تمایز اسکلروتومی سلول‮های سومایتی هم‏کشتی داده شده با نوتوکورد جنین جوجه

نوع مقاله: علمی - پژوهشی

نویسندگان

1 گروه علوم بیوشیمی و تغذیه، دانشکده پزشکی، دانشگاه علوم پزشکی اردبیل، اردبیل، ایران

2 آزمایشگاه تحقیقاتی جنین‮شناسی و سلول‮های بنیادی، گروه علوم تشریحی و پاتولوژی، دانشکده پزشکی، دانشگاه علوم پزشکی اردبیل، اردبیل، ایران

-

چکیده

هدف: سومایتها تودههای اپیتلیالی از سلولهای مزودرمی هستند که به اسکلروتوم و درمومیوتوم تمایز مییابند و نوتوکورد یا مزودرم محوری در تمایز سلولهای سومایتی به اسکلروتوم نقش دارد. هدف از این مطالعه بررسی نقش نوتوکورد در تمایز اسکلروتومی سومایتها در محیط آزمایشگاهی بود.  مواد و روش‏ها : در این مطالعه تجربی، پس از جدا سازی سومایت‏ها و نوتوکورد از جنین جوجه و قرار دادن نوتوکورد ها در قطرات آلژینات، آنها با سومایتها بهمدت شش روز در محیط آزمایشگاهی همکشتی داده شدند. در گروه بدون هم کشتی نیز سومایتها بدون حضور نوتوکورد کشت داده شدند. سومایت‏های تازه جدا شده وکشت داده نشده نیز بهعنوان سومایتهای روز صفر در نظر گرفته شدند. در نهایت مورفولوژی سلولهای سومایتی کشت داده شده  با میکروسکوپ اینورت مورد ارزیابی قرار گرفت و  سپس با روش RT-PCR بیان ژنهای تمایزی اسکلروتومی و درمومیوتومی در سلولهای سومایتی کشت داده شده بررسی شد. نتایج : در مقایسه با گروه کنترل، سلولهای سومایتی به‏دنبال هم کشتی با نوتوکورد پتانسیل تمایز بهتری داشتند و مورفولوژی سلولهای مزانشیمی با زوائد متعدد و باریک را نشان دادند. پروفایل بیان ژنی نیز حاکی از بیان ژنهای Pax1  و BMP4 و بیان ضعیف MyoD در سلولهای سومایتی به‏دنبال هم کشتی با نوتوکورد بود که از ویژگیهای تمایز به سلولهای اسکلروتومی محسوب میشود. نتیجه گیری: نوتوکورد رویانی در محیط آزمایشگاهی بهدنبال افزایش بیان ژنهای دخیل در تمایز اسکلروتوم سبب القای این تمایز در سومایتها میگردد.

کلیدواژه‌ها


مقدمه

مزودرم پاراگزیال رویان در حد فاصل بین لوله عصبی و نوتوکورد در سمت داخل و مزودرم بینابینی و مزودرم صفحه جانبی در سمت خارج قرار دارد. بخش سری این مزودرم به سومایتومر تبدیل میشود در حالیکه در بخش دمی به مزودرم پیشسومایتی و سومایت تمایز مییابد (1). سومایت‌ها بهصورت تودههایی از بافتهای اپیتلیالی هستند که حول محور سری –دمی رویان از بخش سری مزودرم پیش سومایتی با فواصل منظم نسبت به هم جوانه میزنند (2). 

بافتهای اطراف سومایت در تشکیل، تکثیر، تمایز و نیز حفظ و بقای سلولهای سومایتی نقش حیاتی ایفا میکنند (3،4 و5). در پی یک‏سری تعاملات سلولی با بافتهای اطراف، سلولهای سومایتی از حالت اپی‏تلیالی تغییر حالت داده و قسمت شکمی داخلی آنها به سلولهای اسکلروتومی تمایز مییابد که در نهایت به غضروف و استخوان تبدیل میشوند. قسمت پشتی طرفی سومایت‌ها نیز با ایجاد درمومیوتوم عضلات و پوست بدن را میسازد (3 و 6).

