فصلنامه

نوع مقاله : علمی - پژوهشی

نویسندگان

1 دانشجوی دکتری بیوتکنولوژی کشاورزی، دانشگاه گیلان، پردیس دانشگاهی، بخش بیوتکنولوژی کشاورزی، رشت، ایران

2 دانشگاه گیلان، دانشکده علوم کشاورزی، گروه بیوتکنولوژی کشاورزی، رشت، ایران

3 دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته کرمان ، پژوهشکده علوم محیطی، پژوهشگاه علوم و تکنولوژی پیشرفته و علوم محیطی، گروه بیوتکنولوژی، کرمان، ایران

4 دانشگاه جیرفت، دانشکده علوم، گروه زیست شناسی گیاهی، کرمان ، ایران

10.52547/JCT.9.3.206

چکیده

هدف: در این تحقیق اثرات ضد­سرطانی و آپوپتوزیسی عصاره هیدروالکلی بذر خارسنبل  Blepharis persica بر روی سلول­های سرطانی سینه­ و پروستات و اثر هم­افزایی آن با دارو دوکسوروبیسین مورد مطالعه قرار گرفت. 
مواد و روش­ها: عصاره هیدروالکلی بذر با روش خیساندن و با اتانول ­70درصد تهیه شد. 8­ غلظت عصاره و 4 غلظت ترکیبی از دوکسوروبیسین (125و 5/62 نانوگرم بر میلی­لیتر) با عصاره غلظت­های (315/0و 625/0 میلی­گرم بر میلی­لیتر) تهیه شد. سلول‫های سرطانی سینه (MCF-7)­­­، پروستات (LNCaP) و سلول­های فیبروبلاست ­(SKM)کشت داده شدند. درصد زنده­مانی رده‫های سلولی با تست­­MTT اندازه­گیری و میزان آپوپتوزیس در رده­های سلولی از روش Annexin/PI سنجیده شد و بررسی بیان ژن BCL2­ در مدت 24 و 48­ ساعت با روش quantitative RT-PCR (RT-qPCR)   Real-Timeصورت گرفت.
نتایج: عصاره به­ترتیب بر رده­های سلولی پروستات، پستان و فیبروبلاست بیشترین اثر­ بازدارندگی رشد را نشان­ داد. اثر ترکیبی دوکسوروبیسین با عصاره در هر سه رده سلولی با کنترل هیچ­گونه تفاوت معناداری نداشت. نتایج Annexin/PI  نشان­داد میزان آپوپتوزیس اولیه، تاخیری و نکروز در رده­های سلولی تیمار شده نسبت به کنترل افزایش داشته است. بیان ژنBCL2  در رده­های سلولی با تیمار غلظت 25/1 میلی­گرم بر میلی­لیتر عصاره گیاه در مدت 24 و 48 ساعت نسبت به ژن کنترل بتااکتین به­طور معنی­داری کاهش یافته بود (­01/0­p <).
نتیجه­گیری: عصاره هیدروالکلی بذر خارسنبل توانایی کاهش تکثیر سلول­های سرطانی سینه و پروستات و القا آپوپتوزیس در سلول­های سرطانی را دارد و هرچند که در غلظت کم موجب افزایش اثرات ضد سرطانی دوکسوروبیسین نمی­شود، ولی می­تواند جایگزنی برای آن با عوارض جانبی کمتر باشد.
 

تازه های تحقیق

-

کلیدواژه‌ها

عنوان مقاله [English]

Anticancer activity of Blepharis persica seed hydroalcoholic extract on (MCF-7) human breast cancer and (LNCaP) prostate cancer cell lines and its synergistic effect with doxorubicin

نویسندگان [English]

  • K Aghaabbasi 1
  • H Hassani Kumleh 2
  • N Askari 3
  • M Torkzadeh-Mahani 3
  • A ramzani-ghara 4

1 PhD student. Department of Biotechnology, University Campus 2 - University of Guilan ,Khalij Fars highway (5th kilo meter of Ghazvin road, Rasht, Iran

2 2. Faculty of Agricultural Sciences, University of Guilan, Khalij Fars highway (5th kilo meter of Ghazvin road(, Rasht, Iran

3 Department of Biotechnology,Institute of Sciences and High Technology and Environmental Sciences, Graduate University of Advanced Technology, End of Haft Bagh-e-Alavi Highway, Kerman, Iran.

4 Faculty of basic sciences, Department of plant biology, University of jiroft. km 8 Bandar Abbas Road, kerman , Iran.

چکیده [English]

Aims: This study was aimed to investigate the anti-proliferative effects of hydroalcoholic extract of Blepharis persica seed and its synergy effect with doxorubicin on human breast cancer and prostate cancer cell lines.
Materials and Methods: hydroalcoholic extract of  seed was prepared using maceration, and ethanol­%70. Eight concentrations of extract and four concentrations of combined with doxorubicin (125, 62.5ngr/ml) and extract (0.625, 0.315­mg/ml) were prepared. MCF7, LNCaP and SKM cell lines were cultured .Cell­­ viability was evaluated by MTT assay after 24­h. To show apoptosis inductionof breast and prostate­ cancer cell death by extracts, Annexin/PI test were performed. BCL2 gene expression was analyzed using Real-Time RT-qPCRfor 24,48h.
Results: The highest effects of growth inhibition were observed in the prostate, breast and fibroblast cell lines with extract, respectively. The combined effect of doxorubicin with extract in three cell lines in comparison with control did not show any significant difference. The results of Annexin / PI indicated that the percentage of initial apoptosis, delayed  apoptosis and necrosis in treated cells increased compared to control. BCL2 expression in cell lines decreased significantly over 24 and 48 h compares to control(p < 0.01).
Conclusion: hydroalcoholic extract of B.persica seed has ability to inhibit the proliferation of cancer cell lines as well as the induction of apoptosis in cancer cells, compared with using it with doxorubicin, although the extract did not have any synergy effect with doxorubicin at lower concentrations, it can be a substituted for this kind of drug with fewer side effects.
 

