القا و بهینه سازی شرایط رشد ریشه‏های موئین گیاه سنبل الطیب (L. (Valeriana officinalisحاصل از تلقیح آگروباکتریوم رایزوژنز (Agrobacterium rhizogenes)

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشجوی دکتری تخصصی، دانشکده علوم ، گروه زیست شناسی، ارومیه

2 دانشکده علوم، گروه زیست شناسی، ارومیه

3 دانشکده کشاورزی، گروه اصلاح نباتات‏، ارومیه

4 دکتری فیزیولوژی گیاهی، دانشگاه فرهنگیان، پردیس فاطمه الزهرا، تبریز

-

چکیده

هدف: در این تحقیق به‏منظور بهینه‏سازی شرایط رشد ریشه‏های موئین، ریزنمونه‏های حاصل از برگ‏، ریشه و هیپوکوتیل با با‏کتری آگروباکتریوم رایزوژنز تلقیح و سپس اثر چهار محیط کشت پایه موراشیک و اسکوگ مایع با ترکیبات و دمای متفاوت بر رشد ریشه‏های موئین به‏دست آمده مورد بررسی قرار گرفت.
مواد و روش‏ها: به‏منظور القای ریشه‏های موئین از دو سویه A13 و 9534 باکتری آگروباکتریوم به دو روش اسپری و دیسک برگی استفاده شد. برای تایید تراریخت بودن ریشه‏ها و عدم آلودگی، واکنش PCR برای تکثیر اختصاصی  ژن rol-B و virD انجام شد. ریشه‏های موئین به‏دست آمده در محیط‏های کشت پایه موراشیک و اسکوگ تحت تیمار‏های مختلف در قالب طرح بلوک‏های کامل تصادفی در سه تکرار کشت شده و وزن خشک ریشه‏ها بعد از گذشت دو ماه اندازه گیری شد. 
نتایج: بعد از 8 روز ریشه‏های موئین در ریزنمونه‏های ریشه، هیپوکوتیل و برگ گیاهچه‏ها مشاهده شد. بیشترین درصد تراریختی ریزنمونه‏ها مربوط به برگ بود. نتا‏یج به‏دست آمده نشان داد که بیشترین میزان  وزن خشک  ریشه‏های موئین (19/0 گرم) مربوط به محیط کشت پایه موراشیک و اسکوگ مایع با 3 درصد ساکارز در دمای 35 درجه سانتی‏گراد و کمترین رشد (05/0 گرم) مربوط به محیط کشت MS پایه غنی شده با 2/0 گرم بر لیتر هورمون اکسین  بود.
نتیجه گیری: به‏طور کلی نتایج نشان داد که نوع ترکیبات محیط کشت و دما نقش مهمی در افزایش زیست توده کلی ریشه موئین دارند.
 

