فصلنامه

نوع مقاله : علمی - پژوهشی

نویسنده

استادیار، گروه علوم پایه، دانشگاه فرهنگیان، تهران، ایران

10.52547/JCT/13.4.285

چکیده

هدف: در آویشن، تیمول و کارواکرول به‫دلیل برخورداری از خواص درمانی متنوعی نظیر ضد تومور مورد توجه فارماکولوژیست­ها قرار گرفته­اند. تاکنون، طیف متنوعی از تیمارها مثل الیسیتورها برای افزایش محتوی تیمول و کارواکرول پیشنهاد شده­اند. این پژوهش نیز با هدف ارزیابی اثر هم­افزائی اشعه UV-A و متیل‌جاسمونات بر بیوسنتز تیمول و کارواکرول صورت گرفت.
مواد و روش­ها: بذور آویشن در آزمایش فاکتوریل در زمان با طرح کاملا تصادفی با سه تکرار تحت شرایط گلخانه­ای در گلدان­های پلاستیکی کاشته شدند. گیاهچه­های پنج­برگی به‫طور جداگانه و همزمان با UV-A پرتودهی و با متیل‌جاسمونات 1/0 میلی‌مولار محلول­پاشی شدند. بعد از گذشت 24 و 48 ساعت از اعمال تیمارها، سطح بیان ژن­های GTS، DXR، CYP180 و CYP178 با Real-Time PCR و سطح متابولیت­ها باHPLC  اندازه­گیری شد.
نتایج: بیان ژن­های GTS، DXR، CYP180 و CYP178 تحت تاثیر هم­افزائی متیل‌جاسمونات و UV-A قرار گرفت. سطح رونوشت این ژن­ها بعد از گذشت 24 ساعت از اعمال جداگانه تیمارها به‫طور معنی­داری افزایش یافت و این افزایش در تیمار ترکیبی هورمون و اشعه بیشتر بود. با این‫حال، بیان این ژن­ها بعد از گذشت 48 ساعت از اعمال تیمارها با کاهش معنی­داری همراه بود. روند افزایشی و کاهشی محتوی تیمول و کارواکرول در تیمار الیسیتورها نیز مطابق با بیان ژن­های مورد مطالعه بود.
نتیجه­گیری: مشاهدات ما پیشنهاد می­کند که آویشن در 24 ساعت اول تیمار هورمون و اشعه، از هم­افزائی پیام­رسانی به‫منظور افزایش سطح متابولیت­های خود استفاده می­کند و بعد از آن، سازوکارهای دفاعی دیگر فعال می­شوند و سطح متابولیت­های ثانویه کاهش می­یابد.

تازه های تحقیق

-

کلیدواژه‌ها

dor -

عنوان مقاله [English]

Synergistic effect of UV-A and Methyl Jasmonate on the Biosynthesis of Thymol and Carvacrol Metabolites in Thymus

نویسنده [English]

  • M Abyari

Department of Science, Farhanghiyan University, Tehran, Iran. m.abyari@cfu.ir

چکیده [English]

Aim: In thyme, thymol and carvacrol have attracted the attention of pharmacologists due to their various therapeutic properties such as anti-tumor activity. To date, a variety of treatments such as elicitors have been proposed to increase the content of thymol and carvacrol. This study was also conducted with the aim of evaluating the synergistic effect of UV-A ray and methyl jasmonate on the biosynthesis of thymol and carvacrol.
Material and Methods: Thyme seeds were planted in plastic pots at a factorial experiment in time with a completely randomized design with three replications under greenhouse conditions. The five-leaf seedlings were separately and simultaneously irradiated with UV-A and sprayed with 0.1 mM methyl jasmonate. After 24 and 48 h of treatment, the expression levels of GTS, DXR, CYP180, and CYP178 genes were measured by Real-Time PCR and the metabolite levels were measured by HPLC.
Results: The expression of GTS, DXR, CYP180, and CYP178 genes was affected by the synergistic impact of methyl jasmonate and UV-A. The transcript level of these genes increased significantly after 24 h of individual treatments and this increase was more in the combined treatment of hormone and radiation. However, the expression of these genes was linked with a significant decrease after 48 h of treatment. The increasing and decreasing trend of thymol and carvacrol content in the elicitor treatments was also in accordance with the expression of studied genes.
Conclusion: Our observations suggest that thyme uses synergistic signaling to increase its metabolite levels during the first 24 h of hormone and radiation treatments. And after that, other defense mechanisms are activated and then the level of secondary metabolites decreases.

کلیدواژه‌ها [English]

  • Thymus
  • Jasmonate
  • Ultraviolet light
  • Secondary metabolites
  • مقدمه

    آویشن (Thymus vulgaris) به‫عنوان یکی از گونه­های مهم تیره نعناعیان، در نواحی مختلف آسیا و مدیترانه می‌روید و در مناطق مختلف جهان منجمله ایران کشت­وکار می‌شود. این گیاه دارویی حاوی 8/0 تا 6/2 درصد اسانس می­باشد که بخش بیشتر آن ‌را الکل‌ها، هیدروکربن‌ها و فنل‌ها تشکیل می‌دهند (1). اسانس آویشن در صنایع بهداشتی، آرایشی و دارویی و برگ‫های آن در فرآورده‌های غذایی مورد استفاده قرار می­گیرد. روغن این گیاه دارای خواصی نظیر تاخیردهنده پیری، نگه‫دارنده طبیعی غذا، آنتی‌اکسیدانت، خلط‌آور، ضدرماتیسم، ضدکرم، ضدعفونی­کننده، ضدباکتریایی، ضدقارچی، بادشکن و ضداسپاسم است (2). براساس پژوهش­های درون­پیکری و درون­شیشه­ای، این ویژگی­های درمانی به‫حضور برخی از ترکیبات فعال نظیر تیمول و کارواکرول نسبت داده می­شوند (1). با توجه به این موضوع، تحقیقات روز افزونی به‫سوی درک جنبه­های مولکولی تنظیم و بیوسنتز ایندول آلکالوئیدهای تیمول و کارواکرول متمایل شده­اند به‫طوری‫که طیف متنوعی از موضوعات، از شناسایی مسیر بیوسنتز و عوامل تنظیمی آن تا تعیین مکانیزم­های اثرگذاری درمانی، را در بر می­گیرند (2).