نوتوکورد نیز یک ساختار مزودرمی متشکل از سلولهای بزرگ با غلاف خارج سلولی ضخیم است که در زیر لوله عصبی قرار دارد (7) و در مهره داران عالی دو نقش مهم بر عهده دارد. اولین نقش آن با توجه به مکان قرار گرفتن نوتوکورد در خط میانی پشتی رویان مهرهداران، ترشح فاکتورهایی است که بر روی همه بافتهای اطراف از جمله لوله عصبی (8) و سومایت اثر گذاشته و در تعیین سرنوشت، بقا و مهاجرت سلولهای تشکیل دهنده این بافتها نقش دارد (12-9). دومین وظیفه نوتوکورد نیز نقش مهم ساختاری آن است که در نهایت به دیسک بین مهره تمایز مییابد (13).

تحقیقات نشان میدهند که وجود لوله عصبی و نوتوکورد برای تکوین طبیعی مهرهداران ضروری بوده و این بافتها نقش حیاتی را در الگویابی و تکثیر و بقای سلول های سومایتی ایفا می کنند (14، 15 و 16). نوتوکورد با رهایی برخی از فاکتورها مانند Noggin و Sonic Hedge Hog (SHH) (3) و نیز لوله عصبی با آزاد سازی عواملی مانند Bone Morphogenetic Protein 4 (BMP4) و Wnt و Neurotrophin 3 (NT-3) باعث تمایز ردههای سلولی سومایتی می‌شوند (17 و 18). SHH مترشحه از نوتوکورد مانع از انتشار سیگنال‌هایی می‌گردد که موجب القا پشتی شدن در قسمت شکمی سومایت میشوند و بدین شکل از گسترش ناحیه درمومیوتوم به ناحیه اسکلروتوم جلوگیری می‌کند (19، 20، 21). از طرفی نوتوکورد توانایی القا بیان Pax1‌ را در بخش شکمی داخلی سومایت بهطور مستقیم از طریق SHH دارند (22).

مثال فوق نمونهای از واکنشهای القایی در رویان است که در آن سیگنالهایی از یک گروه سلولی روی گروه سلولی مجاور تاثیر گذاشته و باعث حفظ حیات، تکثیر و تمایز ‌آنها می‌شود. لذا شناخت دقیق بیولوژی سلولهای بدن و نحوه تکوین و تمایز آنها و نیز چگونگی پاسخدهی آنها به عوامل درونی و بیرونی شرایطی را فراهم کرده است که میتوان در سلول درمانی و نیز بررسی فرآیندهای مرگ سلولی و سمیت سلولی از آنها بهره جست. از همین رو دسترسی به مدلهای سلولی مناسب نخستین گام در جهت مطالعه فرایند های فوق الذکر در محیط آزمایشگاهی میباشد.

برای این منظور، سیستمهای هم‌کشتی روش مناسبی برای مطالعه تعاملات موجود بین بافتهای متفاوت هستند و در این راستا محققان زیادی از این روش در تحقیقات خود استفاده کردهاند (23، 24 و 25). لذا با توجه به قدرت سیگنال دهی نوتوکورد در شرایط هم کشتی با سلولهای مختلف از جمله سلولهای بنیادی رویانی (26 و 27) و از آنجاییکه این ارگان مجاورت نزدیکی در بدن رویان  با سومایتها دارد، در این مطالعه اثرات نوتوکورد در تمایز اسکلروتومی سلولهای سومایتی در محیط آزمایشگاهی با استفاده از روش همکشتی مورد بررسی قرار گرفت.

 

موادوروش‏ها

جداسازیسومایتاز جنین جوجه: تخم مرغهای نطفهدار از مرغداریهای اطراف اردبیل تهیه شدند و در 5/37 تا 5/38 درجه سانتی گراد و رطوبت نسبی 50 تا 60  درصد نگهداری شدند تا جنینهای جوجه مطابق با جدول تکوینی هامبورگر – هامیلتون (28) به‏مرحله 10 تا 12 سومایتی برسند. سپس جنینها از سطح زرده جدا شده و در محیط کشت Leibovitz's (L15) قرار داده شدند. برای جداسازی راحتتر سومایتها ، جنینها به مدت2 تا 3 دقیقه در آنزیم  Dispase با غلظت 5/0 میلیگرم بر میلیلیتر قرار داده شدند و پس از خنثی شدن اثر آنزیم توسط سرم جنینی گاو (FBS) سومایتها و نوتوکورد در زیر استریومیکروسکوپ به کمک سوزنهای انسولینی از جنین جوجه جدا شدند.