کلیدواژه‌ها


مقدمه

هزاران سال است که گیاهان از مهم‏ترین منابع درمانی محسوب می‏شوند. تقریبا یک چهارم داروهای تولید شده حاوی عصاره گیاهی یا ترکیباتی هستند که از مواد گیاهی به‏دست آمده‏اند یا براساس ترکیبات گیاهی مدل‏سازی شده‏اند (1). ازآنجا که ساخت شیمیایی ترکیبات گیاهی به‏راحتی میسر نمی‏باشد، محققان سعی برآن دارند که چنین ترکیباتی را از طریق تکنیک‏های فن‏آوری زیستی به‏دست آورند. کشت سلول‏های گیاهی دربعضی موارد موفقیت آمیز بوده است اما بزرگترین چالش دراین زمینه ناپایداری ژنتیکی، رشد کم و بازده پایین کشت سلول‏های گیاهی است (2). بنابراین برای غلبه بر این محدودیت‏ها استفاده از اگروباگتریوم رایزوژنز و کشت ریشه‏های موئین به‏علت رشد سریع، زمان دو برابر شدن کوتاه‏، سهولت نگه‏داری و توانایی سنتز گستره‏ای از ترکیبات شیمیایی مزیت‏های بیشتری را به‏عنوان یک منبع پیوسته برای تولید متابولیت های ثانویه ارزشمند ایجاد می‏نماید (3). علاوه بر این، ریشه‏های موئین یک سیستم مدل ارزشمند برای ارزیابی‏، توسعه و کاربرد اصول مهندسی ژنتیک در گیاهان هستند. ریشه‏های موئین از طریق تراریخت  نمودن سلول‏های گیاهی توسط باکتری اگروباکتریوم رایزوژنز (Agrobacterium rhizogens) تشکیل می شوند و همانند سلول‏های معمولی دارای پایداری ژنتیکی در طول دوره کشت می‏باشد (4). برای افزایش زیست توده توسط ریشه‏های موئین موارد آزمایشی مختلفی باید انجام شود‏، این موارد می‏تواند شامل: بهینه‏سازی شرایط محیط از قبیل دما، نوع ترکیبات، انتخاب لاین‏های مناسب از ریشه‏های موئین که رشد مطلوبی داشته باشند و پیدا نمودن یک نژاد اگروباکتریوم که ژنوتیپ گیاهی مورد نظر را به نحو مطلوب آلوده نماید. در تحقیق حاضر تاثیر تیمارهای مختلف برای         افزایش زیست توده ریشه‏های موئین در گیاه دارویی سنبل الطیب بررسی گردید. گیاه سنبل الطیب با نام علمی   Valeriana officinalis L. از زمان‏های گذشته به‏عنوان گیاه دارویی ارزشمند همواره مورد توجه و استفاده انسان بوده است. ریشه و ریزوم این گیاه درطب سنتی برای درمان ناراحتی‏های مختلف ازجمله اختلا‏ل‏های عصبی مانند صرع‏، بی‏خوابی، سرگیجه، تپش قلب و همچنین به‏عنوان آرام بخش استفاده می‫شود (5). Granicher و همکاران (6) برای اولین بار موفق به تولید ریشه موئین در Valeriana sambucifolia شدند. همچنین آن‏ها در تحقیق دیگری موفق شدند مشتقاتی از روغن اساسی (Essential oil) در ریشه موئین مشاهده کنند که در ریشه‏های طبیعی وجود نداشت (7). یک همبستگی قوی بین سن ریز نمونه و فراوانی تشکیل ریشه‏های موئین در گیاه گندم مشاهده شده است (8). علاوه بر موارد مذکور، در یک مطالعه سن ریز نمونه به‏عنوان یک عامل مهم در رشد هر چه بیشتر ریشه‏های موئین شناخته شده است (9). القا و بهینه‏سازی شرایط محیط کشت ریشه‏های موئین در گیاه سنبل الطیب از نظر بررسی قابلیت‏های بیوسنتزی ریشه‏های موئین آن حائز اهمیت است. همچنین با ارزیابی میزان پاسخ دهی سنبل‏الطیب به آلودگی با آگروباکتریوم رایزوژنز می‏توان از آن به‏عنوان یک مدل بالقوه برای انتقال ژن و مهندسی ژنتیک در جهت افزایش متابولیت‏های ثانویه با استفاده از محرک‏های زیستی و غیر زیستی نیز سود جست.

مواد و روش‏ها

مواد گیاهی و تهیه ریزنمونه‏ها: بذر‏های گیاه سنبل‏الطیب در پاییز 1390 از شرکت پاکان بذر اصفهان تهیه گردید. به‏منظور تسریع جوانه زنی و شکست خواب، بذرها توسط غلظت‏های مختلف جیبرلیک اسید (ppm400 ، 800 و 1600) و اسید سولفوریک (10 و 15 درصد) تیمار شدند، سپس برای استریل نمودن بذرها به‏ترتیب زیر انجام شد: 1- 60 ثانیه شستشو با اتانول 70 درصد 2- شستشو با آب مقطر استریل 3- شستشو با هیپوکلریت 5/2 درصد به مدت 10 دقیقه و 4- شستشو با آب مقطر استریل شده. در پایان بذرها به‏منظور جوانه‏زنی در محیط کشت پایه MS (10) و با مراقبت کامل در شیشه‏ها کشت شده و به اتاق رشد یا فیتوترون منتقل شدند، دمای اتاق رشد 27 درجه سانتی‏گراد و رطوبت آن 22 درصد و میزان نور آن 2000 لوکس بود. ریزنمونه‏های ریشه، هیپوکوتیل و برگ‏های لپه‏ای ازگیاهچه‏های استریل 5 هفته‏ای به‏منظور تلقیح با باکتری مورد استفاده قرار گرفتند. 

