژنوم گیاه تنباکو استفاده شد.

ناقل: در مطالعه‌ی حاضر از ناقل بیانی دوگانه گیاهی ‏pBI121‎‏ به‫منظور بیان قطعه‌ی همسانه‌سازی شده در گیاه ‏استفاده شد. این ناقل دارای ژن مقاومت به آنتی‌بیوتیک کانامایسین (Neomycin phosphotransferase II: nptII) جهت گزینش در باکتری و گیاه، جایگاه‌های برشی برای آنزیم‌های ‏‎SacI و ‏BamHI، پیش‌بر ‏CaMV35S‏ (پیش‌بر ویروس موزائیک کلم)، ‏توالی‌های خاتمه دهنده­ی نسخه‌برداری ‏nos و ژن گزارشگر ß-glucuronidase ‏‎(GUS) می‌باشد. جایگاه‌های برشی آنزیم‌های ‏‎SacI و ‏BamHI در دو طرف ژن GUS وجود داشت و توسط این جایگاه‌های برش ژن GUS از ناقل خارج شد و ژن GSA جایگزین آن شد.

ساخت ژن کایمریک و انتقال آن به پلاسمید: پس از تخلیص ژن GSA و پلاسمید، برای اتصال (Ligation)‏ قطعات ‏DNA‏ از آنزیم ‏T4 DNA Ligase‏ استفاده می‌شود. مواد واکنش ‏اتصال به منظور اتصال‎ ‎پایانه‌های چسبنده‌ی قطعه‌ی ژن به ناقل تهیه و مخلوط شد. ‏به‫طور هم‌زمان در واکنشی دیگر به ‌‌منظور کنترل هم‌جوشی ‏ناقل ‏pBI121‎، از مواد واکنش اتصال به ‏استثنای ژن GSA‏ استفاده شد. پلاسمید نوترکیب حاصل به داخل سلول‌های باکتریایی مستعد E. coli سویه DH5α منتقل گردید. محصول این فرایند بر روی محیط کشت LB جامد دارای 100 میلی‌گرم در لیتر کانامایسین کشت شد و  به‫مدت 8 ساعت در دمای 37 درجه سانتی‫گراد قرار داده شد. از کلنی‌های رشد کرده در این شرایط تست PCR به همراه پرایمر اختصاصی GSA و هضم آنزیمی انجام گرفت.

تخلیص پلاسمید: پلاسمید حاوی سازه PBI121-GSA در محیط‌ کشت LB مایع دارای آنتی‌بیوتیک کانامایسین (100 μg/ml) کشت داده و  به‫مدت 12 ساعت در دمای 37 درجه سانتی‫گراد در انکوباتور شیکردار نگه‌داری شد. به‫منظور تخلیص پلاسمید محیط کشت مربوطه سانتریفیوژ شد. سپس محلول رویی دور ریخته و از رسوب باقی‌مانده جهت استخراج پلاسمید به روش لیز قلیایی از کیت استخراج پلاسمید زیست فناوران رنا (RB-1003C) طبق پروتکل شرکت مربوطه استفاده شد. در نهایت محلول به‫دست آمده که حاوی پلاسمید است بر روی ژل آگارز یک درصد بررسی شد.

انتقال سازه ژن کایمریک به اگروباکتریوم: پلاسمید حاوی سازه کایمریک pBI121-GSA استخراج شد و بر اساس پروتکل انجماد/ذوب بهA. Tumefaciens   سویه LBA4404 وارد شد (34). پس از تایید PCR مثبت A. tumefaciens با ناقل pBI121-GSA، از اگروباکتریوم تراریخته شده برای تراریخته نمودن تنباکو بر اساس روش قطعات برگ (Leaf-disk) استفاده شد (35). سپس این قطعات برگ  به‫مدت دو روز به محیط‌کشت MS جامد به‫عنوان محیط هم‌کشت انتقال داده شدند و در تاریکی قرار گرفتند. پس از طی این زمان به محیط کشت MS حاوی هورمون‌های NAA و BAP برای تحریک باززائی گیاه و نیز آنتی‌بیوتیک‌های کانامایسین و سفوتاکسیم منتقل شدند، پس از 21 روز جوانه‌های رشد کرده به محیط‌کشت واجد آنتی‌بیوتیک جهت ریشه‌دار شدن جوانه‌ها منتقل گردیدند. برگ گیاهان باززایی شده جهت استخراج DNA مورد استفاده قرار گرفت و گیاه‌های بازیابی شده‌ای که دارای سازه ژن GSA بودند انتخاب شده و به محیط کشت محرک ریشه‌زایی منتقل شدند.

سازگاری به محیط و انتقال به گلخانه: پس از حدود یک ماه گیاهان جوانه‌ زده و رشد کرده و ریشه‌دار شده به گلدان منتقل شده و شرایط سازگاری با محیط گلخانه برای آن‌ها مهیا گردید سپس حدود 3 ماه پس از انتقال گیاهان به خاک، مرحله گلدهی آغاز گردید. جهت خودگشنی و تولید بذر جورتخم  (Homozygous)از پاکت‌های کاغذی برای پوشانده شدن گل‌های تنباکو استفاده شد. پس از مرحله بذرگیری با کشت دوباره بذرها روی محیط کشت MS حاوی آنتی بیوتیک کانامایسین، نسل اول، دوم و سوم بذرها به‫دست آمد و آنالیزهای مورد نظر بر روی گیاهان نسل دوم انجام گرفت.

سفیدشدگی و فتواکسیداسیون (Photobleaching): گیاهان ترایخت حاصل در شدت نوری بالا (μmol m−2 s−1 2500 که این شدت نوری معادل شدت نور در ظهر تابستان می‌باشد) نیز دارای رشد طبیعی بوده و آثاری از سفیدشدگی و فتوبلیچینگ (Photobleaching) در آن‌ها مشاهده نشد.

PCR کمی: RT-PCR با استفاده از مستر میکس سایبرگرین RB S3p (شرکت زیست فناوران رنا، اصفهان) و دستگاه Biosystems™ StepOne™ Real-Time PCR System (Thermo Fisher Scientific, ABI, USA) طبق دستورالعمل‌های مربوطه و روش کمّی- مقایسه‌ای Ct (ΔΔCt) انجام شد. مخلوط واکنش با 5/12 میکرولیتر مستر میکس سایبرگرین RB S3p ، 5/0 میکرومولار از هر آغازگر و 100 نانوگرم cDNA تهیه شد و در نهایت حجم نهایی با آب دیونیزه استریل به 25 میکرولیتر رسید. PCR کمی جهت واسرشت اولیه به‫مدت 5 دقیقه در دمای 95 درجه سانتی‫گراد و واسرشت به‫مدت 15 ثانیه در دمای 95 درجه سانتی‫گراد ، دمای اتصال ویژه برای هر جفت آغازگر 20 ثانیه و طویل شدن در 72 درجه سانتی‫گراد برای 30 ثانیه همه برای 45 چرخه برنامه‌ریزی شد. تمام آزمایش‌ها در مورد نمونه‌های بیولوژیکی در سه تکرار و در مورد روش‌های فنی در دو تکرار انجام شد. به‫منظور تایید محصولات تکثیر شده، یک منحنی ذوب تجزیه و تحلیل ترسیم شد (36). تغییرات نسبی در سطح بیان ژن در نمونه‌های cDNA مورد بررسی با استفاده از رابطه 1 محاسبه شد:

رابطه 1

 

در این رابطه Etarget کارایی پرایمرهای ژن‌های هدف، Eref کارایی ژن کنترل داخلی و Ct چرخه آستانه هر یک از نمونه‌های cDNA است. در این مطالعه از ژن اکتین به عنوان یک کنترل داخلی برای نرمال‌سازی داده‌های بیان ژن استفاده شد. کارایی هر جفت پرایمر توسط نرم افزار LinRegPCR نسخه 2012.3 (37) و مقادیر سیکل آستانه (Ct) برای هر cDNA از نرم‌افزار StepOne (v. 2.3, Thermo Fisher Scientific, ABI) به‫دست آمد.