سنتز تیمول و کارواکرول نیازمند هفت واکنش آنزیمی مرتبط با هم است (شکل1). نخست، پیش­ماده ترپنوئیدها یعنی       دی‫ اکسی زایلوز 5-­فسفات (DXP) از طریق ترکیب پیروات و دی­گلسیر آلدهید 3-­فسفات با یکدیگر و پس از پشت­سرگذاری واکنش­های بیوشیمایی لازم تولید می­شود. ترکیب حد واسط بعدی یعنی 2 سی متیل اریتریتول 4-فسفات (MEP) توسط آنزیم 1 دی­اکسی زایلوز 5-فسفات ردکتوایزومراز (DXR) از سوبسترای DXP به‫وجود می­آید. در ادامه، ژرانیل 2-فسفات (GP) بعد از پشت­سرگذاری واکنش­های بیوشیمایی از MEP حاصل می­شود. گاماترپینن نیز توسط گاماترپینن سنتاز (GST) از ترکیب GP تولید می­شود. اکنون، تیمول و کارواکرول به‫کمک سیتوکروم­های P450 (CYP180 و CYP178) از پیش­ماده گاماترپینن ایجاد می­شوند (3).

 

 

شکل1: مسیر بیوسنتز تیمول و کارواکرول (3).

 

کاربرد الیسیتورها یکی از رویکردهای مهم بیوتکنولوژیست­ها جهت القای تولید متابولیت­های ثانویه و افزایش بازدهی این ترکیبات فعال و با ارزش تجاری می­باشد. الیسیتورها بر حسب ماهیت به دو دسته زیستی (اسیدهای چرب نام، گلیکوپروتئین‫ها، الیگوساکاریدها، ترکیبات پلی ساکاریدی دیواره سلولی و عصاره مخمر) و غیرزیستی (ترکیبات شیمیایی، پرتوهای فرابنفش و فلزات سنگین) تقسیم می­شوند (4). الیسیتورها از طریق فعال­سازی سازوکارهای دفاعی منجر به القای تولید ترکیبات فعال­زیستی و اعمال پاسخ­های دفاعی سلول­های گیاهی مثل سنتز فیتوالکسین­ها، تغییرات ساختاری در دیواره سلولی، بیان ژن­های دفاعی، تولید گونه­های فعال اکسیژن، افزایش جریانات یونی از غشای پلاسمایی و سنتز اسیدسالیسیک و اسید جاسمونیک به‏عنوان پیک­های ثانویه می‏‏شوند (5). الیسیتورها همچنین باعث افزایش طول و وزن ساقه و ریشه و متعاقبا رشد گیاه می­شوند (5). درنتیجه، تشخیص مولکولی الیسیتورها و برهمکنش آن‫ها با گیرنده‎های گیاه تا مکانیزم تاثیرگذاری آن‫ها بر مسیرهای بیوسنتزی و تجزیه­ای متابولیت­های ثانویه ازجمله زمینه­های تحقیقاتی جذاب در حوزه الیسیتورها و کشت ‫بافت گیاهی است (6).

اسیدجاسمونیک و مشتقات آن از جمله متیل­جاسمونات، به‫عنوان الیسیتور و تنظیم­کننده رشد گیاهی شناخته می­شوند که در نقش پیام‌رسان طی پاسخ به تنش‌های زیستی و غیرزیستی ایفای نقش می‌کنند (7). تاثیر اسید جاسمونیک بر فرایندهای فیزیولوژیکی گیاهان وابسته به‫نوع مشتقات جاسمونات و غلظت ‌به‌کاررفته، گونه گیاهی و مرحله نموی می­باشد (8). تاکنون، مطالعات محدودی در حیطه محلول‌پاشی اسیدجاسمونیک و ردیابی اثرات آن بر ویژگی­های کیفی و کمی گیاهان دارویی صورت گرفته است (9). در یک مطالعه، Yang و همکاران (10) نشان دادند که کاربرد متیل­جاسمونات سبب افزایش تانشینون در گیاه داروییSalvia miltiorrhiza می‌شود. Chen و همکاران (11) نیز نشان دادند که اشعه UV-A به طور قابل ملاحظه­ای تجمع متابولیت­های ثانویه را افزایش می­دهد به‫طوری‫که محتوای آنتوسیانین و اسکوربیک اسید به‫ترتیب تا 40 و 80 درصد افزایش یافت (11). نویسندگان افزایش تولید این ترکیبات را به تحریک مسیرهای پیام­رسانی وابسته به رادیکال­های آزاد نسبت دادند. Mumivand  و همکاران (12) نیز مشاهده کردند که تیمار UV-A سبب افزایش محتوی لینالول در گیاه آویشن می­شود به‫طوری که مقدار این متابولیت تا 50 درصد افزایش یافت. علاوه بر ترکیبات شیمیایی نظیر اسید جاسمونیک، پژوهش­های سال­های گذشته گویای نقش اشعه UV-A در تنظیم ترکیب و نوع متابولیت­های متابولوم گیاهان است به‫طوری‫که محققان متوجه شده­اند که از 300 گونه گیاهی مورد مطالعه، حدود 50 درصد حساس، حدود 30 درصد حساسیت متوسط و مابقی غیرحساس به تابش UV-A هستند (13). در آزمایشی دیگر، Victório و همکاران (14) نشان دادند که کاربرد UV-A سبب افزایش ژرانین و الاژیک اسید در گیاه دارویی Phyllanthus tenellus می‌شود. Kim و همکاران (15) نیز نشان دادند استفاده از تیمار UV-A منجر به افزایش سطح متابولیت ثانویه رزماریک اسید در گیاه دارویی ریحان می­شود. نویسندگان پیشنهاد کردند که تابش UV-A با فعال‫سازی گیرنده غشائی اختصاصی و سپس به راه­انداختن آبشار پیام­رسانی وابسته به رادیکال­های آزاد منجر به افزایش سطح رزماریک اسید تا 2 برابر می­شوند. اگرچه اثرات اسید جاسمونیک و اشعه فرابنفش به‫طور مجزا بر تجمع ترکیبات فعال زیستی در گیاهان داروئی مورد ارزیابی قرار گرفته است (10،13 و 14)، با این‫حال پاسخ هم­ افزائی گیاهان به حضور هر دو این الیسیتورها هنوز مورد مطالعه قرار نگرفته ­است. 