تهیهدانههایآلژینات حاوی نوتوکورد: برای جلوگیری از ادغام با سومایتها، نوتوکوردهای جدا شده در داخل قطرات آلژینات قرار داده میشوند. برای تهیه این قطرات، بهکمک محلول 15/0 مولار  NaCl محلول 2/1 درصد از پودر آلژینات تهیه شد. پس از دو بار شستشوی سومایتها در PBS فاقد کلسیم و منیزیم، قطرات  15 تا 20 میکرولیتری از محلول آلژینات حاوی نوتوکورد (دانه های آلژینات) به مدت 15 دقیقه در محلول 102 مولار  CaCl2 قرار داده شدند. در نهایت این دانهها 2 بار در محلول 15/0 مولار  NaCl شستشو داده شدند.

همکشتیسلولهای سومایتی و نوتوکورد: سومایتها و قطرات آلژینات حاوی نوتوکورد در دمای 37 درجه سانتیگراد و 5 درصد 2OC در محیط کشت DMEM/F12GLutaMax + 10% FBS ، 1 میلیمولار اسیدآمینه غیرضروری، 1میلی مولار پنیسیلین و استرپتومایسین، 1/0 میلیمولار بتا –مرکاپتواتانل در دو گروه سومایت همراه با نوتوکورد و سومایت بدون نوتوکورد به مدت  6 روز کشت داده شدند. سومایتهای تازه جدا شده نیز بهعنوان کنترل روز صفر در نظر گرفته شدند.

RT-PCR: RNA توتال سلولهای سومایتی همه گروهها با استفاده از محلول Trizol استخراج شد. سپس مطابق با دستورالعمل سازنده superscript II RNase H- reverse transcriptase  1 میکروگرم از RNA توتال برای سنتز cDNA در دمای 42 درجه به مدت 1 ساعت در حجم نهایی 02 میکرولیتر مورد استفاده قرار گرفت. فهرست و توالی پرایمر‏ها در جدول 1 آورده شده است. محصولات PCR بر روی ژلهای آگاروز 2/1 درصد حاوی اتیدیوم بروماید )5/0 میکروگرم بر میلیلیتر) الکتروفورز شدند و باند ایجاد شده به کمک نور UV مشاهده شد.

 

جدول 1: فهرست و توالیهای پرایمرهای مورد استفاده.

Primer Sequence (5΄→ 3΄)

Gene

F: AGTCATCCCTGAGCTGAATG

R: AGGATCAAGTCCACAACACG

GAPDH

F: GCGTCGCAGCAGGACAACCT

R: GCGCTGGGTGGAAACCCTCC

Pax3

F: GACCGGCAGGAAGAAAGTCG

R: GCACGCTGCTGCTGAGGTTGAAG

BMP4

F: GCTGGGTGGTGTCTTCGTGAAC

R: ACTGGTAAAGGGGGTTGTAGGG

Pax1

F:ACTACACGGAATCACCAAATGACC

R: AAGGAATCTGGGCTCCACTGTC

MyoD

F: Forward                           R: Reverse

 

نتایج

نتایج مشاهدات مورفولوژیکی

بعد از استخراج جنین جوجه در مراحل 10 تا 12 سومایتی از سطح زرده (شکل A1) و جداسازی نوتوکورد (شکل B1) و سومایت از آن (شکل C1)، سومایت‏ها در  ظروف حاوی محیط کشت قرار داده شدند (شکل A2). بررسیهای مورفولوژیکی در گروههای مورد مطالعه نشان داد که سلولهای سومایتی پس از دو روز کشت با نوتوکورد و نیز بدون حضور نوتوکورد از گوشههای سومایت شروع به رشد و تکثیر نموده (شکل E و B2) و پس از شش روز کشت توانستند بهصورت سلولهایی با ظاهر سلولهای مزانشیمی تمایز یابند؛ اگرچه تعداد این سلولها در گروه بدون هم کشتی کمتر بود (شکل F و C2). از طرف دیگر، مطابق با شکلD2 سلـولهـای مـزانشیمی از یک جسم سلـولی

نسبتا پهن و کوچک با زوائد متعدد و باریک برخوردار بودند.    