بررسی‌های رشدی: برای انجام بررسی‌های رشدی 15 نمونه از نسل دوم هر کدام از لاین‌های یک، سه و چهار گیاهان تراریخته و تیپ وحشی در شرایط یکسان با استفاده از بذر بر روی خاک سبک متشکل از نسبت مساوی کوکوپیت، پیت‌ماس و پرلیت رشد داده و در پایان دو ماهگی برداشت گردید و وزن‌تر و خشک گیاه کامل مورد بررسی قرار گرفت. کلیه آنالیزها در 12 تکرار اندازه‌گیری شد. آنالیز واریانس داده‌ها با استفاده از نرم افزار SPSS نسخه 25 انجام شد. مقایسه میانگین داده‌ها با آزمون دانکن و معنی‌داری تیمارها در سطح 05/0 محاسبه شد .

اندازه‌گیری محتوای کلروفیل: برای اندازه گیری محتوای کلروفیل از روش آرنون استفاده شد (38). 100 میلی‌گرم از چهارمین یا پنجمین جوان‌ترین برگ کاملا رشد یافته گیاهان 8 هفته‌ای در 2 میلی‌لیتر استون 80 درصد همگن شدند. عصاره‌ها در 6000 دور در دقیقه سانتریفیوژ شدند و جذب محلول فوقانی در سه تکرار اندازه‌گیری شد. جذب در طول موج‌های 480، 645 و 663 نانومتر توسط دستگاه الایزا ریدر (BioTekspectrophotometer Epoch) اندازه گیری شد. مقدار کلروفیل با استفاده از فرمول آرنون محاسبه شد:

 

 

 

V   حجم محلول رویی بر حسب میلی‌لیتر وW   وزن نمونه بر حسب گرم را نشان می‌دهند و محتوای کلروفیل بر حسب میلی‌گرم در گرم وزن برگ تازه (FW) بیان شده است.

اندازه‌گیری محتوای ALA: محتوی ALA در نمونه‌های گیاه تنباکو طبق روش ماوزلا و کرنیک و با اعمال تغییراتی توسط خزایی و همکاران (39)  اندازه‌گیری شد (40). 100 میلی‌گرم از جوان‌ترین برگ‌های کاملاً رشد یافته تنباکو در 1 میلی‌لیتر بافر فسفات 50 میلی‌مولار ساخته شده از مخلوط K2HPO4 وKH2PO4  در (pH 6.8) ساییده شدند. نمونه‌ها  به‫مدت 10 دقیقه در شتاب g 16000 سانتریفیوژ شدند و سپس 400 میکرولیتر از مایع رویی با 100 میکرولیتر اتیل‌استواستات مخلوط شد و  به‫مدت 10 دقیقه در دمای 100 درجه سانتی‫گراد جوشانده شد. پس از سرد شدن نمونه‌ها، دوباره  به‫مدت 5 دقیقه در شتابg 16000 سانتریفیوژ شدند و مایع رویی به یک تیوب جدید منتقل شد و با 500 میکرولیتر معرف ارلیخ (Ehrlich) اصلاح شده که متشکل است از 373 میلی‌لیتر اسیداستیک، 90 میلی‌لیتر اسید پرکلریک 70 درصد (v/v) و 5/1 گرم کلرید نقره و 1/9 گرم 4-دی متیل‌آمینوبنزآلدئید که با آب دو بار تقطیر به حجم 1 لیتر رسانده شد. میزان جذب نمونه‌ها در 553 نانومتر اندازه‌گیری شد و محتوای ALA نمونه‌های تنباکو با استفاده از منحنی استاندارد به‫دست آمده از ALA تجاری که هدیه‌ای از دکتر Sinan Battah از انگلیس، در غلظت‌های 0، 50، 100، 150، 200، 250، 300 نانوگرم محاسبه شد. کلیه آنالیزها در 3 تکرار اندازه‌گیری شد. آنالیز واریانس داده‌ها با استفاده از نرم افزار SPSS نسخه 25 انجام شد. مقایسه میانگین داده‌ها با آزمون دانکن و معنی‌داری تیمارها در سطح 05/0 محاسبه شد .

اندازه‌گیری میزان فلاونوئید : به‫منظور سنجش محتوای فلاونوئید 1/0 گرم بافت‌تر برگ با متانول 80 شد و عصاره حاصل با سرعت 4000 دور در دقیقه و در دمای 4 درجه سانتی‌گراد سانتریفیوژ شد. سپس 100 میکرولیتر از عصاره حاصل با 200 میکرولیتر متانول 80 درصد، 200 میکرولیتر کلرید آلومینیوم 10 درصد و 200 میکرولیتر سدیم استات (1 مولار) مخلوط و پس از 30 دقیقه جذب نمونه‌ها در طول موج 415 نانومتر توسط اسپکتروفتومتر UV-VIS اندازه‌گیری شد. از کوئرستین به‫عنوان استاندارد استفاده شد (41).

اندازه‌گیری میزان آنتوسیانین: به‫منظور سنجش محتوای آنتوسیانین 1/0 میلی‌گرم بافت‌تر در 5 میلی‌لیتر متانول اسیدی شده ساییده شد (متانول خالص و اسید کلریدریک خالص به نسبت حجمی‌1:99). در دمای اتاق (25 درجه سانتی‌گراد)  به‫مدت 24 ساعت در تاریکی مطلق نگه‫داری شد. عصاره حاصل در 4000 دور در دقیقه  به‫مدت 10 دقیقه سانتریفیوژ شد. جذب عصاره‌های متانولی اسیدی در طول موج ۵۵0 نانومتر قرائت شد. ضریب خاموشی (ɛ)  M-1 cm-133000 استفاده شد. نتایج حاصل بر حسب میلی‌مول بر گرم وزن‌تر محاسبه و ارائه شد (42).

اندازه‌گیری میزان فنل کل: 10 میلی‌لیتر متانول درصد به 1/0 گرم بافت‌تر برگ اضافه شد و سپس برگ ساییده شد و نمونه‌ها  به‫مدت 10 دقیقه با سرعت 4000 دور در دقیقه سانتریفیوژ شد و محلول رویی جمع آوری شد. مقدار ترکیبات فنلی کل در عصاره‌ها بر اساس روش Folin-Ciocalteu اندازه‌گیری شد و از گالیگ اسید نیز به‫عنوان استاندارد استفاده شد (43).

3- آنالیز آماری:

آزمایش کشت گلدانی در قالب طرح کاملا تصادفی با حداقل چهار تکرار مستقل انجام شد. برای تمامی تحلیل‌های آماری از نرم‌افزار SPSS (نسخه 25، SPSS Inc., Chicago, IL, USA) استفاده شد. داده‌ها از نظر آماری بین تیمارهای مختلف و شاهد با استفاده از آنالیز واریانس (ANOVA) و سپس آزمون مقایسه چندگانه دانکن در سطح اطمینان 05/0 مقایسه شدند. در جداول و شکل‌ها، تفاوت‌های معنی‌دار (05/0 > P) بین لاین‌های تراریخته و نوع وحشی برای پارامترهای مختلف ارزیابی‌شده به صورت حروف متفاوت گزارش شده‌اند.

4- نتایج

استخراج RNA گیاهی و تهیه cDNA کل و تکثیر ژن با پرایمر

RNA گیاه یونجه کشت شده پس از رسیدن به مرحله‌‌ی چندبرگی استخراج شد سپس به‫منظور تایید کیفیت بر روی ژل آگارز یک درصد برده شد و RNA استخراج شده تایید شد (شکل 3- الف). از RNA استخراج شده و تایید شده جهت تهیه cDNA طبق پروتکل ذکر شده در قبل استفاده شد. کیفیت محصول cDNA با الکتروفورز مورد بررسی قرار گرفت و مورد تایید قرار گرفت (شکل 3- ب).