بنابر آنچه گفته شد، اهمیت متابولیت­های تیمول و کارواکرول در گیاهان دارویی نظیر آویشن و نقش ژن‌های کلیدی DXR، GTS، CYP178 و CYP180 در تولید این دو ترکیب باارزش از یک سو، و پتانسیل متیل­جاسمونات و UV-A در القای تولید متابولیت­های ثانویه از سوی دیگر، ما را به این مطالعه رهنمود کرد که اثر هم­افزائی اشعه فرابنفش UV-A و متیل‌جاسمونات بر بیسونتز تیمول و کارواکرول را مورد ارزیابی قرار دهیم.

2-مواد و روش­ها

مواد گیاهی و تیمار آزمایشی: بذرهای آویشن تهیه­شده از مرکز ملی ذخایر ژنتیکی ایران تحت شرایط گلخانه­ای با رطوبت نسبی 60 درصد، فتوپریود 16 ساعت روشنایی و 8 ساعت تاریکی، دمای 25 درجه­سانتی­گراد روز، دمای 20 درجه­سانتی­گراد روز در گلدان­های پلاستیکی حاوی خاک­برگ، خاک، ماسه با نسبت 1:2:3 در قالب آزمایش فاکتوریل دوعاملی در زمان با سه تکرار کاشته شدند. در مرحله پنج­برگی، متیل‌جاسمونات با غلظت 1/0 میلی‌مولار بر روی برگ­های‌ آویشن محلول­پاشی شد (10). همزمان با تیمار متیل‌جاسمونات، اشعه فرابنفش از طریق در معرض قراردادن گیاهیچه­ها با لامپ­های UV-A (365 نانومتر) به‫مدت 20 دقیقه اعمال شد (14). جهت اطمینان از صحت تیمار اشعه، لامپ­های UV-A (365 نانومتر) 40 واتی در جعبه­های شیشه­ای در فاصله 30 سانتی­متری از گیاهچه­ها قرار گرفتند تا تعادل مابین پوشش گیاه‫چه و آسیب پرتوی رعایت شود. ضمنا، از برگ­های بالایی گیاه‫چه­ها برای نمونه­برداری استفاده شد تا از تیمار برگ با اشعه UV-A اطمینان حاصل شود. نمونه‌گیری در 24 و 48 ساعت بعد از اعمال تیمار انجام گرفت. گیاهان شاهد با تابش نور معمولی تحت تیمار و با آب مقطر استریل تحت محلول­پاشی قرار گفتند. نمونه‌های گیاهی از برگ جوان کاملا توسعه­یافته در دمای80– درجه سانتی‏گراد در فریزر نگه‏داری شدند تا متعاقبا اندازه­گیری­های بیان ژن بر روی آن‫ها انجام شود.

استخراج DNA و سنتز cDNA:  با استفاده از روش ترایزول، محتوی  RNAاز نمونه­های برگی آویشن استخراج شد (16). جهت نیل به این هدف، 1 میلی‌لیتر ترایزول به ازای 1/0 گرم بافت برگی استفاده شد. به منظور دسترسی به‏ RNA خالص و عاری از DNA، نمونه‏های RNA با آنزیم DNase1 تیمار شدند تا مولکول­های تجزیه DNA شوند. غلظت RNA به دست­آمده توسط دستگاه نانودراپ در طول موج‏های 280 و 260 نانومتر و کیفیت آن نیز به‫کمک ژل آگارز 2/1 درصد تعیین شد. از کیت سنتز cDNA (سیناژن) مطابق دستورالعمل شرکت در راستای سنتز DNA مکمل (cDNA) استفاده شد.