 

شکل 1: تصویر میکروسکوپ فاز کنتراست از جنین جوجه در مرحله 10 سومایتی (A) و نوتوکورد (B) و سومایتهای جدا شده از این جنین )C(.Bar= 100 µm

 

 

شکل 2: گسترش و تمایز سلولهای سومایتی. A) سومایت جدا شده از بدن جنین جوجه، B) گسترش سلولهای سومایتی پس از دو روز هم کشتی با نوتوکورد،C( مورفولوژی سلولهای سومایتی پس از شش روز هم کشتی. D( فتومیکروگراف با بزرگنمایی بیشتر از سلولهای مزانشیمی حاصل از تمایز سلولهای سومایتی، E( سلولهای سومایتی پس از دو روز کشت در گروه بدون هم کشتی و F( تمایز آنها پس از شش روز کشت.  Bar= 100 µm

 

نتایج RT-PCR

با روش RT-PCR بیان ژنهای GAPDH ، Pax3 ، BMP4، Pax1 و MyoD در گروه سومایتهای تازه جدا شده (سومایت روز صفر)، گروه سومایت بدون هم کشتی با نوتوکورد و گروه سومایت هم کشتی داده شده با نوتوکورد پس از 6 روز کشت مورد بررسی قرار گرفتند (شکل 3). نتایج RT-PCR نشان داد که Pax3  که نشانگر قسمت درمومیوتوم سومایت‌ها می‌باشد در هر سه گروه فوق الذکر بیان قابل توجهی داشت اما در گروه بدون هم کشتی بیان آن کمی شدیدتر بهنظر میرسید درحالیکه Pax1 که نشانگر قسمت اسکلروتوم سومایت است. در گروه سومایت همراه با نوتوکورد بیان بیشتری را نسبت به سایر گروهها نشان داد. MyoD  نیز که نشانگر قسمت میوتومی سومایت‌ها می‌باشد در سومایتهای تازه جدا شده از شدت بیان بیشتری برخوردار بود. هرچند بیان این ژن در گروه سومایت بدون نوتوکورد کاهش یافته بود ولی کمترین بیان این ژن در گروه سومایت همراه با نوتوکورد مشاهده شد. از طرف دیگر، ژن BMP4 در گروه سومایت همراه با نوتوکورد بیشترین بیان را داشته و بعد از آن در گروه سومایت بدون نوتوکورد و به‏میزان کمتر در سومایت‌های روز صفر بیان شده بود.

 

 

شکل 3: بیان ژنهای مختلف تمایز به اسکلروتوم و درمومیوتوم در گروه سومایتهای تازه جدا شده از جنین جوجه (روز صفر) و گروههای سلولهای سومایتی پس از شش روز هم کشتی با نوتوکورد (Som + Notو بدون نوتوکورد (Som). =MyoD نشانگر تمایز میوتومی، =BMP4 , Pax1 نشانگرهای تمایز اسکلروتومی، =Pax3 نشانگر تمایز درمومیوتوم،  =GAPDH ژن خانگی

 

بحث

حضور بافتهای اطراف سومایت برای حفظ بقا سلولهای سومایتی و همچنین الگویابی آنها لازم و ضروری می‌باشد (3، 4 و 5) و سومایتها پس از شکلگیری در طرفین لوله عصبی تحت تاثیر بافتهای اطرافشان به سلولهای مزانشیمی اسکلروتومی و درمومیوتومی تمایز مییابند (3 و 6). همچنین مشخص شده است که در صورت عدم حضور ارگانهای میانی رویان (نوتوکورد و لوله عصبی) اغلب ردههای سلولی حاصل از سومایت‌ها دچار آپوپتوزیس میشوند ولی بهدنبال پیوند زدن این ارگانها به سلولهای سومایتی میزان مرگ سلولی در آنها کاهش می‌یابد (41 و 51). یافتههای مورفولوژیک مطالعه حاضر نیز نشان دادند که در گروه سومایت همراه با نوتوکورد تمایز سلولها به سمت مزانشیمی شدن بوده و سلولهایی با زوائد باریک و متعددی شکل گرفتند. همچنین اجسام آپوپتوتیک کمتری در این گروه نسبت به گروه فاقد نوتوکورد مشاهده شد.

مشخص شده است که حضور نوتوکورد و SHH نقش اساسی در القا و شکلگیری سلولهای اسکلروتومی دارد (22،92 و 03). Pax1 و Pax9 بهطور وسیعی در سلولهای اسکلروتومی بیان می‌شوند درحالیکه در قسمت میوتوم بیان نشانگر MyoD و در قسمت درمومیوتوم بیان ژن Pax3 را خواهیم داشت (6 و31). ژن‌های Pax1 و MyoD در حضور نوتوکورد و لوله عصبی بیان شده و باعث تمایز ردههای سلولی سومایتی می‌شود (22 و 92). با اینحال، SHH  مترشحه از نوتوکورد مانع از انتشار سیگنال‌هایی می‌گردد که موجب القا پشتی شدن در قسمت شکمی سومایت میشوند و بدینشکل از گسترش ناحیه درمومیوتوم به ناحیه اسکلروتوم جلوگیری می‌کند (91، 02 و 12).