القای ریشه‏های موئین: به‏منظور القای ریشه‏های موئین در سنبل‏الطیب از دو سویه A13 و 9534 باکتری آگروباکتریوم رایزوژنز به‏دو روش دیسک برگی و اسپری استفاده شد. به‏منظور آماده سازی باکتری جهت انجام تلقیح، ابتدا یک محیط کشت باکتری LB) ) تهیه و باکتری‏ها ابتدا به‏مدت 48 ساعت و سپس یک کشت مجدد به مدت 7 ساعت تهیه شد. در همه محیط‏های کشت باکتری، 50 میلی‏گرم بر لیتر آنتی بیوتیک ریفامپیسین اضافه شد. سپس دو نوع سوسپانسیون باکتری (باکتری 48 ساعته و باکتری 7 ساعته) با هم مخلوط گردیده و به‏مدت 10 دقیقه در rpm 3600 جهت رسوب سلول‏های باکتری سانتریفوژ گردید. پس از کشت، باکتری‏ها در محیط کشت MS مایع حاوی  100 میکرولیتر بر لیتر استوسرینگان (Acetosringon) به‏طور کامل حل و در یک ارلن 100 میلی‏لیتر ریخته شد. این محلول به مدت 2 ساعت در یک شیکر انکوباتور در دمای 28 درجه سانتی‏گراد درrpm  100 قرار گرفت. در روش دیسک برگی ریزنمونه‏های ریشه، هیپوکوتیل و برگ‏های لپه‏ای در اندازه‏های 5/0 تا 1 سانتی‏متر تهیه و در محلول‏های سوسپانسیون باکتری غوطه‏ور و به شیکر انکوباتور منتقل و در دمای 26 درجه سانتی‏گراد در rpm80 به مدت 30 دقیقه تکان داده شد. همچنین در روش اسپری، محلول سوسپانسیون باکتری به‏وسیله سرنگ استریل شده بر روی ریزنمونه‏ها پاشیده شد. در مرحله بعد برای هم کشتی، ریز نمونه‏ها به  محیط کشت پایه MS منتقل شدند.  بعد از گذشت 48 ساعت در روش دیسک برگی و 72 ساعت در روش اسپری ریزنمونه‏ها به‏منظور حذف باکتری به محیط کشت MS مایع حاوی 500 میلی‏گرم بر لیتر آنتی بیوتیک سفاتاکسیم (Cefotaxime) انتقال یافتند و به‏مدت 2 ساعت در شیکر انکوباتور در دمای 25 درجه سانتی‏گراد باrpm80 شستشو داده شدند. سپس ریز نمونه‏های شستشو شده، تحت شرایط استریل در یک محیط کشت MS جامد حاوی 500 میلی‏گرم بر لیتر آنتی بیوتیک سفاتاکسیم کشت شدند. عمل انتقال، چند مرتبه تا حذف شدن کامل باکتری تکرار شد.

آنالیز مولکولی ریشه‏ها از طریق واکنش زنجیره ای پلیمراز( PCR) : استخراج DNA ژنومی ریشه‏های موئین و طبیعی به‏روش CTAB انجام شد (11). برای تایید تراریختی ریشه‏های موئین و عدم آلودگی آن‏ها واکنش زنجیره‏ای پلیمراز برای تکثیر قطعه‏ای از ژن rolB  و  virDانجام شد. به این منظور از توالی‏های آغازگر اختصاصی ژن virB  و virD به‏ترتیب زیر استفاده شد.

5'-GTTCTCGCGAGAAGATGCA -3'

5'-CAGTTTCGCATCTTGACAG-3'

5'- ATGCCCGATCGAGCTCAAGT -3'  

5'-CCTGACCCAAACATCTCGGCT-3'

همچنین از پلاسمید القاکننده ریشه‏های موئین (Ri) باکتری آگروباکتریوم سویه  A13  بهعنوان کنترل مثبت استفاده گردید. شرایط دمای PCR شامل واسرشته سازی اولیه DNA بهمدت 5 دقیقه در 94 درجه سانتی‏گراد، واسرشته سازی DNA الگو به مدت 1 دقیقه در 94 درجه سانتی‏گراد، اتصال آغازگر به DNA تک رشته‏ای به‏مدت 80 ثانیه در 56 درجه سانتی‏گراد و بسط آغازگر توسط آنزیم Taq polymerase90 ثانیه در  72 درجه سانتی‏گراد و بسط نهایی 10 دقیقه در 72 درجه سانتی‏گراد انجام شد. برای بررسی تولیدات تکثیر شده، از الکتروفورز افقی (Bio- Rad) با ژل آگاروز 1 درصد حاوی Ethidium bromide (غلظت 5/0 میکرو‏گرم بر میلی‏لیتر) به‏مدت یک ساعت و 20 ثانیه با ولتاژ ثابت 80  ولت  استفاده گردید. سپس از  ژل حاصله توسط نور UV با استفاده از دستگاه ژل داکیومنت (2000Gel doc) عکس‏برداری صورت گرفت.