طراحی آغازگرها و Real-Time PCR: از اطلاعات ژنی NCBI و نرم‌افزار Primer3 برای طراحی آغازگرهای مربوط به ژن­های DXR، GTS، CYP178 و CYP180 استفاده شد (جدول 1). سه نمونه RNA از هر تکرار بیولوژیکی باهم ادغام شدند تا خزانه RT-PCR را تشکیل دهند. برای هر خزانه نیز سه تکرار تکنیکی لحاظ شد و از میانگین آن‫ها برای برآورد فراوانی نسبی رونوشت­ها استفاده شد. واکنش RT-PCR شامل 3 میکرولیتر SYBR Green (5X)، 2 میکرولیتر cDNA (1 μg/μl)، 1 میکرولیتر Primer F (10 pmol/μl)، 1 میکرولیتر Primer R (10 pmol/μl) و 15 میکرولیتر ddH2O بود که بعد از رقیق­سازی به 100 میکرولیتر، از 5 میکرولیتر آن به‫عنوان الگو برای اجرای واکنش استفاده شد. جهت اندازه­گیری بیان ژن­های DXR، GTS، CYP178 و CYP180 از 18s-rRNA به‏عنوان کنترل داخلی یا ژن مرجع استفاده شد.

جدول 1: مشخصات آغازگرهای مورداستفاده جهت بررسی بیان ژن

دمای اتصال

توالی آغازگر (3→ 5)

نام آغازگر

59~

TGGCCTTTGGAAGCGTCG

F-CYP178

TCAGGCTCATTCCAATAGAGG

R-CYP178

60~

GGTAAACTGGCGGACTTGGT

F-CYP180

CGAACGGGATTAACTCGAAA

R-CYP180

61~

CTCTTGGATTCAGACTCCTCAG

F-GTS

GAGGGAGAGCCAAAGAATG

R-GTS

61~

GCCTTTTGTCCTTCCTCTTG

F-DXR

TCCGCTCGATGCTTGTCGC

R-DXR

60~

ATGTTTAGAAGGGTGAGTGAGCAGTTTAC

18s-F

GCCTCATCATCATACTCTTCCTCATCATC

18s-R

 

  • آنالیز داده­ها

   مقدار CT هر نمونه برای هر کدام از ژن­ها به‫وسیله نرم­افزار Line Gene K تعیین شد. تغییرات کمی بین نمونه­ها به‫کمک رویکرد کمی‌سازی نسبی DDCT تعیین شد (16). جهت تجزیه آماری داده‌ها بر مبنای آزمایش فاکتوریل دوعاملی در زمان، آنالیز واریانس و مقایسات میانگین بین تیمارها با آزمون دانکن در نرم­افزار SAS انجام شد. از برنامه Excel 2010 نیز به‫منظور ترسیم نمودار­های حاصل از آنالیز بیان ژن‏ها استفاده شد.

اندازه­گیری محتوی تیمول و کارواکرول:  جهت تعیین غلظت تیمول و کارواکرول در برگ­های آویشن، کروماتوگرافی مایع با کار آیی بالا HPLC انجام شد. جهت آماده­سازی برای عصاره­گیری، نخست نمونه­ها در دمای 25 درجه سانتی­گراد و تاریکی خشک شده و سپس 5/0 گرم بافت خشک خردشده با  25 میلی­لیتر اتانول 80 درصد ترکیب شد. بعد از فرایند استخراج در دمای  25 درجه سانتی­گراد به‫مدت  2 ساعت بر روی شیکر، محلول به‫دست­آمده با کاغذ صافی واتمن فیلتر شد. بعد از سانتریفیوژ با دور 400 rpm به‫مدت 5 دقیقه، محلول کاملا شفاف توسط دستگاه تبخیرکننده چرخان خشک شد. از هر نمونه، محلول استوک (1000پی پی ام) توسط حلال متانول تهیه شد که این محلول­ها برای سنجش غلظت تیمول و کارواکرول به‫کار گرفته شدند. در ادامه، 50 میکرولیتر از عصاره به دستگاه  HPLC (مجهز به آشکارساز  UV و ستون C18 با اندازه ذرات 5 میکرومتر، قطر  4 میلی­متر و طول250 میلی­متر) تزریق شد. سنجش کارواکرول و تیمول در طول موج 280 نانومتر صورت گرفت. برای آنالیز کمی ترکیبات، بعد از تزریق محلول­های استاندارد با غلظت­های مشخص و به حصول سطح زیر پیک هر کدام، منحنی کالیبراسیون هر ترکیب رسم شد و توسط معادله خطی منحنی کالیبراسیون، مقدار هر ترکیب در عصاره­های آویشن برآورد شد (10).

3-نتایج

بیان ژن DXR تحت تاثیر اشعه UV- A و هورمون متیل‌جاسمونات

   بیان ژن رمزگردان آنزیم DXR که در تولید متیل اریتریتول 4-فسفات (MEP) از دی­اکسی زایلوز 5-­فسفات (DXP) ایفای نقش می­کند، به‫طور معنی­داری بر اثر تیمار الیسیتورهای متیل‌جاسمونات و UV-A افزایش یافت (شکل 2). بعد از 24 ساعت، بیان ژن DXR در تیمار متیل‌جاسمونات، UV-A و تیمار ترکیبی آن‫ها به‫ترتیب 2/2، 1/2 و 8/2 برابر نسبت به کنترل افزایش یافت. اما بیان این ژن بعد از گذشت 48 ساعت از تیمار متیل‌جاسمونات، UV- A و تیمار ترکیبی آن‫ها به ترتیب 32، 48 و 39 درصد نسبت به روز قبل کاهش یافت.

 

شکل 2: بیان ژن DXR پس از اعمال اشعه UV-A و هورمون متیل‌جاسمونات. حروف یکسان گویای عدم تفاوت معنی‌دار در سطح احتمال 5 درصد با آزمون دانکن است.