نتایج RT-PCR تحقیق حاضر نیز نشان داد که بیان Pax1 در گروه سومایت همراه با نوتوکورد بهمراتب بیشتر از گروه سومایت بدون نوتوکورد و گروه سومایت روز صفر بود و این موضوع نشاندهنده آن است که سلولهای سومایتی در حضور نوتوکورد  تمایز یافته و احتمالا به اسکلروتوم تبدیل شده‌اند. این نتایج در تائید مشاهدات قبلی است که حضور نوتوکورد و SHH مترشحه از آن را برای بیان ژن Pax1 در سلولهای سومایتی و تعیین رده سلولی اسکلروتومی لازم و ضروری میداند (12 و 92). همچنین مشخص شده بود که Pax1 در مزودرم پیش سومایتی جنین جوجه و سومایتهای تازه تشکیل شده بیان بسیار ضعیفی دارد (21 و 32). لذا، بیان ضعیف Pax1 در گروه سومایتهای روز صفر تائیدی بر این یافته میباشد.

همچنین نشان داده شده است که بیان Pax3 مستقل از ساختار میانی می‌باشد و نیازی به این ارگانها ندارد (22). بنابراین در صورت عدم حضور نوتوکورد نیز Pax3 بیان بالایی خواهد داشت. Pax3 در گروه سومایت بدون نوتوکورد تا حدی بیان بیشتری نسبت به گروه سومایت همراه با نوتوکورد داشت و بهنظر میرسد که بیان کمی پایینتر Pax3 در گروه سومایت همراه با نوتوکورد مربوط به تمایز اسکلروتومی سلولها در این گروه می‌باشد.

مطالعات نشان میدهند که حضور نوتوکورد و سیگنال آن SHH برای فعال سازی ژن Pax1 کافی است اما برای فعالسازی ژنMyoD  و تعیین رده میوژنیک بهتنهایی کافی نیست بلکه برای فعال سازی آن حضور Wnt مترشحه از لوله عصبی نیز ضروری می‌باشد (61،92 و 33). دادههای ما نیز نشان داد که بیان MyoD در گروه کنترل بهمراتب بیشتر از دو گروه دیگر است و بیان این ژن در گروه سومایت بدون نوتوکورد بیشتر از سومایت همراه با نوتوکورد می‌باشد. احتمالا بیان شدید MyoD در سومایتهای روز صفر به دلیل مجاورت آنها با صفحه عصبی و بخش پشتی لوله عصبی میباشد. بیان ضعیف MyoD در سلولهای گروه همکشتی تائید دیگری بر تمایز اسکلروتومی و نه میوتومی سلولهای سومایتی بهدنبال هم کشتی با نوتوکورد است.

گرچه برخی از مطالعات بیان BMP4 در مزودرم پاراگزیال را دلیلی بر افزایش آپوپتوز در این بافت میدانند (34) ولی گروهی از محققین بر این باورند که فزایش بیان BMP4 مربوط به تمایز سلول ها به سمت غضروفی شدن می‌باشد چرا که SHH میزان پاسخدهی به BMP4 را در سلولهای اسکلروتومی افزایش می‌دهد و موجب افزایش بیان BMP4 می‌شود (6). یافتههای ما نیز بیان بیشتر BMP4 را در گروه هم کشتی با نوتوکورد نشان داد و این توجیه دیگری بر تمایز اسکلروتومی سلولهای سومایتی بهدنبال هم کشتی با نوتوکورد می تواند باشد.

 

نتیجه گیری

در مجموع این مطالعه نشان میدهد که بهدنبال هم کشتی با نوتوکورد سلولهای سومایتی توانستند تمایز یافته  و مورفولوژی سلولهای مزانشیمی با مشخصات سلولهای اسکلروتومی یعنی بیـان ژنهـایPax1  و BMP4 و بیـان ضعیف MyoD را پیـدا

کنند که از ویژگیهای تمایز به سلولهای میوتومی است.