 

 

شکل 3: الف) تصویر الکتروفورز محصول RNA کل، ستون 1و 2: RNA کل استخراج شده از برگ گیاه یونجه. ستون 3: نشانگر وزن مولکولی DNA ( kb1کاپا). ب) تصویر الکتروفورزcDNA  ژن  GSAگیاه یونجه، ستون 4: cDNA ژن  GSAگیاه یونجه، ستون 5: نشانگر وزن مولکولی DNA ( kb1کاپا).

همسانه‌سازی ژن GSA در E. coli و تایید حضور ژن در کلون‌ها

پس از ساخت قطعه ژن مورد نظر و توالی‌یابی و اطمینان از صحت و عدم وقوع موتاسیون در قطعه ژنی قطعه تکثیر شده در پلاسمید pBI121 بین جایگاه‌های برشی BamHI و SacI به‫جای توالی ژن GUS همسانه‌سازی شد. از انتقال نصف محصول اتصال به باکتری E. coli مستعد (Competent cells) تهیه شده تعداد زیادی کلونی روی محیط کشت گزینشی لوریا بوروس (Luria Broth: LB) واجد کانامایسین حاصل شد. به‫منظور بررسی صحت فرایند همسانه‌سازی، روی کلونی‌های رشد یافته بر روی محیط‌کشت داری آنتی‌بیوتیک کانامایسین از سه روش کلونی PCR، هضم آنزیمی کلون‌های کایمریک و تعیین توالی قطعه همسانه‌سازی شده استفاده شد که نتایج آن‌ها در شکل 4 ارائه شده است. نتایج کلونی PCR، هضم آنزیمی را نشان دادند.

همسانه‌سازی ژن GSA در پلاسمید pBI121 و انتقال به سلول‌های مستعد باکتری پس از همسانه‌سازی ژن مورد نظر در پلاسمید هدف pBI121 انجام شد. جهت تولید حداکثری ژن مورد نظر وکتور به سلول‌های باکتری‌های مستعد ایکولای منتقل و پس از کشت شبانه در حضور آنتی‌بیوتیک کانامایسین ابتداPCR  کلونی بر روی تعدادی از کلون‌های مثبت شد کرده در محیط آنتی‌بیوتیک جهت تایید وجود ژن مورد نظر انجام شد (شکل 4- الف) در ادامه کلونی‌های مثبت جهت کشت و استخراج وکتور به محیط کشت LB با حضور آنتی بیوتیک منتقل شدند. پلاسمید استخراجی از باکتری‌های رشد کرده استخراج و خالص‌سازی شد و جهت بررسی کیفیت الکتروفورز گردید (شکل 4- ب). پلاسمیدهای استخراجی در نهایت هدف هضم آنزیمی دوطرفه قرار گرفتند و نتایج دال بر وجود ژن GSA در آنها داشت (شکل 4- ج). بر محصول هضم آنزیمی نیز توالی‌یابی انجام پذیرفت تا صحت و سلامت ژن بررسی گردد. برای این کار از ناقل پلاسمیدیpUC19  استفاده شد. تجزیه توالی و بررسی هم‌خوانی با نرم افزار Mega v.7 انجام شد.

 

شکل 4: الف) تصویر الکتروفورز تایید حضور ژن GSA در باکتری با انجام کلونی PCR (ستون 1 تا 5)، ستون 6: نشانگر وزن مولکولی  DNA( kb1کاپا). ب) تصویر الکتروفورز استخراج پلاسمید. ستون 7 و 9پلاسمید pBI121 استخراج شده، ستون :8 نشانگر وزن مولکولی  DNA( kb1کاپا). ج) تصویر الکتروفورز تایید حضور ژن GSA در ناقل pBI121 با استفاده از هضم آنزیمی با آنزیم‌های برشی Bam HI و Sac I. ستون 9: نشانگر وزن مولکولی  DNA( kb1کاپا)، ستون 11 و 12 قطعات هضم آنزیمی.

تراریخته نمودن گیاه تنباکو

پس از هم‌کشتی  (Co-culture)اگروباکتریوم واجد سازه ژن GSA و قطعات برگ، این قطعات به محیط‌کشت واجد هورمون و آنتی‌بیوتیک مناسب منتقل گردید. پس از 21 روز آثار باززایی و تشکیل نوساقه‌ها به‫صورت (Shoot-buds) قابل تشخیص بود (شکل 5- الف و ب) و پس از آن این قطعات دوباره در محیط‌کشت با ترکیب هورمونی و آنتی‌بیوتیکی واکشت گردید تا نوساقه رشد نموده و گیاهچه واجد ساقه و برگ تشکیل شد (شکل 5- ج و د).

 

شکل 5: القای نوساقه‌ها (Shoot-buds) و باززایی مستقیم از قطعات برگ‌‌ تنباکوی تلقیح شده با اگروباکتریوم واجد سازه ژنی، الف وب) تشکیل نوساقه‌ها (Shoot-buds)، ج و د) باززایی مستقیم از قطعات برگ‌‌ تنباکو و تشکیل گیاه‌‌‌چه.

با رشد نوساقه‌ها و قابلیت تشخیص و جداسازی آن‌ها، نوساقه‌ها به محیط‌کشت واجد آنتی‌بیوتیک کانامایسین و سفوتاکسیم جهت ریشه‌زایی منتقل شد. (شکل 6- الف). با تشکیل ریشه و رشد آن بعد از دو سه هفته گیاه چه کامل قابل انتقال تشکیل شد (شکل 6-ب).

 

 

شکل 6: الف) انتقال نوساقه تشکیل یافته به محیط کشت واجد آنتی‌بیوتیک. ب) رشد نوساقه و تشکیل ریشه و تشکیل گیاه‌چه قابل رشد.

تایید تراریخته در گیاهچه‌های باززایی شده

از برگ‌های بالایی گیاه‌چه‌های باززایی شده روی محیط‌کشت حاوی کانامایسین، استخراج DNA انجام گرفت و با انجام PCR روی DNAی استخراجی با پرایمرهای مربوطه وجود ژن GSA در آن‌ها مورد تایید قرار گرفت (شکل 7).

 

شکل 7: تایید حضور ژن GSA در تعدادی از گیاه‌چه‌های رشد یافته. الف) PCR بر روی DNAی استخراجی گیاهان باززایی شده بر روی محیط کشت MS حاوی کانامایسین و سفاتاکسیم با پرایمرهای مربوطه و تایید حضور ژن GSA در تعدادی از آن‌ها.

بیان نسبی ژن GSA

از میان گیاهان تراریخته حاصل سه لاین 1، 3 و 4 برای انجام بررسی‌های بعدی انتخاب شدند که میزان بیان نسبی آن‌ها به ترتیب بیشترین، کمترین و میزان متوسط بیان در میان لاین‌های تراریخته شده حاصل بود. به این ترتیب میزان بیان این ژن در عملکرد فیزیولوژیک گیاه مشخص می‫شود. در شکل 8 میزان بیان نسبی ژن  GSA در هر کدام از این لاین‌های تراریخته نسبت به تیپ وحشی مشخص شد.

 

شکل8: بیان نسبی ژن GSA در تنباکوی تراریخته نسبت به تنباکوی وحشی.

محتوی کلروفیل و ALA

برای بررسی این‫که آیا افزایش فعالیت GSA باعث تغییر مسیر بیوسنتز کلروفیل و ALA به‫عنوان پیش‌ساز اصلی سنتز کلروفیل در گیاهان دارای بیان بیش از حد MsGSA می‌شود، محتوی کلروفیل و ALA تعیین شد. برگ‌های جدید کاملا رشد یافته لاین‌های تراریخته و گیاهان نوع وحشی که در شرایط گلخانه رشد کرده ‌بودند برداشت شد و برای تعیین کمیت کلروفیل و ALA مورد بررسی قرار گرفتند. داده‌ها به‫وضوح نشان داد که به موازات افزایش سطح بیان ژن MsGSA در گیاهان تراریخته، رنگدانه‌های فتوسنتزی به‫طور معنی‌داری تغییر کردند. سطح کلروفیل a و b به‫صورت معنی‌داری از 20 درصد (کلروفیل a) تا 100 درصد (کلروفیل b) در مقایسه با گیاهان نوع وحشی افزایش یافت، همچنین محتوای کل رنگدانه فتوسنتز (کلروفیل a و b) در لاین‌های تراریخته بین 45 تا 70 درصد افزایش یافت (جدول 2). همان‫طور که در جدول 2 نشان داده شده است، بیشترین میزان ALA به ترتیب در لاین‌های T2-1 به‫میزان 65 درصد، T2-4 به‫میزان 40 درصد و T2-3 به‫میزان 25 درصد در مقایسه با گیاهان نوع وحشی یافت شد.