بیان ژن GTS تحت تاثیر اشعه UV- A و هورمون متیل‌جاسمونات

   بیان ژن گاماترپینن سنتاز (GST) که تولید گاماترپینن از ژرانیل 2-فسفات (GP) را کاتالیز می­کند، به‫طور معنی­داری بر اثر تیمار الیسیتورهای متیل‌جاسمونات و تابشه اشعه UV-A افزایش یافت (شکل 3). در 24 ساعت پس از شروع تیمار، بیان این ژن توسط متیل‌جاسمونات و UV- A به‫ترتیب 6/2 و 9/2 برابر نسبت به کنترل افزایش یافت. با اینحال، بعد از گذشت 48 ساعت، بیان ژن GST توسط متیل‌جاسمونات و UV-A به ترتیب 34 و 45 درصد نسبت به روز قبل کاهش یافت. تیمار ترکیبی باعث افزایش بیان GST شد؛ با این‫حال، اختلاف معنی­داری مابین 24 و 48 ساعت پس از اعمال ترکیبی متیل‌جاسمونات و UV-A وجود نداشت.

 

شکل 3: بیان ژن GST پس از اعمال اشعه UV-A و هورمون متیل‌جاسمونات. حروف یکسان گویای عدم تفاوت معنی‌دار در سطح احتمال 5 درصد با آزمون دانکن است.

 

بیان ژن CYP178 تحت تاثیر اشعه UV-A و هورمون متیل‌جاسمونات

   بر اثر تیمار الیسیتورهای متیل‌جاسمونات و UV-A، سطح رونوشت ژن CYP178 که واکنش تولید تیمول از گاماترپینن را کاتالیز می­کند، به طور معنی­داری افزایش یافت (شکل 4). بعد از گذشت 24 ساعت، بیان ژن CYP178 در تیمار متیل‌جاسمونات، UV-A و تیمار ترکیبی آن‫ها به‫ترتیب 6/1، 0/2 و 3/2 برابر نسبت به کنترل افزایش یافت. با این‫حال، بیان این ژن بعد از گذشت 48 ساعت از تیمار متیل‌جاسمونات، UV-A و تیمار ترکیبی آن‫ها به‫ترتیب 33، 40 و 30 درصد نسبت به روز قبل کاهش یافت.

 

شکل 4: بیان ژن CYP178 پس از اعمال اشعه UV- A و هورمون متیل‌جاسمونات. حروف یکسان گویای عدم تفاوت معنی‌دار در سطح احتمال 5 درصد با آزمون دانکن است.

بیان ژن CYP180 تحت تاثیر اشعه UV-A و هورمون متیل‌جاسمونات

بر اثر تیمار الیسیتورهای متیل‌جاسمونات و UV-A، سطح رونوشت ژن CYP180 که واکنش تولید کارواکرول از گاماترپینن را کاتالیز می­کند، به‫طور معنی­داری افزایش یافت (شکل 5). بعد از گذشت 24 ساعت، بیان ژن CYP180 در تیمار متیل‌جاسمونات، UV- A  و تیمار ترکیبی آن‫ها به ترتیب 6/1، 0/2 و 3/2 برابر نسبت به کنترل افزایش یافت. با این‫حال، بیان این ژن بعد از گذشت 48 ساعت از تیمار متیل‌جاسمونات، UV- A و تیمار ترکیبی آن‫ها به‫ترتیب 33، 40 و 30 درصد نسبت به روز قبل کاهش یافت.

 

شکل 5: بیان ژن CYP180 پس از اعمال اشعه UV-A و هورمون متیل‌جاسمونات. حروف یکسان گویای عدم تفاوت معنی‌دار در سطح احتمال 5 درصد با آزمون دانکن است.

 

غلظت ترکیبات تیمول و کارواکرول تحت تاثیر اشعه UV- A و هورمون متیل‌جاسمونات

   نتایج این آزمایش نشان داد که غلظت ترکیبات فنولی تیمول و کارواکرول به‫شدت متاثر از هم­افزائی دو الیسیتور غیزیستی UV-A و متیل‌جاسمونات قرار گرفت به‫گونه­ای که غلظت تیمول و کارواکرول در ترکیب تیماری بعد از گذشت 24 ساعت، به‫ترتیب 7/1 و 05/1 برابر نسبت به شاهد بود و بعد از 48 ساعت با کاهش همراه بود (شکل 6 و 7).

 

 

 

 

 

 

شکل 6: غلظت تیمول پس از اعمال اشعه UV-A و هورمون متیل‌جاسمونات. حروف یکسان گویای عدم تفاوت معنی‌دار در سطح احتمال 5 درصد با آزمون دانکن است.

 

شکل 7: غلظت کارواکرول پس از اعمال اشعه UV-A و هورمون متیل‌جاسمونات. حروف یکسان گویای عدم تفاوت معنی‌دار در سطح احتمال 5 درصد با آزمون دانکن است.

 

همبستگی غلظت متابولیت­ها و بیان ژن­های درگیر در بیوسنتز تیمول و کارواکرول

   نتایج این آزمایش نشان داد که همبستگی معنی­داری مابین غلظت متابولیت­ها و بیان ژن­های درگیر در بیوسنتز تیمول و کارواکرول وجود دارد به‫طوری‫که بیان ژن­هایDXR  و GTS دارای رابطه مثبت و معنی­داری با غلظت تیمول و کارواکرول بودند. درحالی‫که، بیان ژنCYP178  فقط با غلظت تیمول رابطه مثبت معنی­داری داشت. به‫طور مشابهی، بیان ژنCYP180  فقط با غلظت کارواکرول رابطه مثبت معنی­داری داشت و با غلظت تیمول رابطه معنی­داری نشان نداد (جدول 2).