 

تشکر و قدردانی

این مطالعه با استفاده از منابع مالی دانشگاه علوم پزشکی و خدمات درمانی اردبیل انجام شده است و نویسندگان مقاله بدین وسیله مراتب تقدیر و تشکر خود را از معاونت پژوهشی این دانشگاه بهعمل میآورند

  1. Stockdale FE, Nikovits WJr, Christ B. Molecular and cellular biology of avian somite development. Dev Dyn. 2000; 219: 304-21.
  2. Pourquie O. Vertebrate somitogenesis: A novel paradigm for animal segmentation? Int J Dev Bio. 2003; 47(7-8): 597-603.
  3. Hirsinger E, Jouve C, Malapert P, Pourquie O. Role of growth factors in shaping the developing somite. Mol Cell Endocrinol. 1998; 140:83-7.
  4. Gilbert ,S. Developmental biology. 9th Ed.: sinauer associates, Inc. 2010.
  5. Bothe I, Ahmed MU, Winterbottom FL, von Scheven G, et al.Extrinsic versus intrinsic cues in avian paraxial mesoderm patterning and differentiation. Dev Dyn. 2007; 236(9): 2397-2409.
  6. Murtaugh LC, Chyung JH, Lassar A. Sonic hedgehog promotes somatic chondroogensis by altering the cellular response to BMP signaling. Gen Dev. 1999; 13: 225-237.
  7. Stemple DL. Structure and function of the notochord: an essential organ for chordate development. Development. 2005; 132: 2503-2512.
  8. Placzek M, Dodd J, Jessel TM. The case for floor plate induction by the notochord. Curr Opin Neurobiol. 2000; 10(1): 15-22.
  9. Hassanzadeh Taheri MM, Nikravesh MR, Djalali M, Fazel AR, et al. Distribution of specific glycoconjugates in early mouse embryonic notochord and paraxial mesenchyme. Ir Biom J. 2005; 9(1): 21-26
10. Dockter JL. Sclerotome induction and differentiation. Curr Top Biol. 2000; 48:77-127.

11. Fan CM, Lavigne LM. Patterning of mammalian somites by surface ectoderm and notochord: evidence for sclerotome induction by a hedgehog homolog. Cell. 1994; 79: 1175-1186.

12. Christ B, Huang R, Wilting J. The development of the avian vertebral column. Anat Embryol. 2000; 202: 179-194.

13. Sachdev SW, Dietz UH, Oshima Y, Lang MR, et al. Sequence analysis of zebrafish chondromodulin-1 and expression profile in the notochord and chondrogenic regions during cartilage morphogenesis. Mech Dev. 2001; 105: 157-162.

14. Gordon M, Jay W, Frank E. Sonic hedgehog enhances somite cell viability and formation of primary slow muscle fibers in avian segmented mesoderm. Anat Embryol. 1999; 200: 239-252.

15. Asakara A, Tapscott SJ. Apoptosis of apaxial myotome in danforths Short-tail (SD) mice in somites that form following notochord degeneration. Dev Biol. 1998; 203(2): 276-289.

16. Munesterberg A, Lassar A. Combinatorial signals from the neural tube, floor plate and notochord induce myogenic bHLH gene expression in the somite. Development. 1995; 121: 651-660.

17. Loganathan PG, Nimmagadda S. Scaal M, Huang R, et al. Wnt signaling in somite development. Ann Anat. 2008; 190: 208-222.

18. Galli  LM, Willert  K,  Nusse R, Yalonka-Reuvent Z, et al. A proliferative role Wnt-3a in chick somites. Dev Biol. 2004; 269: 489-504.

19. Pourqié O, Coltey M, Teillet M-A, Ordahl C,et al. Cotrol of dorsoventral patterning of somatic derivatives by notochord and floor plate. Dev Biol. 1993; 90: 5242-4246.

20. Borycki AG, Mendham L, Emerson CPJr. Control of somite patterning by sonic hedgehog and its downstream signal response genes. Development 1998; 125: 777-79021.

21. Bumcrot DA, Mcmahon AP. Sonic signals somites. Curr Biol. 1995; 5(6): 612-614.

22. Marcelle C, Ahlegres S, Bronner M. In vivo regulation of somite differentiation and proliferation by sonic hedgehog. Dev Biol. 1999; 214: 277-287.

23. Kitazawa A, Shimizu N.  Differentiation of mouse embryonic stem cells into neurons using conditioned medium of dorsal root ganglia. J Biosci Bioeng. 2005; 100(1): 94-99.

24. Fontaine-Perus J, Jarno V, Fournier L, Ray C, et al.  Mouse chick chimera: a new model to study the in ovo developmental potentialities of mammalian somites. Development 1995; 121:1705-1718.

25. Sagha M, Karbalaie K, Tanhaee S, Esfandiari E, et al. Neural induction in mouse embryonic stem cells by co-culturing with chicken somites. Stem Cell Dev. 2009; 18(9): 1351-1359.