بررسی اثر تیمارهای مختلف بر میزان رشد ریشه‏های موئین: 8 روز پس از ظهور اولین ریشه‏ها از ریزنمونه‏های گیاه سنبل‏الطیب درصد ریزنمونه‏های هر سه نوع بافت که موفق به تولید ریشه موئین شدند نسبت به کل ریزنمونه‏های مورد آزمایش به‏طور جداگانه محاسبه گردید. از آنجا که هر ریشه موئین محصول یک سلول تراریخته در یک ریزنمونه (لاین) می‏باشد، بنابراین هر ریشه موئین را می‏توان یک کلون در نظر گرفت. براین اساس در تحقیق حاضر حدود 9 کلون از هر ریزنمونه برگ، هیپوکوتیل و ریشه انتخاب و پس از قطع از محل رویش به ارلن های 100 میلی‏لیتر حاوی 15 میلی‏لیتر MS مایع منتقل شدند. ریشه‏های موئین حاصل از رشد کلون‏ها پس از 4 هفته و 4 مرحله واکشت وزن کشی شدند. به‏منظور بررسی اثرات هر کدام از محیط‏های کشت بر میزان افزایش زیست توده ریشه‏های موئین 4 کلون انتخاب و نوک ریشه‏های فعال در حال رشد هر کلون قطع و با وزن تقریبی 200 میلی‏گرم به 4 محیط کشت شامل: HRGM-A   محیط کشت پایه MS مایع با 3 درصد ساکارز، ; HRGM-B محیط کشت پایه MS مایع با 3 درصد ساکارز و غنی شده با 2/0 گرم بر لیتر هورمون اکسین (NAA)، ;HRGM-C محیط کشت پایه MS مایع با 5/1 درصد ساکارز، ; HRGM-D محیط کشت پایه MS مایع با 3 درصد ساکارز در دمای 35 درجه سانتی‏گراد منتقل شدند‏، دمای محیط‏های کشت , HRGM-A  HRGM- HRGM-C 25 درجه سانتی‏گراد بود. به این ترتیب 12 محیط کشت با سه تکرار برای هر کدام از شرایط اعمال شده ایجاد شد. محیط‏های کشت در تاریکی و دمای 25 و 35 درجه سانتی‏گراد براساس آزمایش‏های طراحی شده بر روی شیکر انکوباتور با سرعت rpm 100 به‏مدت 2 ماه نگه‏داری شدند، نمونه‏‏ها در هر 10 روز واکشت می‏شدند. پس از گذشت 2 ماه به ‏منظور اندازه‏گیری وزن خشک ریشه‏های موئین، نمونه‏ها در دمای 50 درجه سانتی‏گراد خشک گردیدند تا وزن آن‏ها ثابت شود.

آنالیز آماری: کلیه آزمایش‏ها بر اساس یک طرح کامل تصادفی با حداقل 3 تکرار انجام گردید. میانگین داده‏های به‏دست آمده با استفاده از نرم افزار SAS مورد تجزبه واریانس (ANOVA) قرار گرفت، و میانگین‏ها برای صفات اندازه‏گیری شده به روش دانکن در سطح 5 درصد مقایسه گردید.

 

نتایج

درصد تراریختی ریزنمونه‏ها در دو روش دیسک برگی و اسپری

اولین ریشه‏های موئین حاصل از تلقیح با سویه A13 پس از گذشت 8 روز در ریزنمونه‏های  ریشه، هیپوکوتیل و برگ مشاهده گردید. مورفولوژی رشدی ریشه‏های موئین در هر سه نوع ریزنمونه با خصوصیات ریشه‏های موئین یعنی پلاژیوتروپیک و تولید انشعابات متعدد قابل مقایسه بود (شکل 2). میانگین درصد تلقیح ریزنمونه‏ها در دو روش دیسک برگی و اسپری در شکل (A -3) نشان داده شده است، بر اساس نتایج به‏دست آمده، در روش دیسک برگی بالاترین کارایی در انتقال T-DNA در ریزنمونه‏ها مشاهده شد (3/84 درصد) که اختلاف معنی‏داری در سطح آماری 5 درصد بین این دو روش وجود داشت.  همچنین بیشترین میانگین درصد تلقیح حاصل از دو روش مربوط به ریزنمونه های برگ (5/86 درصد ) و کمترین درصد تلقیح مربوط به ریزنمونه‏های ریشه (1/66 درصد) بود (شکلB  – 3). در تحقیق حاضر علاوه بر سویه A13 سویه 9534 نیز به‏کار برده شد که در این سویه درصد ریشه‏زایی صفر بود و تنها در بعضی ریزنمونه‏ها تشکیل کالوس در محل زخم رویت شد. همچنین نتایج حاصل از تلقیح ریزنمونه‏ها نشان داد که مناسب ترین سن ریزنمونه‏ها‏ی گیاهی در پذیرش ژن بیگانه مربوط به گیاهچه‏های 5 هفته‏ای (1/78 درصد) بود. با کاهش و افزایش سن گیاهچه‏ها در مقایسه با این دوره سنی کاهش درصد تلقیح قابل ملاحظه بود. به‏طوری‏که در 3 هفته صفر درصد و در 6 هفته به 57 درصد رسید.