 

جدول 2: همبستگی غلظت متابولیت­ها و بیان ژن­های درگیر در بیوسنتز تیمول و کارواکرول

 

بیان ژن DXR

بیان ژن GTS

بیان ژن CYP178

بیان ژن CYP180

تیمول

*65/0

*71/0

*87/0

27/0

کارواکرول

*59/0

*63/0

23/0

*74/0

 

4-بحث

    تاکنون، تکنیک­های مختلفی به‫منظور افزایش تولید ترکیبات فعال و متابولیت­های ثانویه گیاهان دارویی اتخاذ شده است که در این میان، استفاده از الیسیتورهای زیستی و غیرزیستی به خاطر تنوع و سهولت به‫طور چشمگیری در کشت­ بافت و حتی در گلخانه و مزرعه مورد توجه قرار گرفته­اند (17). هرچند گزارشاتی در خصوص کاربرد جداگانه متیل‌جاسمونات و UV-A به‫منظور القای بیوسنتز ترکیباتی همچون ترپنوئیدها در گیاهان مختلف منتشر شده است (18، 19)، با این‫حال اثر هم­افزائی آن‫ها بر مسیرهای بیوسنتزی هنوز ناشناخته مانده است.

متیل‌جاسمونات‏ از کارآمدترین الیسیتور‏های شیمیایی به شمار می­رود که با مسیر پیام‏رسانی اختصاصی خود منجر به افزایش فعالیت آنزیم فنیل‏آلانین‏آمونیالیاز و متعاقبا القای مسیر فنیل‏پروپانوئیدی می‌شود که پیامد آن، افزایش محتوای متابولیت­های فنلی می­باشد (16 و 20). یک روز بعد از تیمار، بیان ژن­های DXR، GTS، CYP178 و CYP180 افزایش معنی­داری داشت و با گذشت زمان، روند کاهشی در پیش گرفت. با توجه به رابطه مستقیم بین بیان ژن‌های کلیدی یادشده و فرآورده­های حاصل از آن‫ها یعنی تیمول و کارواکرول، به‏نظر می‏رسد که زمان ایده­آل تیمار متیل‌جاسمونات جهت افزایش تولید این دو ترکیب، 24 ساعت بعد از اعمال تیمار متیل‌جاسمونات ‌باشد. همراستا با یافته­های ما، Ruiz-May و همکاران (21) نشان دادند که تیمار متیل‌جاسمونات در گیاه دارویی Catharanthus roseus سبب افزایش چشمگیر آلکالوئیدهای ایندول­ترپن می­شود (21). در پژوهشی دیگر، Gadzovska و همکاران (22) با به‫کارگیری متیل‌جاسمونات بر روی گیاه داروییHypericum perforatum نشان دادند که آلکالوئیدها و فنیل پروپانوئیدها به‫طور قابل­توجهی پس از اعمال تیمار در مقایسه با گیاهان شاهد افزایش پیدا کردند. با مقایسه مشاهدات ما با سایر محققان (23-30)، می­توان پیشنهاد کرد که تیمار متیل­جاسمونات سبب افزایش بیان ژن‏های درگیر در بیوسنتز تیمول و کارواکرول خواهد شد که این امر به نوبه خود راه را برای افزایش تولید تیمول و کارواکرول فراهم می­کند. به‫نظر می­رسد که متیل‌جاسمونات با اتصال به پروتئین­های گیرنده واقع بر روی غشا و متعاقبا القای آبشار پیام‫رسانی وابسته به گونه­های فعال اکسیژن سبب فعالسازی فاکتورهای رونویسی می­شود که مسئولیت بیان ژن­های درگیر در بیوسنتز تیمول و کارواکرول را برعهده دارند (15).

 امواج نوری نظیر فرابنفش به‫طریق مختلف بر فرایندهای فیزیولوژیکی و بیوشیمیایی تاثیر می­گذارند. یکی از ساز وکارهای درگیر در تاثیر تابش فرابنفش بر متابولوم گیاهان، متاثرسازی نسبت­های هورمونی است. برای مثال، اکسین یکی از هورمون­های هدف اشعه فرابنفش است که که بر اثر تابش طولانی تخریب می­شود و بدین­ترتیب نسبت اکسین به سیتوکنین و متعاقبا برخی از ویژگی­های رشدی گیاه دچار تغییر می­شود (13). یکی دیگر از ساز وکارهای عمل فرابنفش، مشابهت رفتاری با نور آبی است. از آنجایی‫که گیرنده­های نور آبی و فرابنفش یکسان است، لذا فرابنفش در طول­موج نزدیک به آبی شبیه به آن عمل می­کند و بدین­ترتیب سبب افت رشد گیاه و افزایش متابولیت­های آن می­شود (14). به‫عنوان ساز وکار بعدی، حساسیت برخی آنزیم­ها (همچون انواع درگیر در تولید آنتوسیانین­ها) به فرابنفش را می­توان نام برد که به‫شدت و زمان اشعه فرابنفش پاسخ می­دهند و از این طریق بر سطح متابولیت­های گیاهان اثر می­گذارند (20). در تحقیق اخیر، اثر اشعه UV-A بر بیان ژن­های DXR، GTS، CYP178 و CYP180 مورد بررسی قرار گرفت و نتایج حاکی از این بود که سطح رونوشت آن‫ها به‫طور معنی­داری تحت تاثیر اشعه قرار گرفت. در توافق با یافته­های ما، Victório و همکاران (14) نشان دادند که کاربرد UV-A سبب افزایش ژرانین و الاژیک اسید در گیاه داروییPhyllanthus tenellus می‌شود (14). در تحقیق دیگر، Rai و همکاران (20) نشان دادند که استفاده از UV-A منجر به افزایش آرتیمیزین در گیاه آرتمیزیا می­شود. روی هم­رفته، مشاهدات ما در کنار گزارشات قبلی حاکی از نقش بالقوه اشعه UV-A در افزایش تولید تیمول و کارواکرول می­باشد. به‫نظر می­رسد که تابش اشعه UV-A سبب فعالسازی مسیرهای پیام­رسانی القا شونده باUV  می­شود که به‫نوبه خود فاکتورهای رونویسی دخیل در بیان ژن­های بیوسنتز تیمول و کارواکرول را فعال می­کنند (30، 31). البته هنوز مکانیزم­های دقیق درگیر در افزایش بیوسنتز متابولیت­های ثانویه با تابش UV-A معلوم نشده است.