کلیدواژه‌ها [English]

  • Apoptosis
  • Blepharis persica
  • BCL2
  • LNCaP
  • MCF7

مقدمه

سرطان به‫عنوان یکی از کشنده­ترین عوامل مرگ و میر در دنیا، سالیانه بیش از 5/7 میلیون نفر را در به کام مرگ می­کشاند (1). بر اساس پیش­بینی سازمان بهداشت جهانی بروز سرطان در ایران تقریبا 86000 نفر در سال 1399 شمسی خواهد بود که میزان مرگ و میر ناشی از آن حدود  63000 مورد خواهد رسید (2 و 3). درکشورهای در حال توسعه سرطان پستان از جمله شایع­ترین سرطان­ها در بین زنان است­ (4). این سرطان از عوامل اصلی به خطر انداختن سلامتی در میان زنان است و اولین عامل مرگ و میر بر اثر سرطان در بین زنان محسوب می‫شود (5). بر اساس آمار وزارت بهداشت، درمان و آموزش پزشکی در سال 1392 بیش از 40000 نفر در ایران دچار این بیماری شده­اند و بر این تعداد هر ساله افزوده می­شود ­(6). از سوی دیگر پروستات یکی از غدد مهم دستگاه تولید مثل در مردان است و بیماری­های ناشی از آن دارای اهمیت فراوانی هستند ­(7). سرطان پروستات شایع‫ترین سرطان بدخیم در میان مردان است، بیشترین مورد بروز سرطان در مردان (حدود 28 درصد) و دومین عامل مرگ­و­میر (حدود11 درصد­) را به‫خود اختصاص داده است. فاکتورهای ژنی و عوامل محیطی از مهم­ترین فاکتورهای هستند که در بروز سرطان سینه و پروستات نقش دارند، از طرف دیگر عواملی محیطی مانند رژیم غذایی، نحوه زندگی، شرایط جغرافیایی، عوامل استرس­زا، سن و چاقی در بروز این بیماری دخیل هستند (11-8). متخصصین بالینی از روش­های متعددی در تشخیص و درمان انواع سرطان­ها استفاده می­کنند که شیمی درمانی، پرتو درمانی، جراحی و هورمون درمانی عمده­ترین آن‫ها هستند ولی مهم­ترین روش مبارزه با سرطان، شیمی‫درمانی است که عوارض جانبی  زیادی از  جمله خستگی­، حالت تهوع و ریزش مو و غیره را برای بیمار ایجاد می­کند، این عوارض می­تواند بر روی کیفیت زندگی بیمار تاثیر زیادی داشته باشد (12و13). داروی دوکسوروبیسین با نام تجاری آدریامایسیین یکی از قوی­ترین و اصلی­ترین داروهای شیمی درمانی گروه آنتراسیکلین است. این دارو در درمان بسیاری از سرطان­ها نظیر معده، پستان، ریه، تخمدان، استخوان، بیماری هوچکین و سرطان خون مورد استفاده قرار می‫گیرد، این دارو همانند دیگر داروهای شیمی درمانی دارای عوارض جانبی بسیار زیادی است که می­توان به تب، مسمومیت قلبی و غیره اشاره کرد (16-14). چندین مکانیسم برای اعمال خاصیت سمیت این دارو در نظر گرفته می­شود که مهم­ترین آن‫ها آسیب به DNA  می‫باشد. دوکسوروبیسین با پایداری اتصال کمپلکس آنزیم توپوایزومراز II به DNA از اتصال مجدد رشته­های شکسته شده جلوگیری می­کند. آسیب به DNA به‫عنوان یک محرک سلولی باعث فعال شدن پروتئین­های مسیر آپوپتوزیس می­­شود (17). پروتئین­های خانواده BCL2­، یک گروه از تنظیم کننده­های داخل سلولی آپوپتوزیس یا مرگ برنامه­ریزی شده سلول هستند. تعدادی از پروتئین­ها­ خانوادهBCL2، پروآپوپتوتیک هستند یعنی آپوپتوزیس به‫وسیله افزایش بیان این پروتئین­ها راه اندازی می­شود و  BAX جز این گروه است. تعداد دیگری از پروتئین­های خانواده  BCL2آنتی­آپوپتوتیک هستند یعنی آپوپتوزیس به‫وسیله مهار آزاد­سازی این پروتئین­ها باز­داری می­شود مانند­BCL2  که به‫طور گسترده در سطح غشا خارجی میتوکندری وER  غشا هسته واقع شده­اند و تمامیت غشا را حفظ می­کنند (20-18). تحقیقات زیادی در مدت بیش از بیست سال  بر روی مرگ برنامه­ریزی شده سلول یا آپوپتوزیس پوپتورصورت گرفته است و در نتیجه این تحقیقات ثابت شده است که مرگ برنامه ریزی شده سلول به‫عنوان یک مانع طبیعی رشد سرطان می‫باشد، ترکیبات طبیعی موجود در گیاهان با تاثیر بر روی مسیر آپوپتوزیس سلول­های سرطانی می‫توانند به‫عنوان یک ترکیب ضد توموری شناخته شوند (21).

جنس Blepharis دارای 100 گونه گیاهی است که در مناطق گرمسیری و نیمه گرمسیری رشد می‫کند. گیاه خارسنبل از جنس Blepharisبا نام علمی Blepharis persica شناخته می­شود (22). گونه مشابه این گیاه­، B.edulis است که در بیابان­های خاورمیانه و آفریقا رشد می­کند (23). خارسنبل گیاهی است چندساله و کم ارتفاع، دارای برگ بیضی و میوه کپسولی است. ریشه آن مدر است و برگ­های آن دارای خاصیت بند آوردن خون هستند. در حال حاضر تحقیقات زیادی بر روی این گیاه انجام نشده است و اطلاعات کمی از خواص و فواید دارویی این گیاه وجود دارد ­(24). با توجه به آن‫که گیاهان دارای اثرات ضد توموری از جمله القای آپوپتوزیس و مرگ سلول­های سرطانی هستند و عوارض جانبی از استفاده آن‫ها کمتر است و همچنین این گیاه در مناطق بومی جنبه دارویی دارد، در این تحقیق بر آن شدیم که در ابتدا اثرات ضدسرطانی عصاره بذر گیاه خارسنبل با کمک تست MTT (Dimethylthiazol-2-yl-2,5-diphenyltetrazolium  bromide) بر روی رده­های سلول­های سرطانی سینه ­(MCF-7) و پروستات (‫LNCaP) سنجیده شود و با رده سلولی نرمال فیبروبلاست (­SKM) به‫عنوان گروه کنترل مقایسه شود و همچنین میزان القا آپوپتوزیس در رده­های سلولی با کمک روش فلوسایتومتری سنجش شود. ترکیب دارو دوکسوروبیسین و عصاره نیز مورد سنجش قرار گرفت و در پایان بیان ژن Bcl2 با کمک روش quantitative RT-PCR  Real-Time برای هر یک از گروه­های مورد مطالعه مورد سنجش قرار گرفت.