جدول 2 : مقایسه میزان محتوی کلروفیل و ALA در سه لاین تراریخته و تیپ وحشی تنباکو. تاثیر افزایش بیان ژن GSA بر محتوی کلروفیل و ALA برگ‌های جدید کاملا رشد یافته سه لاین تراریخته T2-1، T2-3، T2-4 در مقایسه با تیپ وحشی تنباکو. لاین‌های بیان بیش از حد GSA و نوع وحشی آن در شرایط گلخانه‌ای در سطح نور 600-1500 میکرومول در متر مربع بر ثانیه، 14 ساعت روشنایی/10 ساعت تاریکی و دمای 5±25 درجه سانتی‌گراد و رطوبت نسبی 10±60 درصد رشد کردند. نمونه‌ها از یک برگ جدید کاملا رشد یافته از گیاهان 8 هفته‌ای گرفته شد. مقادیر نشان دهنده میانگین چهار گیاه منفرد (SD ±4) است. حروف مختلف در یک ستون نشان دهنده تفاوت‌های قابل توجه‌ی در سطح اطمینان 95 درصد است.

 

WT

T2-1

T2-3

T2-4

محتوی کلروفیل a

8.85±0.69c

9.97±0.46b

11.71±0.76a

11.62±0.37a

محتوی کلروفیل b

3.1±0.43b

6.42±0.41a

6.95±0.52a

5.86±0.52a

محتوی کلروفیل کل

11.66±0.92b

17.42±3.23a

16.93±2.17a

20.15±2.46a

محتوای ALA

(نانوگرم برگرم از وزن تر برگ)

10.18±1.34c

16.19±0.92a

13.08±0.2b

14.49±0.98ab

بیان نسبی ژن GSA

0

1.45±0.033

0.6±0.02

1.01±0.04

افزایش میزان رشد در لاین‌های تراریخته MsGSA

وزن‌تر در نمونه گیاهان تراریخته لاین‌های 1 و 4 نسبت به تیپ وحشی افزایش معنی‌داری را نشان داد در حالی‫که میزان افزایش وزن‌تر لاین 3 (که میزان بیان کم‫تری از ژن GSA نسبت به دو لاین دیگر دارد) نسبت به لاین وحشی معنی‌دار نیست (شکل 9- الف). به‫طور مشابه وزن خشک در نمونه گیاهان تراریخته لاین‌های 1 و 4 تراریخته نسبت به تیپ وحشی افزایش معنی‌داری نسبت به گیاهان تراریخته نشان داد در حالی‫که میزان افزایش وزن خشک لاین 3 نسبت به لاین وحشی معنی‌دار نیست (شکل 9- ب).

 

 

 

 

 

 

 

 

 

 

 

شکل 9:  بررسی رشد گیاهان تراریخته و تیپ وحشی از نظر وزن تر (الف) و وزن خشک (ب) آن. گیاهان در شرایط گلخانه‌ای با شدت نور 600-1500 میکرومول بر مترمربع بر ثانیه (µmol m-2 s-1)، 14 ساعت روشنایی/10 ساعت تاریکی، دمای 5±25 درجه سانتی‫گراد و رطوبت نسبی 10±60 درصد رشد کردند. نمونه‌ها از جدیدترین برگ کاملا رشد یافته گیاهان 8 هفته‌ای گرفته شد. مقادیر نشان دهنده میانگین دوازده نمونه گیاهی(SD ±12) است. حروف مختلف نشان دهنده تفاوت معنی‌دار در سطح اطمینان 95 درصد است.

محتوی فنل کل، فلاونوئید و آنتوسیانین

میزان محتوای فنل کل در لاین‌های تراریخته به وضوح نسبت به لاین معمولی تنباکو افزایش معنی‌دار پیدا نمود به این صورت که افزایش در لاین T2-1 48 درصد بیشتر از نمونه‌های وحشی تنباکو، در لاینT2-3  19 درصد افزایش و در لاین T2-4 5/31 درصد افزایش مشاهده شد (شکل 10- الف). در خصوص محتوای فلاونوئیدی به‫ترتیب افزایش معنی‌دار 23، 10 و 16 درصدی در لاین‌های T2-1، T2-3 و T2-4 تراریخته مشاهده شد (شکل 10- ب). محتوای آنتوسیانینی نیز به‫طور معنی‌داری به‫ترتیب به‫میزان 12، 7 و 16 درصد در لاین‌های T2-1، T2-3 و T2-4 تراریخته افزایش پیدا کرد (شکل 10- ج).

شکل 10 : محتوی آنتی‌اکسیدانت‌های غیرآنزیمی. الف) محتوی فنل. ب) محتوی فلاونوئیدها. ج) محتوی آنتوسیانین. گیاهان در شرایط گلخانه‌ای با شدت نور 600-1500 میکرومول بر مترمربع بر ثانیه (µmol m-2 s-1)، 14 ساعت روشنایی/10 ساعت تاریکی، دمای 5±25 درجه سانتی‫گراد و رطوبت نسبی 10±60 درصد رشد کردند. نمونه‌ها از جدیدترین برگ کاملا رشد یافته گیاهان 8 هفته‌ای گرفته شد. مقادیر نشان دهنده میانگین چهار نمونه گیاهی(SD ±4)  است. حروف مختلف نشان دهنده تفاوت معنی‌دار در سطح اطمینان 95 درصد است.

5- بحث

این مطالعه نشان داد که فوق بیان ژن MsGSA باعث افزایش محتوای کلروفیل a، b و کلروفیل کل در لاین‌های تراریخته تنباکو می‌شود. در حالی‫که هوفگن و همکاران (44) گزارش کردند که بیان کم ژن GSA در گیاهان تنباکوی تراریخته آنتی‌سنس این ژن، منجر به آسیب شدید گیاهی می‌شود و گیاهان با سفیدشدگی برگ‌ها به دلیل کاهش محتوای کلروفیل طیف گسترده‫ای از الگوهای کلروفیل را در برگ‌ها نشان می‌دهند. محتوای کلروفیل از 10 درصد تا 53 درصد با کاهش بیان ژن GSA از 22 درصد تا 85 درصد نسبت به گیاهان تیپ وحشی در گیاهان آنتی‌سنس کاهش یافت. در مقابل فرادینی و همکاران (45) گزارش کردند که بیان ژن جهش یافته GSA یونجه در گیاه یونجه و تنباکو هیچ تغییری در محتوای کلروفیل یا میزان بیوماس این گیاهان تراریخته ایجاد نکرد. مشاهده شد جهش نقطه‌ای در ژن  GSAبا جایگزینی متیونین به ایزولوسین (M→I) در محل اتصال کوفاکتور GSA باعث می‌شود این آنزیم غیرفعال ‌شود یا فعالیت آن کاهش یابد بنابراین غیرفعال شدن آنزیم باعث عدم افزایش محتوای کلروفیل در این گیاهان فوق بیان می‌شود (45). مطالعات بیشتر نشان داد که افزایش فعالیت آنزیم‌های بیوسنتز کلروفیل ممکن است محتوای کلروفیل و رنگدانه‌ها را تغییر دهد، بیسوال و همکاران (46) در مطالعه‌ای انجام دادند گزارش کردند که بیان بیش از حد کلروفیلید a اکسیژناز (Chlorophyllide A oxygenase: CAO) باعث افزایش محتوای کلروفیل b می‌شود. نتایج بررسی ما نیز مشابه نتایج گزارش شده توسط Biswal و همکاران  است. هنگامی که فعالیت CAO در گیاهان تنباکو و آرابیدوپسیس زیاد شد در نتیجه آن افزایش محتوای ALA، محتوای کلروفیل و افزایش سرعت فتوسنتز مشاهده می‌شود. داده‌های بررسی‌های قبلی شواهدی را ارائه می‌دهند که افزایش میزان فتوسنتز در گیاهان تراریخته CAO عمدتا به‫دلیل افزایش محتوای کلروفیل b و پروتئین‌های متصل شونده به کلروفیل می‌شود و در نتیجه افزایش جذب‌ نور می‌شود (47 ،46). تغییر در میزان رنگدانه فتوسنتزی در گیاهان تنباکوی فوق بیان MsGSA و گیاهان تنباکوی آنتی‌سنس GSA و همچنین گیاهان تنباکوی و آرابیدوپسیس فوق بیان CAO نشان دادند که تغییرات اندک میزان بیان ژن‌های مسیر سنتز تتراپیرول باعث تغییرات تنظیمی زیادی در این مسیر می‌شود (50 ،48).