تایید قابلیت ریشه‏زایی سویه A13

واکنش زنجیره‏ای پلیمراز (PCR) با استفاده از آغازگرهای اختصاصی ژن rolB وvirD  به ترتیب منجر به تکثیر قطعه‏ای به‏طول تقریبی bp780 و  bp338 گردید که وجود باند‏های درخشان از ژن rolB در ژنوم ریشه‏های موئین حاکی از ترایخته شدن ریزنمونه های گیاهی می باشد (شکل- A1). همچنین عدم حضور ژن virD در ریشه‏های موئین، که در خارج از T–DNA قرار دارد دلیلی بر عدم وجود هر گونه آلودگی باکتریایی ریشه‏های موئین است (شکل1- B ).

 

 

شکل 1: (A آنالیز PCR برای ریشه‏های موئین V. officinalis سویه A13 با استفاده از پرایمر‏های ژن‏های rolB .  M:DNA Ladder 1Kb ، 1: پلاسمید Ri از A. rhizogenes بهعنوان کنترل مثبت، 2 و3 و 4: ریشه‏های موئین تراریخته شده از ریزنمونهها، 5: ریشه گیاه بدون انتقال ژنتیکی به‏عنوان کنترل منفی اول، 6: واکنش PCR بدون DNA به‏عنوان کنترل منفی دوم. شکل 1- B: آنالیز PCR برای ریشه‏های موئین V. officinalis سویه A13  با استفاده از پرایمر‏های ژن‏هایvirD.M : DNA Ladder 1Kb، 1: پلاسمید Ri از A. rhizogenes به‏عنوان کنترل مثبت، 2و3 و4 : ریشه‏های موئین تراریخته القا شده ریزنمونه‏ها، 5: ریشه گیاه بدون انتقال ژنتیکی به‏عنوان کنترل منفی، 6: واکنش PCR بدون DNA به‏عنوان کنترل منفی دوم.

 

شکل 2: ظهور ریشه‏های موئین حاصل از تلقیح: C, B ,A به‏ترتیب مربوط به هیپوکوتیل ، ریشه و برگ می‏باشد.

 

 

شکل 3: میانگین درصد القای ریشه‏های موئین حاصل از B: ریزنمونه‏های برگ، هیپوکوتیل و ریشه، A: روش تلقیح. حروف غیر مشابه بیانگر معنی‏دار بودن (05/0p< ) بر اساس آزمون دانکن می‏باشد.


ارزیابی فنوتیپ رشد کلون‏های ریشه موئین

به‏منظور مقایسه فنوتیپ رشد ریشه‏های موئین مربوط به هر کلون، حدود 9 کلون از ریزنمونه‏های برگ، هیپوکوتیل و ریشه به‏مدت یک ماه در محیط کشت MS مایع کشت شدند. نتایج به‏دست آمده از اندازه‏گیری میانگین وزن تر کلون‏های ریشه موئین نشان داد. تفاوت قابل ملاحظه‏ای در میزان رشد آن‏ها وجود دارد (شکل 4). بر مبنای وزن تر کلون‏ها، فنوتیپ رشدی ریشه‏های موئین به‏صورت سه گروه کلون‏های تند، متوسط و کند رشد در نظر گرفته شد. بر این اساس کلون‏های C4, C7 و C9 به‏عنوان کلون تند رشد، همچنین کلون‏های C1, C2  و C5 به‏عنوان رشد متوسطه و بقیه‏ی کلون‏ها به‏عنوان کلون‏های با رشد کند انتخاب شدند. 

 

 

 

شکل 4 : میزان رشد 9 کلون (C1 – C9)  از ریشه موئین سنبل الطیب بر اساس وزن تر. حروف غیر مشابه بیانگر معنی‏دار بودن (05/0p<) بر اساس آزمون دانکن می‏باشد.


مقایسه اثرات محیط‏های کشت بر وزن خشک ریشه‏های موئین

در این مطالعه به‏منظور افزایش میزان رشد، ریشه‏های موئین گیاه سنبل‏الطیب در چهار محیط کشت متفاوت به‏مدت 2 ماه کشت شدند. نتایج به‏دست آمده از مقایسه میانگین وزن خشک ریشه‏های موئین تفاوت معنی‏داری در سطح 5 درصد را نشان می‏دهد (شکل 5). همان‏طور که مشاهده می‏شود بیشترین میزان وزن خشک ریشه‏های موئین در محیط کشت MS مایع با 3 درصد ساکارز در دمای 35 درجه سانتی‏گراد (HRGM-D) و کمترین میزان در محیط کشت MS مایع غنی شده با 2/0 گرم لیتر اکسین (HRGM-B) به‏ترتیب برابر با 19/0 و 05/0 گرم بود.