 تاثیر هم­افزائی متیل‌جاسمونات و UV-A در افزایش سطح دو ترکیب فنلی مهم یعنی تیمول و کارواکرول گویای پتانسیل بالای مسیر پیام­رسانی متیل‌جاسمونات و مسیر پاسخ به آسیب­های ناشی از UV-A در القا و تولید متابولیت­هایی ثانویه­ای است که از گیاه به هنگام شرایط نامطلوب محیطی حفاظت به‫عمل می­آورند (10، 14). بنابراین از این پتانسیل می­توان به‫منظور افزایش بازدهی تولید ترکیبات فعال در گیاهان دارویی بهره برد.

در رابطه با مکانیزم­های پشت­پرده این تاثیرگذاری الیسیتورها بر محتوی ترکیبات فنولی می­توان گفت که الیسیتورها سبب بروز آرایه­ایی از واکنش­های دفاعی نظیر تجمع مجموعه­ای متنوعی از متابولیت­های ثانویه دفاعی در گیاه می‏شوند. هرچند مکانیسم دقیق این تاثیرگذاری به‫خوبی شناخته نشده است، بااین‫حال پیشنهاد شده است که مکانسیم­هایی مختلفی در این پدیده دخالت دارند. برخی محققان اعتقاد دارند که نخست الیسیتورهایی مثل جاسمونات به گیرنده­های غشای پلاسمایی متصل می‫شوند و سپس آبشارهای پیام‫رسانی­ را فعال می­کنند. در واقع، تحریک سلول با الیسیتور، شامل اتصال الیسیتور به گیرنده‫های غشای پلاسمایی، اسیدی­شدن محیط سیتوزول، تولید گونه­های فعال اکسیژن و درنهایت فعال‫سازی بیان ژن­های درگیر در فرآیندهای پاسخ دفاعی نظیر سنتز متابولیت­های ثانویه است (22-31).

5-نتیجه­گیری

    الیسیتورها به‫عنوان یکی از دستاوردهای مهم بیوتکنولوژیست­ها از پتانسیل قابل توجهی در القا  و تولید ترکیبات زیستی برخودار هستند. جدا از این اثرگذاری مثبت، تاثیر هم­افزائی آن‫ها می­تواند گویای ظرفیت بالای گیاهان در پاسخ به این الیسیتورها باشد. در راستای پاسخ به این سوال، مطالعه اخیر نشان داد که بیان ژن­های کلیدی درگیر در بیوسنتز تیمول و کارواکرول یعنی DXR، GTS، CYP178 و CYP180 به‫طور چشمگیری در تیمار ترکیبی نسبت به تیمارهای جداگانه افزایش یافت. از آنجایی‫که محتوی تیمول و کارواکرول مستقیما تحت تاثیر بیان این ژن‏ها قرار دارد، لذا استفاده از الیسیتورهای متیل‌جاسمونات و UV-C می­تواند راه‫کاری مناسب و ساده در تولید این ترکیبات بارزش تلقی شود.

6- تشکر و قدردانی

   کمال سپاسگزاری را از همکارانی داریم که ما را در اجرای این مطالعه مساعدت نمودند.