​ پاتانیاک و تریپاتی (51) همچنین نشان دادند که فوق بیان پروتوکلروفیلید اکسیدوردوکتازC (PORC) محتوای کلروفیل را تا 28 درصد نسبت به گیاهان تیپ وحشی افزایش داده است. محتوای بالای کلروفیل در برگ‌های تراریخته MsGSA
(جدول 2) می‌تواند برای افزایش برداشت کوانتوم نور در شرایط نور طبیعی مفید باشد. Chlb جز اصلی رنگدانه‌ای گیرنده‌های نوری (Antenna complex) فتوسیسم‌ها است، بنابراین افزایش محتوای Chlb برای برداشت کوانتومی که منجر به تولید انرژی در قالب ATP یا NADP می‌شود ارزشمند است (47). نتایج به‌دست‌ آمده در این بررسی نیز این نظر را تایید می‌کند
(جدول 2). علاوه بر این بهره‌وری برداشت نور یک فتوسیستم عمدتا به اندازه آنتن فتوسنتزی آن بستگی دارد. پیشنهاد شده است که اندازه آنتن توسط بیوسنتز کلروفیل b کنترل می‌شود و شکل‌گیری اندازه آنتن به‫شدت نوری که گیاه در آن رشد می‌کند بستگی دارد (51، 47). داده‌های به‌دست ‌آمده از مطالعات بیشتر نشان می‌دهد که ALA خارجی باعث افزایش تتراپیرول‌ها و در نتیجه افزایش سرعت فتوسنتز می‌شود. نتایج ما با مطالعاتی که تاثیر استفاده خارجی (اگزوژنوس) از ALA افزایش تبادلات گازی فتوسنتز و در نتیجه افزایش فتوسنتز را نشان می‌دهد مطابقت داشت. لذا این تاثیرات ممکن است به افزایش قابل توجهی در محتوای کلروفیل و متعاقب آن افزایش پتانسیل برداشت نور گیاهان تیمار شده با ALA نسبت داده شود (53، 52). در این مطالعه افزایش همزمان در میزان سنتز ALA در پاسخ به افزایش بیان آنزیم MsGSA در گیاهان تنباکوی فوق بیان MsGSA مشاهده شد. ‌می‌توان تفسیر کرد که افزایش محتوای ALA در گیاهان دارای فوق بیان MsGSA ممکن است مستقیماً منجر به تجمع کلروفیل در بافت فتوسنتزی شود، نتایج به‫دست آمده در این بررسی این نظر را تایید می‌کند.

در یک مطالعه ژن کد کننده ژن آمینولوولینات سنتاز (ALA-S) مخمر (Saccharomyces cerevisiae) تحت عنوان YHem1 تحت کنترل پروموتر ژن  HemA1از آرابیدوپسیس تالیانا (AtHemA1 P) به ژنوم تنباکو (Nicoliana tabacum) وارد شد. همه لاین‌های تراریخته ژن YHem1 را به خصوص در شرایط نوری بیان کردند. ظرفیت سنتز ALA و کلروفیل در گیاهان مزبور افزایش یافت. نتایج این مطالعه نشان می‌دهد که بیان ژن بیوسنتز ALA افزایش یافته است و میزان رشد گیاهان تراریخته هم متناسب با همین میزان افزایش بیان تغییر می‌نماید (54). این نتایج در بررسی ما نیز مشاهده شد به این ترتیب که سه گیاه تراریخته منتخب متناسب با افزایش میزان بیان ژن MsGSA میزان رشد بیش‫تری از خود نشان دادند.

این مطالعه نشان داد که انتقال و فوق بیان ژن MsGSA باعث افزایش میزان بیان ژن GSA، افزایش محتوای ALA (به‫عنوان محصول ژن) در لاین‌های تراریخته تنباکو شده است. داده‌های ما همچنین نشان داد که میزان رشد در لاین‌های تراریخته نسبت به گیاهان نوع وحشی افزایش یافته است. همچنین لاین‌های تراریخته بدون هیچ‌گونه اثری از سفیدشدگی و فتواکسیداسیون (Photobleaching) در شدت بالای نوری در ظهر تابستان (2500 μmol m2 s1) رشد می‌کنند. این در حالی است که در مطالعه‌‌ای در برنج فوق بیان ژن آمینولویولینیک ‌‌سینتاز (Aminolevulinate synthase: ALA-S (مربوط به باکتریBradyrhizobium japonicum  که ژن مسیر بیوسنتز ALA در باکتری‌ها می‌باشد، تحت کنترل پروموتور ژن یوبی‌‌کوئینون انجام شد در نتیجه این انتقال گیاهان تراریخته حاصل دارای میزان بیان بالاتری از ژن آمینولوولینات سینتاز (ALA-S) بودند. این گیاهان در شرایط شدت نور کم ( μmol m–2 s–1150) فنوتیپ عادی نشان می‌دادند ولــی در شرایط نور شدیدتر
 μmolm–2 s–1 500 سفید شدگی برگ‌ها و صدمات فتوداینامیکی گزارش شد (56-54). رشد طبیعی گیاهان تراریخته بدون هیچ‌گونه اثری از سفیدشدگی در اثر فتواکسیداسیون در شدت بالای نوری نشان دهنده این است که میزان بیان ژن GSA به حد سمیت برای تخریب فتوداینامیک (Photodynamic) سلول‌ها در این گیاهان نرسیده است. در بررسی‌های بیوشیمیایی گیاهان تراریخته حاصل مشاهده شد که میزان ‌فنل کل، فلاونوئیدها و آنتوسیانین در گیاهان تراریخته نسبت به گیاه نوع وحشی به‫طور معنی‌داری افزایش پیدا کرده است. در نتیجه بررسی‌های رشدی و محتوی آنتی‌اکسیدانی نیز نشان می‌دهند که فوق بیان ژن GSA در گیاهان تراریخته به نفع مکانیزم آنتی‌اکسیدانتی بوده است و گیاهان تراریخته بخوبی سیستم تنظیم بیان ژن را کنترل نموده‌‌اند و سیستم مقاومت گیاه پتانسیل و کارایی بالاتری پیدا نموده است. این در حالی است که در مطالعه‌ای که Jung و همکاران انجام دادند ژن ALA-S که ژن مسیر بیوسنتز ALA در باکتری Bradyrhizobium japonicum است به گیاه برنج تحت کنترل پروموتور یوبی‌کینون ذرت انتقال داده شد که برگ‌های گیاهان تراریخته حاصل در شدت نورهای بالا تخریب فتوداینامیک نشان داده و سفیدشدگی در برگ‌ها مشاهده شد و رشد گیاه تراریخته فقط در شدت نور پایین امکان‌پذیر بود. انتقال ژن‌ ALA-S به گیاه برنج منجر به افزایش سنتز ALA به‫ترتیب 44 و 85 درصد در دو گروه گیاه تراریخته P5 و P14 در مقایسه با نوع وحشی شد. این میزان افزایش در سطح ALA باعث افزایش 5/2 برابری پورفیرین XI در برنج تراریخته گردید و صدمات فتوداینامیک در گیاه تراریخته برنج نشان دهنده به‫هم خوردن سطح تعادل بیان و کنترل میزان پورفیرینXI در شدت نور بالا شده که موجب تخریب بافت برگ و سفید شدن برگ می‌شود (55). در مطالعه‌‌ی دیگری که ژنی که آنزیم آمینولوولینات سینتاز مخمر(Saccharomyces cerevisiae)  را کد می‌‌کند و تحت عنوان YHem1 نامیده می‌شود تحت کنترل پروموتور ژن HemA1 آرابیدوپسیس تالیانا به گیاه آرابیدوپسیس تالیانا منتقل شد و در نتیجه در گیاه تراریخته حاصل مقاومت به شوری مشاهده گردید و این گیاه در شرایط نوری ظهر که شدت نور در حدودμmol m–2 s–1  1000 بود رشد عادی داشته و هیچ گونه نشانه‌‌ای از سفید‌‌شدگی و صدمات فتوداینامیکی دیده نشد. لذا زنگ و همکاران (57) از این مطالعه نتیجه‌‌گیری کردند که اگر سنتزALA  تحت کنترل پروموتور غیرمستمر (Nonconstitiute) چون پروموتور حساس به نور بیان شود نه تنها صدمات فتوداینامیکی بروز نخواهد کرد بلکه گیاه شرایط رشدی بهتر همراه با افزایش مقاومت در برابر استرس‌‌ها از خود بروز می‌‌دهد . نتایج مشابه‌ی در مطالعه‌‌ی دیگری (54) سازه‌ی ژنی که در مطالعه‌ی قبلی ساخته شده بود (YHem1) تحت کنترل همان پروموتور (HemA1) به تنباکو انتقال یافت. مشاهده شد که همه لاین‌های تراریخته تنباکو ژن YHem1 را بیان نمودند و این گیاهان در شرایطی که نور شدید بود و در نور آفتاب در ظهر (μmol m-2 s-1 2000) بدون هیچ‫گونه اثری از فتوبلیچینگ و سفیدشدگی رشد کردند. این در حالی است که در مطالعه ما از پروموتور CaMV35S به‫عنوان یک پروموتور مستمر  (Constitute) استفاده شد ولی برخلاف نتیجه‌گیری زنگ و همکاران اثری از فتوبلیچینگ در شدت نور بالا مشاهده نشد که این امر نشان دهنده این است که در گیاهان تراریخته این مطالعه به‫خوبی تنظیمات ژن بنحوی انجام پذیرفته که مانع بروز صدمات فتوداینامیکی شده است و عدم بروز نشانه فتوبیلیچینگ ربطی به مستمر یا غیرمستمر بودن پروموتور بیانی ژن ندارد. با استفاده از ALA برون‌زا (Exogenous) افزایش میزان فتوسنتز و نیز رشد مشاهده می‌شود که نتایج حاصل با نتایج بررسی اخیر مشابه است. در این مطالعه با افزایش میزان بیان ALA در گیاهان تراریخته افزایش میزان رشد به‫صورت معنی‌داری قابل مشاهده است (9-7).