 

مواد و روش‌ها

تهیه نمونه گیاهی:این تحقیق یک تحقیق بنیادی، کاربردی است. گیاه خارسنبل از مناطق جنوبی و گرمسیر استان کرمان در فصل بهار در سال 1396 از منطقه کهنوج با طول جغرافیایی 57 و عرض جغرافیایی 27 درجه و ارتفاع از سطح دریا 508 متر جمع آوری شد و بعد از تائید استاد گیاه شناسی ، گیاه در سایه و دمای محیط خشک شد و  سپس بذرهای  گیاه  جدا شدند و تا زمان عصاره­گیری در دمایی اتاق نگه­داری شدند.

 تهیه عصاره گیاهی: برای تهیه عصاره هیدروالکی از روش خیساندن (Macerate) و اتانول 70 درصد استفاده شد (25). ابتدا 40 گرم از بذر به‫کمک دستگاه آسیاب کاملا پودر شد. پودر حاصل در 300 میلی‫لیتر الکل 70 درصد حل شد و به‫مدت 72 ساعت روی دستگاه شیکر با دور متوسط در دمایی اتاق قرار داده شد­. در مرحله بعدی کار با کمک کاغذ صافی واتمن 1 در مدت 30 دقیقه عصاره­های صاف شد و جداسازی الکل با کمک دستگاه روتاری در خلا در دمای 45 درجه سانتی­گراد و مدت 45 دقیقه صورت گرفت. در نهایت برای جداسازی کامل حلال از عصاره در داخل آون به‫مدت 48ساعت در دمایی 45 درجه سانتی­گراد قرار داده شدند. عصاره حاصل تا فرایند آزمایشگاهی در فریزر 20- سانتی­گراد نگه­داری شد .

تهیه غلظت­های مختلف عصاره و دارو: در این تحقیق از 8 غلظت عصاره هیدرو­الکلی بذر خارسنبل و 4 غلظت دارویی دوکسوروبیسین استفاده شد. به‫منظور تهیه 10­ میلی‫لیتر استوک10 میلی­گرم برمیلی‫لیتر عصاره هیدرو الکلی، ابتدا میزان 100 ­میلی­گرم از عصاره نیاز است که این مقدار در 400 میکرو لیتر  Dimethyl sulfoxide (DMSO) (4 درصد) حل شد، در ابتدا 1 میلی‫لیتر محیط کشت فاقد سرم اضافه شد و بعد از آن مابقی محیط کشت اضافه تا کاملا در عصاره حل شود. غلظت­های دیگر به­ترتیب  5/7، 5 ، 5/2، 25/1، 625/0 ، 315/0و 156/0 میلی­گرم بر میلی­لیتر از استوک اصلی با کمک فرمول m1c1=m2c2  به‫دست آمد. در این تحقیق از دارو دوکسوروبیسین 50 میلی­گرم بر 25میلی لیتر به‫صورت محلول با نام تجاریEbedoxo  استفاده شد. ابتدا برای تهیه 7 میلی­لیتر از استوک نانوگرم بر میلی لیتر 500  از این دارو 25/1 میکرولیتر از آن را در 400 میکرولیتر  DMSOو محیط کشت بدون سرم به‫صورت کم کم اضافه شد تا حجم محلول 7 میلی­لیتر شود و از استوک به دست آمده غلطت­های 250 ، 125 و 5/62 نانوگرم بر میلی­لیتر دارو  تهیه شد. عصاره موجود و دارو را قبل از رقت سازی با فیلتر سررنگی 22/0­میکرومتر فیلتر شدند. در این تحقیق همچنین اثر ترکیبی دارو دوکسوروبیسین در غلظت‫های کم (125­و 5/62 نانوگرم برمیلی لیتر با غلظت­های کم عصاره (625/0 و 315/0 میلی گرم بر میلی لیتر) مورد سنجش قرار گرفت .

کشت سلولی : در این پژوهش­، سه رده سلول­های سرطانی سینه (MCF7)­، پروستات (LNCaP) و فیبروبلاست ((SKM در داخل فلاسک 25 سانتی­متر مربع به‫صورت کشت شده از انستیتو پاستور ایران خریداری شدند. سلول­­های سرطانی در محیط کشت 1640 RPMI و سرم جنینی  گاو  FBS 10 درصد به‫همراه 1 درصد آنتی بیوتیک­های استرپتومایسین و پنی­سیلین کشت داده شدند و هر سه رده سلولی را در انکوباتور 5 درصد CO2 و دمای 37 درجه سانتی­گراد کشت داده شدند. سلول­های نرمال فیبروبلاست در محیط کشت­DMEM  حاوی 10 درصد سرم FBS کشت داده شدند. سلول­های سرطانی سینه و پروستات بعد از ده مرحله پاساژ منظم و سلول­های فیبروبلاست بعد از 5 مرحله پاساژ آماده تیمار با غلظت­های مختلف عصاره­، دارو و ترکیب غلظت کم­دارو و عصاره شدند.

تست تترازولیومMTT: رده­های سلولی در فلاسک 25 سانتی­متر مربع به صورت مجزا کشت داده شدند و بعد از چند پاساژ به فلاسک 75 سانتی­متر مربع انتقال داده شدند و در انکوباتور 5 درصد CO2 و دمای 37 درجه سانتی گراد کشت داده شدند. بعد از شمارش سلولی به میزان 100 میکرو‫لیتر شامل تقریبا 7000 سلول از سوسپانسیون سلولی در پلیت‫های 96 خانه ریخته شدند و به‫مدت 24 ساعت در انکوباتور حاویCO2  و دمای 37 درجه سانتی­گراد به‫منظور چسبیدن و رشد سلول­ها به کف پلیت قرار داده شدند. سپس محیط کشت رویی سلول­ها خارج شد و محیط حاوی غلظت­های عصاره، دارو و ترکیب ­دارو با عصاره و همچنین محیط کشت  فاقد سرم به‫عنوان کنترل به سلول­ها اضافه شدند. بعد از 24­ ساعت به‫هر یک از چاهک­ها به میزان 10میکرو‫لیتر  MTT(­MELFORD ساخت اتگلستان ) اضافه شد و  بعد از آن­که 4 ساعت در انکوباتور نگه­داری شدند به هریک از چاهک­ها 150 میکرولیتر­DMSO  اضافه شد و بعد از 30 دقیقه جذب سلول­ها توسط دستگاه الیزا ریدر در طیف جذب 490 و 630 خوانده شد و  بر حسب فرمول مربوطه میزان زنده­مانی محاسبه شد. 