 

 

شکل 5: اثر محیط‏های کشت مختلف بر رشد ریشه‏های موئین بر اساس وزن خشک. حروف غیر مشابه بیانگر معنی دار بودن (p<0/05 ) بر اساس آزمون دانکن می باشد.


بحث

به‏منظور تکثیر قطعه‏ی مورد نظر T – DNA (Transferred-DNA) باکتریایی از واکنش زنجیره‏ای پلیمراز استفاده می‏گردد (12). انتقال ژنتیکی موفق به‏دو روش می‏تواند ثابت گردد: 1- روش مستقیم 2- روش غیرمستقیم که این دو روش به‏ترتیب به‏وسیله شناسایی و تعیین توالی‏های T-DNA  و اوپین‏ها می‏باشد. به‏دلیل اینکه تولید اوپین‏ها پایدار نبوده و حتی ممکن است از بین بروند، روش مستقیم یعنی تعیین توالی T-DNA ترجیح داده می‏شود (13). انتقال T – DNA از اگروباکتریوم به ژنوم گیاهی فرآیند پیچیده‏ای است که درصد موفقیت آن به عواملی از قبیل سویه باکتری (14)، نوع ریزنمونه گیاهی (15 و 16) و دوره هم کشتی (17) بستگی دارد. در بین موارد ذکر شده نوع سویه باکتری نقش کلیدی در این فرایند دارد. دلیل این پدیده را می‏توان در قالب اثرات متقابل گیاه – پاتوژن بررسی کرد. در تحقیق حاضر از دو سویه A13 و 9534 برای القای ریشه موئین استفاده گردید که این دو سویه از عمل‏کرد یکسانی برخوردار نبودند، طوری‏که ریزنمونه‏های گیاه سنبل‏الطیب پاسخ مثبت به سویه 9534 نشان ندادند. از طرفی سویه A13 در سطح قابل ملاحظه‏ای عمل کرد. تولید موفقیت آمیز ریشه‏های موئین با استفاده از باکتری آگروباکتریوم سویه A13 در چندین مطالعه انجام شده است. برای مثال ریزنمونه‏های اپی‏کوتیل بادام زمینی با سویه A13 آلوده شده و منجر به تولید ریشه‏های موئین شده است (18). همچنین القا ریشه‏های موئین از قطعات برگی گونه  Crotalaria  juncea با استفاده از باکتری اگروباکتریوم سویه A13 توسطOhaara  نیز گزارش شده است (19).  Lee و همکاران (20) در بررسی قدرت تهاجمی و قابلیت آلودگی پنج سویه مختلف آگروباکتریوم به این نتیجه رسیدند که سویه A13 برروی گیاه Aglaia elliptica کارایی موثرتری داشت. هورمون‏های گیاهی خارجی، سطح قند، منابع نیتروژن و مقدار نسبی آن‏ها، نور، دما و حضور مواد شیمیایی می‏توانند میزان رشد و زیست توده کلی و همچنین مقدار متابولیت‏های ثانویه را تحت تاثیر قرار دهند. بهینه سازی این اجزا می‏تواند رشد ریشه‏های موئین را افزایش دهد. نتایج به‏دست آمده از بررسی اثرات 4 محیط کشت بر میزان افزایش زیست توده ریشه‏های موئین نشان دهنده اثر متفاوت این محیط کشت‏ها به سود محیط کشت پایه MS  نگه‏داری شده در دمای 35 درجه سانتی‏گراد بود. در مقابل محیط کشت حاوی 2/0  گرم بر لیتر NAA دارای حداقل رشد بود. چندین گزارش وجود دارد که نشان می‏دهد مکمل‏های قند و اکسین در محیط کشت موجب تحریک رشد ریشه‏های موئین می‏شود (21). در این تحقیق نتایج به‏دست آمده با گزارش‏های ارائه شده در زمینه تاثیر اندک اکسین بر رشد ریشه‏های موئین مشابه است (22). هر چند جدیدا ثابت شده است که آزمون منظم اثرات هورمون‏های مختلف بر روی ریشه‏ها و متابولیت‏های ثانویه می‏تواند در بعضی موارد منجر به افزایش رشد ریشه‏های موئین و متابولیت‏ها گردد (23). این نتایج متضاد را می‏توان در میزان آندوژنی هورمون‏ها بررسی کرد. از آنجا که میزان آندوژنی هورمون‏ها در گیاهان متفاوت می باشد، بنابراین استفاده از هورمون‏ها‏ی گیاهی خارجی منجر به پاسخ‏های متفاوت در گیاهان می‏شود. در مطالعه حاضر به‏منظور بررسی و تعیین مناسب‏ترین نوع و سن ریزنمونه‏ها‏ی گیاهی در تولید ریشه موئین، مشخص گردید که با افزایش سن ریزنمونه‏ها‏ی گیاهی تا 5 هفتگی توانایی ریزنمونه‏ها برای پذیرش ژن بیگانه افزایش یافت (داده‏ها‏ی مربوط به سن ریزنمونه‏ها نشان داده نشده است). همچنین در گیاه سنبل‏الطیب، تفاوت قابل ملاحظه‏ای در فراوانی ریشه‏های موئین ایجاد شده در3 نوع ریزنمونه وجود داشت.Mehrota  و همکاران (24) نیز گزارش دادند میزان آلودگی و فراوانی تشکیل ریشه‏های موئین تحت تاثیر دو عامل سن و نوع ریزنمونه می‏باشد، بر اساس نتایج مطالعه مذکور، ریزنمونه‏های برگی بیشترین موفقیت را به‏خود اختصاص دادند. این مشاهدات حاکی از آن است که سن و نوع ریزنمونه معیار اساسی در این زمینه می‏باشد، به‏دلیل این‏که سن و نوع ریزنمونه فاکتور مهمی است که خصوصیات فیزیولوژیکی سلول را تغییر می‏دهد. بر اساس وزن تر ریشه‏های موئین حاصل از کلون‏ها، تفاوت فنوتیپ رشد در بین کلون‏ها مشاهده گردید. در بررسی‏های انجام شده تفاوت رشدی قابل ملاحظه‏ای در بین کلون‏های حاصل از تلقیح یک نژاد مشاهده شد (25). دلیل این تنوع می‏تواند به مواردی همچون ورود مقادیر مختلفی از T – DNA  باکتری در سلول‏های ترا‏ریخته اولیه هر کلون و همچنین بیان متفاوت ژن‏های T- DNA با توجه به محل قرار گیری این ژن‏ها ارتباط داشته باشد. سارا و همکاران (26) در بررسی میزان رشد 10 کلون ریشه موئین گیاه کاسنی (‏Cichorium intybus) حاصل از سویههای مختلف اگروباکتریوم رایزوژنز دریافتند که تنوع قابل ملاحظهای در سرعت رشد کلون‏های حاصل از هر سویه وجود دارد و بر این اساس آن‏ها را در 3 گروه قرار دادند.