همان‫طور که قبلا بیان شد در بررسی‌های بیوشیمیایی گیاهان تراریخته حاصل مشاهده شد که میزان ‌فنل کل، فلاونوئیدها و آنتوسیانین در گیاهان تراریخته نسبت به گیاه نوع وحشی به‫طور معنی‌داری افزایش پیدا کرده است که این نتایج با مشاهدات دیگر با به‫کار بردن ALA برون‌زا و افزایش محتوی این مواد مطابقت دارد (58). پیشنهاد شده استفاده از ALA برون‌زا افزایش محصولات متابولیسم فنیل‌پروپانوئید در گیاهان را تحریک می‌کند. برای مثال مشاهده شد افزایش آنتوسیانین‌ها در محصولات کشاورزی با استفاده از ALA برون‌زا افزایش می‌یابد (58-60 ،8) در مطالعه‌ای در گیاه جینکگو بیلوبا (Ginkgo biloba) استفاده از ALA برون‌زا باعث افزایش قابل توجه‌ی در محتوای پلی‌فنول‌ها، فلاونوئیدها و آنتوسیانین‌ها و در نتیجه کیفیت برگ‌های گیاه مربوطه جهت برداشت شد (58). همچنین مشاهده شده است که تیمار با ALA به‫طور معنی‌داری فعالیت‌ آنزیم‌های (Phenylalanine ammonia-lyase) PAL، CHS  (Chalcone synthase)و CHI  (Chalcone isomerase)را متناسب با غلظت ALA در برگ‌های جینکو القا کرده است. پیشنهاد شده است که ALA باعث ساختن فیتوکروم می‌شود و مسیر ساخت فیتوکروم را تنظیم می‌کند و گمان می‌شود که فعالیت فیتوکروم بیان ژن فلاونوئید را در بسیاری از سیستم‌های گیاهی تنظیم می‌کند (62، 61). رابطه مستقیمی بین محتوای پلی‌فنل کل، فلاونوئید و آنتوسیانین و فعالیت آنزیم‌های PAL، CHS و CHI در بسیاری از گیاهان نشان داده شده است (64، 63). همچنین مطالعات بیولوژیکی مولکولی متعددی نشان داده است که میزان رونوشت چندین ژن کد کننده آنزیم‌های دخیل در بیوسنتز فلاونوئید و آنتوسیانین، مانند PAL، CHS و CHI، با تجمع فلاونوئیدها و آنتوسیانین‌ها رابطه مستقیم دارد (66، 65). در مطالعه‌ای مشاهده شد که PAL و CHS آنزیم‌های تنظیم‌کننده کلیدی در بیوسنتز فلاونوئید در برگ‌های گیاه جینکگو بیلوبا است [67] و نیز ALA می‌تواند رونویسی ژن کالکون ایزومراز (GbCHI) که یک ژن کلیدی تنظیم‌کننده تجمع فلاونوئیدها در برگ‌های جینکو است را القا کند (68). لذا پژوهش‫گران افزایش در محتوای پلی‌فنل کل، فلاونوئید و آنتوسیانین را به‫دلیل افزایش فعالیت‌ آنزیم‌های PAL، CHS و CHI که در نتیجه تیمار با ALA افزایش پیدا کرده نسبت داده‌اند. از سوی دیگر افزایش این مواد ممکن است با افزایش کربوهیدرات‌ها به‫عنوان پیش‌سازهای مسیرهای فنیل‌پروپانوئید و فلاونوئید نیز همراه باشد. استفاده از ALA می‌تواند محتویات قند محلول، پلی‌فنل‌ها، آنتوسیانین‌ها و فلاونوئیدها را که از هگزوزها از طریق مسیرهای شیکمات و فنیل پروپانوئید سنتز می‌شوند را به‫طور قابل توجه‌ی افزایش دهد (69). مطالعات نشان می‌دهد که اثرات تحریکی ALA بر محتوای پلی‌فنل کل، فلاونوئید و آنتوسیانین و فعالیت‌های PAL، CHS و CHI به زمان و غلظت کاربرد ALA بستگی دارد (58).

6- نتیجه گیری

نتایج حاصل از این بررسی نشان داد که افزایش میزان رشد، افزایش محتوای کلروفیلی، افزایش محتوای ALA و نیز محتوای متابولیت‌های ثانویه‌ای چون فنل کل، فلاونوئیدها و آنتوسیانین در گیاهان تراریخته متناسب با میزان افزایش بیان ژن GSA است که این بیانگر افزایش توان رشدی و افزایش پتانسیل مقاومت در گیاهان تراریخته تحت تاثیر ژن انتقالی GSA و افزایش محتوایALA  نسبت به گیاهان تنباکوی تیپ وحشی است.

7-تشکر و قدردانی:

از شرکت بیوتکنولوژی رنا (RNA) برای فراهم کردن فضا و امکانات و همچنین از کمک‌های خانم مطهره نصری کمال تشکر را داریم.