100 ×میانگین جذب سلول های تحت اثر ماده توکسیک- 1= درصد مهار­کنندگی رشد

                                   میانگین جذب کنترل منفی

درصد مهار­کنندگی رشد -100=  درصد بقا یا زنده­مانی

 

بررسی مرگ  برنامه­ریزی شده سلول توسط دستگاه فلوسایتومتری:جهت سنجش میزان آپوپتوزیس در رده سلول­های سینه، پروستات و سلول­های فیبروبلاست عصاره هیدروالکلی با غلظت 25/1 میلی­گرم بر میلی­لیتر انتخاب شد و سلول­های تیمار شده و بدون تیمار (کنترل) از روش Annexin/PI با کیت تشخیصیKit I Pharmingen™, USA)  (BD و با کمک دستگاه فلوسایتومتری (­CYFlow شرکت  partec G mbH ساخت آلمان) انجام گرفت. آزمایش به این صورت انجام شد که سلول­های سرطانی و فیبروبلاست با عصاره هیدروالکی 25/1 میلی­گرم برمیلی لیتر در مدت 24 ساعت تیمار داده شدند و برای هر کدام از رده­های سلولی یک کنترل در نظر گرفته شد. سلول­ها با محلول نمکِ فسفات با خاصیت بافری (PBS) شستشو داده شدند. بعد از سانتریفیوژ سلول­ها، به رسوب حاصل بافر بایندینگ اضافه شد. سپس 5 میکرولیتر از رنگ annexin V اضافه می­شود و به‫مدت 15 دقیقه در دمای اتاق انکوبه شد و سلول­ها در مرحله بعدی با محلول بایندینگ شستشو داده شدند و در 10 ماکرولیتر رنگ PI به سلول­ها اضافه شد و در پایان کار آنالیز توسط دستگاه انجام شد. 

بررسی بیان ژن BCL2: فرایند استخراجRNA  کل از سلول­های سرطانی پستان­، پروستات و سلول‫های فیبروبلاست بدون تیمار و تحت تیمار عصاره هیدروالکلی 25/1 میلی­گرم بر میلی­لیتر بذر خارسنبل به‫مدت 24 و 48 ساعت و همچنین تحت تیمار ترکیب عصاره  25/1 میلی­گرم بر میلی­لیتر با دارو 5/62 نانوگرم بر میلی­لیتر انجام پذیرفت. ابتدا سلول­های تحت تیمار و کنترل از کف فلاسک­های 25 سانتی­متر مربع با کمک آنزیم تریپسین جدا شدند و برای مراحل استخراج آماده شدند. استخراجRNA  با RNA-X PLUS انجام شد.  بعد از استخراج کمیت و کیفیت RNA موجود با دستگاه اسپکتوفتومتری و ژل الکتروفورز مورد سنجش قرار گرفت.cDNA  با کمک کیت سنتز ­(­Takara ساخت ژاپن­) با دستگاه Biometra GmbH) PCR ساخت آلمان (ساخته شد و توالی پرایمر رفت و برگشت ژن­BCL2  و ژن کنترل داخلی بتااکتین با استفاده از نرم­افزار  Primer3 طراحی شده و به‫منظور اطمینان بیشتر از درصد­GC ، دمای Tm و نداشتن دایمر با همدیگر، پرایمرها با برنامه ( Gene  Runner­­ نسخه 3.50 ( Hasting Software, Inc بررسی شدند (جدول1).

 

 

Primer

Tm) C°)

Primer sequence

Product   size (bp)

β-   actin

64

F:GGACATCCGCAAAGACCTGTA

R:ACATCTGCTGGAAGGTGGACA

189

BCL2

61

F:GTGGATGACTGAGTACCTGA

R:AGCCAGGAGAAATCAAACAGA

119

جدول 1: توالی و طول محصولات آغازگرهای مورد استفاده

 

 

 

پس از طراحی، پرایمرها برای سنتز به شرکت   FAZA Biotechسفارش داده شدند .محلولCYBR Green  مخصوص فرایند Real time-qPCR از شرکت یکتا تجهیز آزما تهیه شد و بیان ژن­های مورد نظر بعد از تیمار با کمک دستگاه rotor-Gene RG-3000 )ساخت استرالیا و شرکت CORBETT Research)  مورد سنجش قرار گرفت.

 

آنالیز آماری

با توجه با آنکه برای هر تیمار و کنترل در تستMTT  ، 3 تکرار وجود داشت. ابتدا داده­ها وارد اکسل شدند و سپس توسط نرم­افزار SPSS 20 ­در طرح کاملا تصادفی آنالیزها انجام گرفت و از آزمون  ANOVAیک‫طرفه برای مقایسه گروه­ها و آزمون دانکن برای آزمون تفاوت بین گروه­ها استفاده شد. تست­های مربوط به ژن BCL2  و ژن داخلی بتا اکتین برای هر نمونه سه تکرار در دستگاه rotor-Gene RG-3000  گذاشته شد و نتایج حاصل از بیان ژن برای بررسی اختصاصیت محصول تکثیر شده، منحنی ذوب مورد بررسی قرار گرفت و داده­های خام به‫صورت Ct از دستگاه استخراج شد و با کمک فرمول ct  ΔΔ نمونه­های شاهد و تیمار به‫دست آورده و نسبت ژن هدف به ژن مرجع بتااکتین را از طریق ct  ΔΔ -2 محاسبه شد . نتایج حاصل از ct  ΔΔ -2 ­­برای سه تکرار به اکسل منتقل شد و با نرم­افزار SPSS در سطح 5 و یک درصد میزان معنی­دار شدن بیان ژن هدف مورد بررسی قرار گرفت.

 

نتایج

تست MTT

در این تحقیق تاثیر عصاره هیدروالکلی خارسنبل با 8 غلظت مختلف، 4 دوز دارو دوکسوروبیسین و ترکیب غلظت پایین عصاره با غلظت پایین دارو دوکسو روبیسین روی رده­های سلول­های سرطانی سینه، پروستات و سلول فیبروبلاست مورد بررسی قرار گرفت. نتابج با کمک روش MTT در سه تکرار به این شکل بود در هر سه رده سلولی تاثیر عصاره بر روی زنده­مانی سلول­ها در سطح 1درصد و 5 درصد معنی­دار بود. به‫طوری که عصاره هیدروالکلی بذر گیاه خارسنبل در غلظت­های 10­و 5/7 میلی­گرم بر میلی­لیتر به ترتیب بر روی رده­های سلولی پروستات و سینه و فبیروبلاست بیشترین تاثیر را داشت (شکل1)، غلظت 10 و 5/7 میلی­گرم بر میلی­لیتر در پروستات 64/85 و 29/82 درصد سمیت سلولی، در سرطان سینه 03/83 و 20/77 و در فیبروبلاست 68/74و 62/72 بازدارندگی رشد  ایجاد کرده بود.