 

نتیجه گیری

با توجه به نتایج به‏دست آمـده از این تحقیق می‏تـوان استنبـاط

کرد که برای کوتاه کردن زمان افزایش زیست توده کلی ریشه‏های موئین بهینه‏سازی شرایط محیط کشت از اهمیت ویژه‏ای برخوردار است. طوری‏که میزان رشد ریشه‏های موئین در محیط کشت پایه MS نگه‏داری شده در دمای 35 درجه سانتی‏گراد در مقایسه با سایر کشت‏ها بیشتر بود. همچنین مشخص شد که نوع سویه باکتری نقش کلیدی در فرآیند انتقال ژن به سلول گیاهی دارد. در پلاسمیدهای سویه‏های باکتری    A. rhizogenes توالی‏هایی به‏نام توالی‏های تحریک کننده انتقال T-DNA وجود دارد که دفعات تکرار این توالی در سویه‏ها متفاوت می‏باشد. درسویه‏های میکیموپین که سویهA13  نیز از همین گروه می‏باشد، توالی مذکور 12 بار تکرار شده است درحالی‏که در سویه‏های مانوپین و اگروپین این توالی 6و 5 بار به‏ترتیب تکرار شده است (27). به‏نظر می‏رسد که این مطلب تا حدودی علت قدرت تهاجمی بالای سویه A13 را توجیه نماید.

تشکر و قدردانی

از کلیه افراد محترم به‏خصوص  آقای دکتر سبزی و مشکی کارشناسان محترم پژوهشکده زیست فناوری دانشگاه ارومیه به‏خاطر مساعدت‏ها و راهنمایی‏های ارزشمندشان قدردانی می‏کنم. همچنین از تحصیلات تکمیلی دانشگاه ارومیه به‏واسطه تصویب و حمایت از این تحقیق صمیمانه سپاسگزاری می‏شود.