-

  1. Jiang M, Hong K, Mao Y, Ma H, Chen T, Wang Z. Natural 5-aminolevulinic acid : sources, biosynthesis, detection and applications. 2022;10(February):1–17.
  2. Chen M. Chlorophyll modifications and their spectral extension in oxygenic photosynthesis. Annu Rev Biochem. 2014;(February):1–24.
  3. Tanaka R, Kobayashi K, Masuda T. Tetrapyrrole metabolism in Arabidopsis Thaliana. ASPB. 2011;1–40.
  4. Kirchhoff H. Molecular crowding and order in photosynthetic membranes. Trends Plant Sci. 2008;13(April):201–7.
  5. Mochizuki N, Tanaka R, Grimm B, Masuda T, Moulin M, Smith AG, et al. The cell biology of tetrapyrroles: a life and death struggle. Trends Plant Sci. 2010 Sep;15(9):488–98.
  6. Rockwell NC, Su Y, Lagarias JC. Phytochrome structure and signaling mechanisms. Annu Rev Plant Biol. 2006;57:834–58.
  7. Feng X, An Y, Zheng J, Sun M, Wang L. Proteomics and SSH Analyses of ALA-promoted fruit coloration and evidence for the involvement of a MADS-Box gene, MdMADS1. Front Plant Sci. 2016 Nov 7;7(November 2016).
  8. Xie L, Wang ZH, Cheng XH, Gao JJ, Zhang ZP, Wang LJ. 5-Aminolevulinic acid promotes anthocyanin accumulation in Fuji apples. Plant Growth Regul. 2013 Apr 25;69(3):295–303.
  9. Ye J, Yang X, Chen Q, Xu F, Wang G. Promotive effects of 5-aminolevulinic acid on fruit quality and coloration of Prunus persica (L.) Batsch. Sci Hortic. 2017 Mar;217:266–75.
  10. Wei ZY, Zhang ZP, Lee MR, Sun YP, Wang LJ. Effect of 5-aminolevulinic acid on leaf senescence and nitrogen metabolism of pakchoi under different nitrate levels. J Plant Nutr. 2012 Jan;35(1):49–63.
  11. Maruyama-Nakashita A, Hirai MY, Funada S, Fueki S. Exogenous application of 5-aminolevulinic acid increases the transcript levels of sulfur transport and assimilatory genes, sulfate uptake, and cysteine and glutathione contents in Arabidopsis thaliana. Soil Sci Plant Nutr. 2010 Apr;56(2):281–8.
  12. Nishihara E, Kondo K, Parvez MM, Takahashi K, Watanabe K, Tanaka K. Role of 5-aminolevulinic acid (ALA) on active oxygen-scavenging system in NaCl-treated spinach (Spinacia oleracea). J Plant Physiol. 2003 Jan;160(9):1085–91.
  13. Elansary HO, El-Ansary DO, Al-Mana FA. 5-Aminolevulinic acid and soil fertility enhance the resistance of rosemary to Alternaria dauci and Rhizoctonia solani and Modulate Plant Biochemistry. Plants. 2019 Dec; 9;8(12):585.
  14. Xu L, Islam F, Zhang W, Ghani MA, Ali B. 5-Aminolevulinic acid alleviates herbicide-induced physiological and ultrastructural changes in Brassica napus. J Integr Agric. 2018 Mar;17(3):579–92.
  15. Sun YP, Zhang ZP, Wang LJ. Promotion of 5-aminolevulinic acid treatment on leaf photosynthesis is related with increase of antioxidant enzyme activity in watermelon seedlings grown under shade condition. Photosynthetica. 2009 Sep;1;47(3):347–54.
  16. Zhang J, Li DM, Gao Y, Yu B, Xia CX, Bai JG. Pretreatment with 5-aminolevulinic acid mitigates heat stress of cucumber leaves. Biol Plant. 2012 Dec;1;56(4):780–4.
  17. Wang Y, Li J, Gu W, Zhang Q, Tian L, Guo S, et al. Exogenous application of 5-aminolevulinic acid improves low-temperature stress tolerance of maize seedlings. Crop Pasture Sci. 2018;69(6):587.
  18. Balestrasse KB, Tomaro ML, Batlle A, Noriega GO. The role of 5-aminolevulinic acid in the response to cold stress in soybean plants. Phytochemistry. 2010 Dec;71(17–18):2038–45.
  19. Kosar F, Akram NA, Ashraf M. Exogenously-applied 5-aminolevulinic acid modulates some key physiological characteristics and antioxidative defense system in spring wheat (Triticum aestivum L.) seedlings under water stress. South African J Bot. 2015;96:71–7.
  20. Xiong JL, Wang HC, Tan XY, Zhang CL, Naeem MS. 5-aminolevulinic acid improves salt tolerance mediated by regulation of tetrapyrrole and proline metabolism in Brassica napus L. seedlings under NaCl stress. Plant Physiol Biochem. 2018;124(January):88–99.
  21. Ali B, Huang CR, Qi ZY, Ali S, Daud MK, Geng XX, et al. 5-Aminolevulinic acid ameliorates cadmium-induced morphological, biochemical, and ultrastructural changes in seedlings of oilseed rape. Environ Sci Pollut Res. 2013;20(10):7256–67.
  22. An Y, Qi L, Wang L. ALA pretreatment improves waterlogging tolerance of fig plants. PLoS One. 2016;11(1):1–15.
  23. Aksakal O, Algur OF, Icoglu Aksakal F, Aysin F. Exogenous 5-aminolevulinic acid alleviates the detrimental effects of UV-B stress on lettuce (Lactuca sativa L) seedlings. Acta Physiol Plant. 2017 Feb 19;39(2):55.
  24. Kanto U, Jutamanee K, Osotsapar Y, Chai-arree W, Jattupornpong S. Promotive effect of priming with 5-aminolevulinic acid on seed germination capacity, seedling growth and antioxidant enzyme activity in rice subjected to accelerated ageing treatment. Plant Prod Sci. 2015 Jan 3;18(4):443–54.
  25. Bindu RC, Vivekanandan M. Hormonal activities of 5-aminolevulinic acid in callus induction and micropropagation. Plant Growth Regul. 1998;26:15–8.
  26. Czarnecki O, Gläßer C, Chen JG, Mayer KFX, Grimm B. Evidence for a contribution of ALA synthesis to plastid-to-nucleus signaling. Front Plant Sci. 2012;3(OCT).
  27. Rebeiz AC, Juvik JA, Rebeiz CC. Porphyric insecticides 1. Concept and phenomenology. Pestic Biochem Physiol. 1988;30:11–27.
  28. Xu L, Zhang W, Ali B, Islam F, Zhu J, Zhou W. Synergism of herbicide toxicity by 5-aminolevulinic acid is related to physiological and ultra-structural disorders in crickweed (Malachium aquaticum L.). Pestic Biochem Physiol. 2015 Nov;125:53–61.
  29. Hunik. Process for the production of vitamin B12. 2002.
  30. Kang Z, Zhang J, Zhou J, Qi Q, Du G, Chen J. Recent advances in microbial production of δ-aminolevulinic acid and vitamin B12. Biotechnol Adv. 2012 Nov;30(6):1533–42.
  31. Ghasemzadeh M, Amiri H, Khozeai M, Ismaili A. Development and evaluation of bioinformatics methods a successful way to design plants for genetic modification. Mod concepts Dev Agron. 2022;10(3):1019–25.
  32. Choi HP, Lee YM, Yun CW, Sung HC. Extracellular 5-aminolevulinic acid production by Escherichia coli containing the Rhodopseudomonas palustris KUGB306 hemA gene. J Microbiol Biotechnol. 2008;18(6):1136–40.
  33. Murashige T, Skoog F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant. 1962;15:473–97.
  34. Green MR, Sambrook J. Molecular cloning: A laboratory manual. Fourth. Vol. Vol 1, Cold Spring Harbor Laboratory Press, USA. New York: Cold Spring Harbor; 2012.
  35. Horsch RB, Fry JE, Hoffmann NL, Eichholtz D, Rogers SG, Fraley RT. A Simple and general method for transferring genes into plants. Science. 1985 Mar 8;227(4691):1229–31.