 

                       

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 1: (a) سلول کنترل یا بدون تیمار فیبروبلاست، (b) سلول تحت تیمار فیبروبلاست غلظت 25/1 میلی‫گرم بر میلی‫لیتر، (c) سلول کنترل یا بدون تیمار پستان‫، (d) سلول پستان تحت تیمار با غلظت  25/1 میلی‫گرم بر میلی‫لیتر، (e) سلول کنترل یا بدون تیمار پروستات، (f) سلول پروستات تحت تیمار با 25/1 میلی‫گرم بر میلی‫لیتر در 24 ساعت (بزرگ‫نمایی  x 100­ ­رده­های سلولی )

 

 

 

میزان سمیت سلولی در غلظت‫های بالا (10، 5/7، 5 ، 5/2 و 25/1) تفاوت معنی‫داری در سطح 1 درصد ­بر روی رده­های سلول‫های سرطانی و  فیبروبلاست نسبت به کنترل آن‫ها وجود داشت. غلظت 15/0میلی­گرم بر میلی­لیتر هیچ­گونه سمیت سلولی نداشت ولی غلظت 315/0 و 625/0 میلی­گرم بر میلی­لیتر بر روی پستان، فیبروبلاست و پروستات با آن‫که افزایش میزان سمیت سلولی مشاهده می­شد ولی تفاوت معنی­داری در سطح 5 درصد میزان سمیت سلولی تیمارها با کنترل دیده نشد (شکل 2).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل2: میزان سمیت سلولی غلظت­های مختلف(mg/ml)  عصاره هیدروالکلی بذر خارسنبل بر روی رده­های سلولی سرطان پروستات (رنگ سبز)، فیبروبلاست (رنگ آبی) و سینه  (قرمز) و تفاوت معنی‫دار در سطح 1درصد در اثر افزایش غلظت عصاره

 

 

 

 نتایج نشان می­دهد که با افزایش غلظت عصاره هیدروالکلی درصد زنده­مانی هر سه رده سلولی کاهش یافته است. نتایج تست MTT در 4 غلظت دارویی دوکسوروبیسین بر روی دو رده سلول­های سرطانی سینه و پروستات دارای اثرات سمیت سلولی بوده و بقای سلولی را کاهش می­دهد ، دوزهای500 و 250 نانوگرم بر میلی­لیتر دارو در سرطان سینه و دوز 500 نانوگرم بر میلی لیتر در سرطان پروستات اثرات سمیت قابل توجهی داشتند‫، به‫طوری‫که بیش از 50 درصد سلول­ها را کشته بودند ولی اثر ترکیبی غلظت 125و 5/62 نانوگرم بر میلی­لیتر دارو دوکسوروبیسین با دو غلظت 315/0­و

625/0 میلی­گرم بر میلی­لیتر  عصاره بذر گیاه در هر سه رده سلولی­ با کنترل آن‫ها هیچ‫گونه تفاوت معنی‫داری را نشان نداد (شکل 3).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل3:DOX   :تاثیر دوزهای مختلف داروی دوکسوروبیسین ،  BPE: تاثیرغلظت کم اثر عصاره خارسنبل بر روی سرطان پستان و پروستات. BPE+DOX: اثرترکیبی غلظت کم عصاره خارسنبل و دوز پایین دارو بر روی دو رده سلول­های سرطانی 

 

تست فلوسایتومتری

 

نتایج حاصل از دستگاه فلوسایتومتری در رده سلول‫های پستان، پروستات و فیبروبلاست تیمار شده با عصاره هیدروالکلی با غلظت 25/1 میلی­گرم بر میلی­لیتر و کنترل ­(بدون تیمار) بعد از 24 روز مورد سنجش قرار گرفتند. سلول­های کنترل پروستات، سینه و فیبروبلاست، به‫ترتیب میزان زنده‫مانی سلول­ها 46/84، 18/90­، 28/92 و مقدار آپوپتوزیس اولیه 24/7­، 57/4­، 97/3 و  درصد آپوپتوزیس تاخیری­ 14/5 ،32/4 ، 14/2 و درصد نکروزیس در سلول­های کنترل 15­/1 ­، 93/0­و 61/1 نشان داده شد­ (شکل4).

 

 

 

 

شکل4: نتایج حاصل از دستگاه فلوسایتومتری :Q1= درصد میزان نکروز، Q2= درصد آپوپتوزیس تاخیری، Q3= درصد میزان سلول­های زنده، Q4= درصد سلول­های که وارد آپوپتوزیس اولیه  شدند. سلول­های کنترل یا بدون تیمار (a) فیبرویلاست، (b) پستان و (c) پروستات، سلول­های تحت تیمار با غلظت 25/1 میلی گرم بر میلی‫لیتر در (d) فیبروبلاست، (e) پستان و(f)  پروستات

 

 

 

 

 

 

 

باتوجه به آنکه سلول­ها تحت تیمار قرار نگرفته بودند میزان آپوپتوزیس و نکروزیس دیده شده در رده­های سلولی قابل قبول بودند. درصد زنده­مانی سلول­های تحت تیمار با غلظت 25/1 میلی­گرم بر میلی­لیتر عصاره هیدروالکلی خارسنبل در رده­های سلولی پروستات، پستان، فیبروبلاست به‫ترتیب 10/71 ،23/74 ،02/82 و میزان آپوپتوزیس اولیه 37/24، 20/15 ، 27/13­، درصد آپوپتوزیس ثانویه به‫ترتیب 47/3 ، 28/7 و 48/3 و همچنین درصد نکروز در سلول­های تحت تیمار به‫ترتیب 06/1­­، 28/3 و 23/1 مشخص شد. نتایج نشان داد میزان درصد آپوپتوزیس اولیه، آپوپتوزیس تاخیری، مجموع کل آپوپتوزیس و نکروزیس دیده شده در  رده­های سلولی تیمار شده نسبت به رده­های سلولی بدون تیمار افزایش داشته است.