-

  1. Jarić S, Mitrović M, Pavlović P. Review of ethnobotanical, phytochemical and pharmacological study of Thymus serpyllum L. Evidence-Based Complementary and Alternative Medicine. 2015; 101978:1–10.
  2. Naghdi-Badi H, Maki-Zadeh M. Review of Common Thyme. Journal of Medicinal Plants. 2003; 2(7): 1-12.
  3. Krause ST, Liao P, Crocoll C, Boachon B. The biosynthesis of thymol, carvacrol, and thymohydroquinone in Lamiaceae proceeds via cytochrome P450s and a short-chain dehydrogenase. Proceedings of the National Academy of Sciences of the United States of America. 2021; 118(52):e2110092118.
  4. Halder M, Sarkar S, Jha S. Elicitation: a biotechnological tool for enhanced production of secondary metabolites in hairy root cultures. Engineering in Life Sciences. 2019; 19:880–895.
  5. Murthy HN, Lee EJ, Paek KY. Production of secondary metabolites from cell and organ cultures: strategies and approaches for biomass improvement and metabolite accumulation. Plant Cell, Tissue and Organ Culture. 2014; 118:1–16
  6. Nabi N, Singh S, Saffeullah P. Responses of in vitro cell cultures to elicitation: regulatory role of jasmonic acid and methyl jasmonate: a review. In Vitro Cellular & Developmental Biology– Plant. 2021; 57:341–355.
  7. Ali MS, Baek KH. Jasmonic acid signalling pathway in response to abiotic stresses in plants. International Journal of Molecular Sciences. 2020; 21:621.
  8. Han GZ. Evolution of jasmonate biosynthesis and signalling mechanisms. Journal of Experimental Botany. 2017; 68:1323–1331.
  9. Ruan J, Zhou Y, Zhou M, Yan J, et al. Jasmonic acid signaling pathway in plants. International Journal of Molecular Sciences. 2019; 20:2479.
  10. Yang D, Ma P, Liang X, Wei Z, et al. PEG and ABA trigger methyl jasmonate accumulation to induce the MEP pathway and increase tanshinone production in Salvia miltiorrhiza hairy roots. Physiologia Plantarum. 2012; 146 (2): 173-83.
  11. Zchen Y, Li T, Yang Q, Zhang Y, Zou J, Bian Z, Wen X. UVA radiation is beneficial for yield and quality of indoor cultivated lettuce. Frontiers in Plant Science. 2019;10:1563.
  12. Zmumivand H, Shayganfar A, Tsaniklidis G, Emami Bistgani Z, Fanourakis D, Nicola S. Pheno-morphological and essential oil composition responses to UVA radiation and protectants: A case study in three Thymus species. Horticulturae. 2021;8(1):31.
  13. Verdaguer D, Jansen MA, Llorens L, Morales LO, et al. UV-A radiation effects on higher plants: Exploring the known unknown. Plant Sciences. 2017; 255:72-81.
  14. Victório CP, Leal-Costa MV, Tavares ES, Kuster RM, et al. Effects of supplemental UV-A on the development, anatomy and metabolite production of Phyllanthus tenellus cultured in vitro. Photochemistry Photobiology. 2011; 87(3):685-9.
  15. Zkim HJ, Chen F, Wang X, Rajapakse NC. Effect of methyl jasmonate on secondary metabolites of sweet basil (Ocimum basilicum L.). Journal of Agricultural and Food Chemistry. 2006;54(6):2327-32.
  16. Pfaffl MW. A new mathematical model for relative quantification in Real-Time RT–PCR. Nucleic acids research. 2001; 29(9): e45-e45.
  17. Ghanati F. Bakhtiarian S. Effect of methyl jasmonate and silver nanoparticles on production of secondary metabolites by Calendula officinalis L. (Asteraceae). Tropical Journal of Pharmaceutical Research. 2014; 13:1783–1789.
  18. Ho TT, Murthy HN, Park SY. Methyl Jasmonate induced oxidative stress and accumulation of secondary metabolites in plant cell and organ cultures. International Journal of Molecular Sciences. 2020; 21:716.
  19. Lee MJ, Son JE, Oh MM. Growth and phenolic content of sowthistle grown in a closed-type plant production system with a UV-A or UV-B lamp. Horticulture, Environment, and Biotechnology. 2013; 54: 492–500.
  20. Rai R, Meena RP, Smita SS, Shukla A. UV-B and UV-C pre-treatments induce physiological changes and artemisinin biosynthesis in Artemisia annua L- An antimalarial plant. Journal of Photochemistry and Photobiology-B: Biology. 2011; 105(3): 216-225.
  21. Ruiz-May E, Galaz-Ávalos RM, Loyola-Vargas VM. Differential secretion and accumulation of terpene indole alkaloids in hairy roots of Catharanthus roseus treated with methyl jasmonate. Molecular Biotechnology. 2009; 41 (3): 278-85.
  22. Gadzovska S, Maury S, Delaunay A, Spasenoski M, et al. Jasmonic acid elicitation of Hypericum perforatum L. cell suspensions and effects on the production of phenylpropanoids and naphtodianthrones. Plant Cell, Tissue and Organ Culture. 2007; 89:1–13.
  23. Khan A, Khan MA, Alam M, Akbar R, et al. Analysis of the differential effects of methyl jasmonate on induction of adventitious roots and antioxidant potential in Artemisia scoparia. International Journal of Biosciences. 2019; 15:547–558.
  24. Largia MJV, Pothiraj G, Shilpha J, Ramesh M. Methyl jasmonate and salicylic acid synergism enhances bacoside A content in shoot cultures of Bacopa monnieri (L.). Plant Cell, Tissue and Organ Culture. 2015; 122:9–20
  25. Mendoza D, Cuaspud O, Arias JP, Ruiz O, et al. Effect of salicylic acid and methyl jasmonate in the production of phenolic compounds in plant cell suspension cultures of Thevetia peruviana. Biotechnology Reports. 2018; 19:e00273
  26. Portu J, López R, Santamaría P, Garde-Cerdán T. Elicitation with methyl jasmonate supported by precursor feeding with phenylalanine: effect on Garnacha grape phenolic content. Food Chemistry. 2017; 237:416–422.
  27. Saeed S, Ali H, Khan T, Kayani W, et al. Impacts of methyl jasmonate and phenyl acetic acid on biomass accumulation and antioxidant potential in adventitious roots of Ajuga bracteosa (Wall ex Benth) a high valued endangered medicinal plant. Physiology and Molecular Biology of Plants. 2017; 23:229–237
  28. Sellapan P, Rohani ER, Noor NM. Sesquiterpene production in methyl Jasmonate-induced Persicaria minor cell suspension culture. Sains Malaysiana. 2018; 47:3051–3059
  29. Zabala MA, Angarita M, Restrepo JM, Caicedo LA, et al. Elicitation with methyl-jasmonate stimulates peruvoside production in cell suspension cultures of Thevetia peruviana. In Vitro Cellular & Developmental Biology– Plant. 2010; 46:233–238
  30. Zaragoza-Martínez F, Lucho-Constantino GG, Ponce-Noyola T, Esparza-García, et al. Jasmonic acid stimulates the oxidative responses and triterpene production in Jatropha curcas cell suspension cultures through mevalonate as biosynthetic precursor. Plant Cell, Tissue and Organ Culture. 2016; 127:47–56
  31. Zhou M, Memelink J. Jasmonate-responsive transcription factors regulating plant secondary metabolism. Biotechnology Advances. 2016; 34:441–449.