  36. Lawaju BR, Lawrence KS, Lawrence GW, Klink VP. Harpin-inducible defense signaling components impair infection by the ascomycete Macrophomina phaseolina. Plant Physiol Biochem. 2018;129(June):331–48.
  37. Ruijter JM, Ramakers C, Hoogaars WMH, Karlen Y, Bakker O, Hoff MJB Van Den, et al. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009;37(6).
  38. Arnon AN. Method of extraction of chlorophyll in the plants. Agron J. 1967;23(23):112–21.
  39. Khozaei M. Increased plastid treansketolase activity intransgenic tobacco plants alters carbon metabolism and has nagative impacts on growth and yield. University of Essex; 2010.
  40. Mauzerall D, Cranick S. The occurrence and determination of δ-minolevulinic acid and porphobilinogen in urine. J Biol Chem. 1956;219:435–46.
  41. Chang C, Yang M, Wen H, Chern J. Estimation of total flavonoid content in propolis by two complementary colorimetric methods. Molecular Breeding. 2002;10(3):178–82.
  42. Wagner GJ. Content and vacuole/extravacuole distribution of neutral sugars , free amino acids , and anthocyanin in protoplasts. Plant Physiol. 1979;88–93.
  43. Singleton VL, Orthofer R, Lamuela-Raventos RM. Analysis of total phenols and other oxidation substrates and antioxidants by means of Folin-Ciocalteu Reagent. Methods Enzymol. 1999;299 (1974):152–78.
  44. Hofgen R, Axelsen KB, Kannangara CG, Schuttke I, Pohlenz HD, Willmitzer L, et al. A visible marker for antisense mRNA expression in plants: inhibition of chlorophyll synthesis with a glutamate-1-semialdehyde aminotransferase antisense gene. Proc Natl Acad Sci. 1994 Mar 1;91(5):1726–30.
  45. Ferradini N, Nicolia A, Capomaccio S, Veronesi F, Rosellini D. A point mutation in the Medicago sativa GSA gene provides a novel, efficient, selectable marker for plant genetic engineering. J Biotechnol. 2011;156(2):147–52.
  46. Biswal AK, Pattanayak GK, Pandey SS, Leelavathi S, Reddy VS, Tripathy G, et al. Light intensity-dependent modulation of chlorophyll b biosynthesis and photosynthesis by overexpression of chlorophyllide a oxygenase in tobacco. Plant Physiol. 2012;159(May):433–49.
  47. Tanaka R, Koshino Y, Sawa S, Ishiguro S, Okada K, Tanaka A. Overexpression of chlorophyllide a oxygenase (CAO) enlarges the antenna size of photosystem II in Arabidopsis thaliana. Plant J. 2001;26(4):365–73.
  48. Ilag LL, Kumar AM, Söll D. Light regulation of chlorophyll biosynthesis at the level of 5-aminolevulinate formation in Arabidopsis. Plant Cell. 1994;6(2):265–75.
  49. von Wettstein D, Gough S, Kannangara CG. Chlorophyll biosynthesis. Plant Cell. 1995;7(July):1039–57.
  50. Wang L, Jiang W, Zhang Z, Yao Q, Matsui H, Ohara H. Biosynthesis and physiological activities of 5-aminolevulinic acid (ALA) and its potential application in agriculture. Plant Physiol Comm. 2003;39:185–192.
  51. Pattanayak GK, Tripathy BC. Overexpression of protochlorophyllide oxidoreductase c regulates oxidative stress in Arabidopsis. Schnur JM, editor. PLoS One. 2011 Oct 21;6(10):e26532.
  52. Memon SA, Hou X, Wang L, Li Y. Promotive effect of 5-aminolevulinic acid on chlorophyll, antioxidative enzymes and photosynthesis of Pakchoi (Brassica campestris ssp. chinensis var. communis Tsen et Lee). Acta Physiol Plant. 2009 Jan 29;31(1):51–7.
  53. Youssef T, Awad MA. Mechanisms of enhancing photosynthetic gas exchange in date palm seedlings (Phoenix dactylifera L.) under salinity stress by a 5-aminolevulinic acid-based fertilizer. J Plant Growth Regul. 2008 Mar 9;27:1–9.
  54. Zhang Z-P, Yao Q-H, Wang L-J. Expression of yeast Hem1 controlled by Arabidopsis HemA1 promoter enhances leaf photosynthesis in transgenic tobacco. Mol Biol Rep. 2011 Oct 26;38(7):4369–79.
  55. Jung S, Yang K, Lee DE, Back K. Expression of Bradyrhizobium japonicum 5-aminolevulinic acid synthase induces severe photodynamic damage in transgenic rice. Plant Sci. 2004;167:789–95.
  56. Jung S, Back K, Yang K, Kuk YI, Chon SU. Defence response produced during photodynamic damage in transgenic rice overexpressing 5-aminolevulinic acid synthase. Photosynthetica. 2008;46(1):3–9.
  57. Zhang ZP, Yao QH, Wang LJ. Expression of yeast Hem1 gene controlled by Arabidopsis HemA1 promoter improves salt tolerance in Arabidopsis plants. BMB Rep. 2010;43(5):330–6.
  58. Xu F, Cheng S, Zhu J, Zhang W, Wang Y. Effects of 5-aminolevulinic acid on chlorophyll, photosynthesis, soluble sugar and flavonoids of Ginkgo biloba. Not Bot Horti Agrobot Cluj-Napoca. 2011;39(1):41–7.
  59. Wang J, Zhang J, Li J, Dawuda MM, Ali B, Martino C Di. Exogenous application of 5-aminolevulinic acid promotes coloration and improves the quality of tomato fruit by regulating carotenoid metabolism. Frontiers in Plant Science. 2021;12(June):1–16.
  60. Zhang Z, Liu L, Chang X, He W, Liu J, Zhao B, et al. Effects of 5-aminolevulinic acid on anthocyanin synthesis in Vitis Vinifera ‘Crimson Seedless’ grapes at the transcriptomics level. J Hortic Sci Biotechnol. 2021;96(6):797–807.
  61. Awad MA, Wagenmakers PS, Jager A De. Effects of light on favonoid and chlorogenic acid levels in the skin of “Jonagold” apples. Sci Hortic. 2001;88:289–98.
  62. Tobin EM, Silverthorne J. Light regulation of gene expression in higher plants. Plant Physiol. 1985;36:569–93.
  63. Obinatai N, Yamakawa T, Takamiya M, Tanaka N, Ishimaru K, Kodamai T. Effects of salicylic acid on the production of procyanidin and anthocyanin in cultured grape cell. Plant Blotechnology. 2003;20(2):105 11 1.
  64. Mato M, Onozaki T, Ozeki Y, Higeta D, Itoh Y, Yoshimoto Y, et al. Flavonoid biosynthesis in white-fowered Sim carnations (Dianthus caryophyllus). Sci Hortic. 2000;84(3–4):333–47.
  65. Fischer TC, Gosch C, Pfeiffer J, Halbwirth H, Halle C, Stich K, et al. Flavonoid genes of pear (Pyrus communis). Trees. 2007;21:521–9.
  66. Jaakola L, Ma K, Pirttila AM, To R, Hohtola A. Expression of genes involved in anthocyanin biosynthesis in relation to anthocyanin, proanthocyanidin, and flavonol levels during bilberry fruit development. Plant Physiol. 2002;130:729–39.
  67. Xu F, Cai R, Cheng S, Du H, Wang Y, Cheng S. Molecular cloning, characterization and expression of Phenylalanine Ammonia-Lyase gene from Ginkgo biloba. 2008;7(6):721–9.
  68. Cheng H, Li L, Cheng S, Cao F, Wang Y, Yuan H. Molecular cloning and function assay of a chalcone isomerase gene (GbCHI) from Ginkgo biloba. Plant Cell Rep. 2011;30:49–62.
  69. Pirie A, Mullins MG. Changes in anthocyanin and phenolics content of grapevine leaf and fruit tissues treated with sucrose, nitrate, and abscisic Acid. Plant Physiol. 1976;58:468–72.