نتایج بیان ژن BCL2  : استخراج  RNA کل از سه رده سلول­های SKM،  LNCaPو MCF-7 تحت تیمار در مدت 24 و 48 ساعت و ترکیبی عصاره هیدروالکلی 25/1 میلی­گرم بر میلی­لیتر با دارو در مدت 24 ساعت و همچنین استخراج از سلول­های بدون تیمار یا کنترل انجام گرفت. کیفیت RNAهای نمونه­ها روی ژل آگاروز 5/1 درصد بررسی شد. دو باند مربوط بهS  18و  S28به‫وضوح قابل تشخیص بودند که نشان دهنده کیفیت بالای RNA استخراجی بود (شکل 5).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 5: RNA کل استخراج شده رده­های سلولی در مدت 24 ساعت، شماره 1: تحت تیمار پروستات ،2: تحت تیمار پستان  3: مربوط به‫ترکیبی دارو و عصاره، 4: کنترل پروستات ، 5: کنترل فیبروبلاست، 6: کنترل پستان 7: تحت تیمار فیبروبلاست و 8: نردبان ملکولی یا Ladder 1kbp روی ژل اگاروز 5/1 درصد

 

 

 

 

بررسی تغییر بیان ژن آپوپتوزیسیBCL2  نسبت به ژن کننرل بتا اکتین در رده­های سلولی­MCF7  و LNCaP در غلطت 25/1 میلی­گرم بر میلی­لیتر عصاره و ترکیب این غلطت با غلظت کم­دارو  با روش qPCR-Realtime  در مدت 24 و 48 ساعت بدین‫شکل بود که در مدت 24 و 48 ساعت بیان ژنBCL2  در تمامی رده­های سلولی کاهش یافته بود و این کاهش بیان در مدت ­24 و 48 ساعت نسبت به ژن کنترل در سطح 1 درصد معنی‫دار بود. بیشترین کاهش بیان به‫ترتیب در سلول­های سرطانی پروستات، سینه نشان داده شد (شکل 6).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 6: مقایسه بیان ژن BCL2 نسبت به ژن کنترل داخلی بتااکتین در مدت زمان 24 و 48 ساعت در رده سلول­های سرطانی LNCap  و MCF-7

 

 

 

تفاوت معنی­داری در سطح 1 درصد بین دو تیمار غلظت 25/1 میلی­گرم بر میلی­لیتر عصاره و اثر ترکیبی آن با دارو مشاهده نشد و کاهش چشم­گیری در بیان

 

ژن BCL2  بین این دو تیمار مشاهده نشد. به­منظور اطمینان از تک باند بودن پرایمرهای موجود، محصولات حاصل از Realtime-qPCR را روی ژل آگاروز 2 درصد بارگذاری شدند (شکل 7).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 7: محصول Realtime-PCR –  سمت راست چاهک اول نردبان ملکولی 1kbp  ( Ladder) و بقیه مربوط به ژن Bcl2 با طول 119 bp  در رده سلولی روی ژل آگاروز 2درصد

 

 

بحث

سرطان به‫عنوان یک بیماری کشنده در جهان شناخته می­شود و هر ساله تعداد زیادی از افراد جدید درگیر این بیماری می­شوند، در کشورهای در حال توسعه مانند ایران این بیماری عامل اصلی مرگ و میر انسان­

هاست. سرطان سینه در زنان ایرانی و سرطان پروستات در مردان ایرانی به‫عنوان شایع­ترین سرطان‫ها مطرح است و در دهه­های اخیر شیوع آن افزایش یافته است (27و 26). بیشتر گیاهان و سبزیجاتی مورد استفاده قرار می­گیرند و در طبیعت وجود دارند دارای خاصیت دارویی هستند. این گیاهان به‫دلیل داشتن ترکیبات دارویی و خاصیت آنتی اکسیدانتی می­توانند به‫عنوان یک عامل ضد سرطانی عمل کنند (28). خاصیت دارویی گیاهان به‫دلیل وجود متابولیت­های ثانویه است. این ترکیبات برای رشد و نمو گیاهان ضروری نیستند ولی برای حیات و  بقا گیاهان ضروری هستند و همچنین دارای پیچیدگی­های بیشتری  نسبت به متابولیت­های اولیه هستند (29). در این تحقیق از گیاه خارسنبلBelepharis persica ، گیاه بومی مناطق جنوبی ایران استفاده شد تا اثرات ضد سرطانی آن مورد سنجش قرار گیرد. گیاه  خارسنبل دارای خواص دارویی است و در مناطق بومی از قسمت­های مختلف آن استفاده می­کنند. از ترکیبات شیمیایی موجود در گیاه خارسنبل می­توان آلانتوان، کاتچول، تانن، ساپونین و گلوکز را نام برد (25). ساپونین یک متابولیت ثانویه است که در بسیاری از گیاهان دارویی و حتی جانوران دیده شده است. این ترکیب دارای طیف وسیعی از خواص دارویی از جمله: ضد آسم، ضد التهاب، ضد باکتریایی­، مفید برای قلب، تقویت کننده سیستم ایمنی، ضد قارچ و ضدسرطان است (31و30). با توجه به آنکه این گیاه دارای متابولیت ثانویه متعددی از جمله ساپونین است می‫توان گفت این گیاه دارای خواص ضد سرطانی می‫باشد. در این تحقیق­ با روش خیساندن­، عصاره هیدروالکلی این گیاه طی مدت 72 ساعت تهیه شد. نتایج حاصل از تست MTT این عصاره بذر خارسنبل  نشان داد که تفاوت معنی­داری در اثر سمیت سلولی این عصاره در غلظت­های مختلف با کنترل آن وجود دارد­. غلطت­های 10و 5/7 میلی­گرم بر میلی­لیتر این عصاره با آن‫که در هر سه رده سلولی بالای 50 درصد مهار رشد سلول­ها را داشت ولی کمترین بازدارندگی رشد را بر روی سلول­های فیبروبلاست داشته است. در تحقیقBaskar  و همکاران (32) اثر عصاره‫های مختلف قسمت هوایی گیاه maderaspatensisBlepharisهم­خانواده­Blepharis persica  بر روی رده­های سلول­های سرطانی MCF7 وAGS   مورد مطالعه  قرار گرفت و نتایج نشان داد که غلظت­های مختلف عصاره الکلی این گیاه در 24، 48 و 72 ساعت بر روی رده­های سلولی معده و سینه دارای اثر مهار کنندگی رشد دارد و با افزایش غلظت و زمان، میزان تاثیر گزاری عصاره بیشتر شده است. همتا و پروینی (33) به بررسی اثرات سمیت عصاره گیاه رزماری روی رده­های سلول­های سرطانیMCF7  القا شده توسط DMBA در رت­های نژاد SD پرداختند، نتایج نشان داد که عصاره الکلی رزماری بر روی سلول­های MCF7 دارای اثرات سمی قابل توجهی بوده است ولی عصاره آبی خواص ضد سرطانی بسیار ضعیفی داشت­. اثر عصاره هیدروالکلی میوه خارخسک بر تکثیر سلول‫های سرطان پروستات و روده بزرگ انسان در شرایط آزمایشگاهی توسط Yaghoobi و همکاران (34) انجام شد. نتایج نشان­داد افزایش غلظت عصاره هیدروالکلی میوه خارخسک باعث افزایش اثر بازدارندگی رشد بر روی رده­های سلول­هایLNCaP  شده است و عصاره موجود بر روی سلول­های فیبروبلاست اثر کمتری داشته است. در تحقیق Ashour (35) در مصر  صورت گرفت با کمک تست radical DPPH  اثبات شد که قسمت‫های هوایی گیاه blepharis edulis خاصیت آنتی اکسیدانتی و ضد سرطانی دارند و همچنین نتایج حاصل از تحقیق Mahboubi و همکاران (36) در ایران نشان داد گیاه  blepharis edulisیا خارسنبل بومی ایران در قسمت‫ های هوایی این گیاه ترکیبات فنولی زیادی وجود دارد که این ترکیبات دارای خواص آنتی اکسیدانتی و ضد میکروبی هستند، نتایج این تحقیقات یه‫همراه نتایج حاصل از این تحقیق دال بر این مطلب است که عصاره گیاه خارسنبل دارای خواص آنتی اکسیدانتی و ضد سرطانی است. در این مطالعه بیان ژن BCL2 با کمک Realtime-PCR  نیز مورد سنجش قرار گرفت و نتایج نشان داد بیان این پروتین به‫صورت معنی­داری تحت تیمار عصاره 25/1 میلی‫گرم بر میلی‫لیتر در مدت 24 و 48 ساعت کاهش یافته است. این نشان دهنده این است که عصاره هیدروالکلی تاثیر بر روی مسیر آپوپتوزیسی گذاشته است. احمدی و همکاران (37) تاثیر عصاره هیدروالکلی برگ گیاه سدر (Ziziphus spina-christi) بر زنده­مانیMCF7  و بیان ژن­های BAX و BCL2 مورد بررسی قرار دادند. نتایج  به این شکل بود که با افزایش غلظت عصاره زنده­مانی سلولی نسبت به کنترل کاهش معنی­داری پیدا کرد و همچنین در غلظت 1/0 میلی­گرم بر میلی‫لیتر عصاره گیاه، بیان ژن BCL2 دچار کاهش معنی­داری (01/0p<) شده است. از عوامل دیگری که می­تواند در کاهش بیان BCL2موثر باشد ساپونین است، ساپونین به‫عنوان یک متابولیت ثانویه می­تواند یک عامل موثر در آپوپتوزیس سلول­های سرطانی و کاهش دهنده بیان ژن BCL2باشد (38). نتایج این تحقیق نیز نشان داد که عصاره هیدروالکلی این گیاه کاهش دهنده بیان BCL2 است که می­توان به‫دلیل وجود ساپونین در این گیاه نسبت داد. نتایج حاصل از دستگاه فلوسایتومتری نشان­دهنده همین مطلب بود که سلول­های سرطانی رو به آپوپتوزیس آورده­اند و عصاره حاصل بر روی مسیر آپوپتوزیس سلول­های سرطانی سینه و پروستات تاثیر داشته است.

 

نتیجه گیری

 نتایج این تحقیق حاکی از اثر بالقوه عصاره عصاره هیدروالکلی بذر گیاه خارسنبل بر بیان ژن BCL2 در سلول‌های سرطانی پستان و پروستات انسان و ارتباط آن با مهار رشد سلول‌های سرطانی است. با توجه به آن در مرحله بعدی کار با جداسازی ماده موثره این گیاه و تحقیقات تکمیلی می­توان به‫عنوان یک ترکیب موثر در درمان سرطان معرفی شود. نتایج همچنین نشان داد عصاره این گیاه بر روی مسیر آپوپتوزیس تاثیر دارد با تحقیقات تکمیلی از جمله بررسی بیان ژن­های دیگری که در مسیر آپوپتوزیس درگیر هستند و می­تواند به‫طور دقیق­تری پاسخگو این مطلب باشد که عصاره حاصل به‫عنوان ترکیبی موثر برای درمان سرطان سینه و پروستات  مورد استفاده قرار گیرد.

 

تشکر و قدردانی

این مقاله از پایان­ نامه دوره دکترای رشته بیوتکنولوژی کشاورزی مصوب در دانشکده کشاورزی دانشگاه گیلان استخراج شده است. از مسئولین آزمایشگاه ژنتیک و بیوتکنولوزی دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته کرمان جهت قرار دادن امکانات و وسایل آزمایشگاهی و آقایان دکتر علی درخشانی­، دکتر فیروز جنت علی پور که ما را در انجام و ارتقاء کیفی این پژوهش یاری دادند، صمیمانه تشکر و قدردانی می شود.

1. Deka SJ, Mamdi N, Manna D, Trivedi V. Alkyl Cinnamates Induce Protein Kinase C Translocation and Anticancer Activity against Breast cancer cells through Induction of the Mitochondrial Pathway of Apoptosis. J Breast Cancer. 2016; 19(4): 358-371.
2. Ferlay J, Soerjomataram I, Dikshit R, Eser S, et al. Cancer incidence  and  mortality  worldwide:  sources,  methods  and major patterns in GLOBOCAN. Int J Cancer .2015; 136(5): 359-386.
3. Mousavi  SM,  Gouya  MM,  Ramazani  R,  Davanlou  M , et al.  Cancer incidence and mortality in Iran. Ann  Oncol. 2009; 20(3): 556-563.
4. Salehi F, Mohsenzadeh F, Aefi M. Prevalence of anxiety of death in patients with breast cancer in Kermanshah , 2015. Ir Jof Breast Dis. 2015; 8(4): 36-40.
5. Kruk J, Aboul-Enein Hy. Psychological stress and the Risk of breast cancer: A case-control study. Cancer Detect Prev. 2004; 28(6): 399-408.
6. Jamshidinaeeni Y, Davoodi H, Esmaeili S. Effects of Vitamin D on risk of breast cancer. Iran J Nutr Sci Food Technol. 2013; 7(4)(27): 53-62.
7. Jemal A, Murray T, Ward E, Samuls A, et al. Cancer statistics . CA cancer J. Clin. 2005; 55(1): 10-30.
8. Moheghi N, Afshari JT, Brook A. The Cytotoxic Effect of Zingiber Afficinale in Breast Cancer (MCF7) Cell line. J Ofogh Danesh. 2011; 17(3): 28-34.
9. Chikezie O. Madu and Yi Lu.Novel diagnostic biomarkers for prostate cancer. J cancer. 2010; 1(1):150-177.
10. DeMarzo AM, Nelson WG, Isaacs WB, Epstein JI. Pathological and molecular aspects of prostate cancer .Lancet .2003; 361; 955-964.
11. Shingo A, Hidewaki N, Toyomasa K. Molecular Features of the Transition from prostatic  Intraepithelial Neoplasia (PIN) tp prostate cancer: Genome-wide Gene- expression Profiles of Prostate cancers and PINs. Cancer Res. 2004; 64(17): 5963-72.
12. Glause A, Muller S. Hemoglobin and fatigue in cancer patients in separable twice. Sohweiz Med Wochenschr  .2000; 130(13): 471-477.
13. Hyun  lee. Fatigue  and  hope: Relationships  to Psychosocial adjustment in Korean woman with breast cancer. Appl Nurs Res. 2001; 14(2): 87-93.
14. Kajstura  J,  Cheng  W,  Sarangarajan  R,  Lim  P, et al. Necrotic and apoptotic  myocyte cell  death  in  the  aging  heart  of  Fischer  344 rats. Am. J. Physiol. 1996; 271 (3 Pt 2): 1215-1228.
15. Frias  MA,  Somers  S,  Gerber-Wicht  C,  Opie  LH, et al.  The  PGE2-Stat3  interaction  in  doxorubicin-induced  myocardial apoptosis. Cardiovasc. Res. 2008;  80 (1): 69-77.
16. Thorn  CF,  Oshiro  C,  Marsh  S,  et  al. Doxorubicin  pathways: pharmacodynamics  and  adverse  effects.  Pharmacogenetics  Genomics. 2011; 21(7): 440-6.
17. Cruet Hennequart S, Prendergast ÁM, Shaw G, Barry FP, et al. Doxorubicin induces the DNA damage response in cultured human mesenchymal stem cells. International journal of hematology. 2012; 96(5): 649-656.‏
18. Cory S, Adams, JM, The Bcl2 family: regulators of the cellular life-or-death switch, Nature Reviews Cancer. 2002; 2(9): 647-656.
 
19. Gross A, McDonnell JM, Korsmeyer S J. BCL-2 family members and the mitochondria in apoptosis, Genes & development. 1999; 13(15): 1899-1911
20. Green DR, Kroemer G.The pathophysiology of mitochondrial cell death.Science Signalling. 2004; 305: (5684): 626.
21. Kaufmann  B, Christen P, Veuthey JL. Parameters  affecting  microwave-assisted extraction of withanolides. Phytochemical Analysis. 2002; 12(5): 327–331.
22. Mozffarian V. A Dictionary of Iranian Plant names.Farhang Moaser. Tehran, Iran.1996; p. 172.
23. Gutterman Y. Delayed seed dispersal and rapid germination  as  survival  mechanisms of  the desert  plant Blepharis persica (Burm.) Kuntze. Oecologia.1972; 10(2): 145-149.
24. Mir Heydar H. Plant Education.Office of the Publishing Islamic Culture . Tehran, Vol. 8. 2006. 8 (3): 21-4.
25. Khacha-ananda S, Tragoolpua Kh, Chantawannakul p, Tragoolpua Y. Antioxidant and Anti-cancer Cell Proliferation Activity of  Propolis Extracts from Two Extraction Methods. A PJC. 2013; 14: 6991-6995.
26. Hairrchi I, Kolahdoozan S, Karbakhsh M, Chegini N, et al. Twenty years o breast cancer in Iran : downstaging without a formal screening program. Ann Oncol. 2011 ; 22(1): 93-97.
27. Jemal  A,  Siegel  R,Ward  E,  Murray  T, et al.  Cancer  statistics.  CA  Cancer  J Clin. 2006; 56(2): 106-30.
28. Shukla  Y,  Singh  M.  Cancer  preventive properties of ginger: a brief review. Food Chem Toxico. 2007; 45(5): 683-690.
29. Montoro  P, Baraca  A, Pizza  C, De Tommasi N. Structure antioxidant activity realionships of flavonoids isolated from different plants species. Food chemistry. 2005; 92: 249-355.
30. Lacaille-Dubois M.A, Wagner H. Bioactive  saponins from plants: an update. In:Studies in natural Products Chemistry. Rahman A.U.(ed). Elsevier, Amsterdam; 2000;  21: 633-687.
31. Hostettmann K, Marston A Chemistry and pharmacology of natural product : saponins. Cambridge University Press, UK. 1995 :286.
32. Baskar AA, KhalidS. Al, Mohammed A, et al. In vitro antioxidant and antiproliferative potential of medicinal plants used in traditional Indianmedicine to treat cancer. Redox Report. 2012; 17(4): 145- 156 .
33. Hamta A, Parvini P. Study of Cytotoxic Effects of Taxol and Rosemary Extracts on Cancerous  Cells Derived From DMBA-induced Breast Cancer in SD Rats. Journal of Cell & Tissue. 2011; 2(2) : 117-126.
34. Pourali M, Yaghoobi MM,  Salehii MH. Cytotoxic, Anti-Proliferative and Apoptotic Effects of Tribulus terrestris L. Fruit Extract on Human Prostate Cancer Lncap and Colon Cancer HT-29 Cell Lines. Jundishapur J Nat Pharm Prod. 2017; 12(2): e33561.
35. Ashour MAG. Isolation, HPLC/UV characterization and antioxidant activity of phenylethanoids from Blepharis edulis (Forssk.)Pers. growing in Egypt. Bulletin of Faculty of Pharmacy, Cairo University. 2012; 50(1): 67-72.
36. Mahboubi M, Haghi GH ,Kazempour N, Hatemi AR. Total phenolic content, ntioxidant and antimicrobial activities of Blepharis edulis extracts. Songklanakarin J. Sci. Technol. 2013; 35(1): 11-16.
37. Ahmadi R, Rahimi S, Ehteshamzad N. The effect of hydroalcoholic Ziziphus spina-christi leaf extract on viability  of breast cancer cell line (MCF7) and evaluation of Bax and Bcl2 genes expression level. Feyz, Journal of Kashan University of Medical Sciences. 2017; 21(5): 407-413.
38. Dikavsakaya D, Schiffmam D , Lan  P. Loss of  APC  incidence  polypoidy  as  a  results  of  a combination  of  defects  in  mitosis  and  apoptosis. Journal of Cell Biol. 2007; 176(2): 183-195.