  1. Yaniv Z. Handbook of Medicinal Plant. 7th Ed. New York, London & Oxford: Food Product, Haworth Medical & Imprints of the Haworth Press. 2005; pp 365.
  2. Ming KJ, Khang GN, Sail GL, Fatt CT. Recent advances in traditional plant drugs and orchids. Acta. Pha. Sin. 2003; 24: 7-21.
  3. Giri A, Narasu ML. Transgenic hairy roots: Recent trends and application. Bio. Adv. 2000; 18: 1-22.
  4. 4.     Tepfer D. Transformation of several species of highplants by Agrobacterium rhizogenes: Sexual transmission of the transformed genotype and phenot Cell. 1984; 37: 959 - 967.
  5. Krystal AD, Ressler I. The use of valeriana in neuropsychiatry.CNS. Spectr. 2001; 6(10): 841-847
  6. Granicher F, Christen P, Kapetanidis I. Essential oils fram normal and hairy roots of Valeriana officinalis var. sambucifolia. Phytochemistry. 1995; 40: 1421-1424.
  7. Granicher F, Christen P, Kapetanidis I. High-yield production of valepotriates by hairy root cultures of valeriana officinalis L.var.sambucifolia Mikan. Plant Cell Rep. 1992; 11(7): 339-342.
  8. Pastrol GM, Wilkinson MD, Steele SH, Sparks CA, et al. Age dependent transformation frequency in elite wheat varieties. J. Exper. Bot. 2001; 52(7): 857-863.
  9. Vergauwe A, Van G, Inze D, Van Montagu M, et al. Factors influencing A. tumefaciens mediated transformation of Artemisia annua L. Plant Cell Rep. 1998; 18 (2): 105-110.
 

10. Murashige T, Skoog F. Arevised medium for rapid growth and bioassays with Tobacco tissue culture. J. Plant Phy.1962; 15(3): 473-497.

11. Khan S, Irfan QM, Kamaluddin AT, Abdin MZ. Protocol for isolation of genomic DNA from dry and fresh roots of medicinal plants suitable for RAPD and restriction digestion. Afr. J. l. Bio. 2007; 6:175-178.

12. Palazon J, Moyano E, Cusido RM, Bonfill M, et al. Alkaloid production in Duboisia hybrid hairy roots and plants overexpressing the h6h gene. Plant Sci. 2003; 165:1289-1295.

13. Sevon N, Oksman-Caldentey KM. Agrobacterium rhizogenes-mediated transformation: root cultures as a source of alkaloids. Planta Med. 2002; 68: 859-868.

14. Chabaud M, Carvalho-Niebel F, Barker DG. Efficient transformation of Medicago truncatula cv. Jemalong using the hyper virulent Agrobacterium tumefaciens strain AGL1. Plant Cell Rep. 2003; 22(1): 46-51.

15. Geier T, Sangwan RS. Histology and chimeral segregationreveal cell-specific differences in the competence for shoot regeneration and Agrobacterium-mediated transformation in Kohleria internode explants. Plant Cell Rep. 1996; 15: 386-390.

16. Kim KH, Lee YH, Kim D, Park YH, et al. Agrobacterium-mediated genetic transformation of Perilla frutescens. Plant Cell Rep. 2004; 23: 386-390.

17. Barik DP, Mohapatra U, Chand PK. Transgenic grasspea (Lathyrus sativus L.): factors influencing Agrobacterium-mediated transformation and regeneration. Plant Cell Rep. 2005; 24: 523-531.

18. Akasaka Y, Mii M, Daimon H. Morphological alterations and root nodule formation in Agrobacterium rhizogenes-mediated transgenic hairy roots of peanut (Arachis hypogaea L.). Annals of Bot. 1998; 81:355–362.

19. Ohara A, Akasaka Y, Paimon H, Mii M. Plant regeneration from hairy roots  induced by infection with Agrobacterium rhizogenes in Crotalaria Juncea L. Plant Cell Rep. 2000; 56: 563-568.

20. Lee SK, Cui B, Mehta RR, Kinghorn AD, et al. Cytostatic mechanism and antitumor potential of novel 1.Hcyclopenta [2] benzofuran lignans isolated from Aglaia elliptica. Chem. Biol. Interact. 1998; 115: 215–228.

21. Nilsson O, Olsson O. Getting to the root: the role of the Agrobacterium rhizogenes rol genes in the formation of hairy roots. Physiol. Plant. 1997; 100: 463-473.

22. Doran PM. Foreigen Protein degradation and instability in plants and plant tissue cultures. Trends. Biotechn. 2006; 24: 426-432.

23. White PR. Potentially unlimited growth of excised tomato root tips in a liquid medium. Plant Physiol. 1943; 9: 585-600.

24. Mehrota T, Kukreja AK, Khanuja S, Mishra BN. Genetic transformation studies and scale up of hairy root culture of Glycyyhiza glabra in bioreactor. Ele. J. Biotech. 2008; 11:2: 1-7.

25. Sevon N, Oksman KM. Agrobacterium rhizogenes-mediated transformation: root cultures as a source of alkaloids. Planta Med. 2002; 68: 859-868.

26. Sara K, Jafar Z, Gorbanalli N, Ehsan S. Optimization of hairy root culture establishment in Chicory plants (Cichorium intybus) through inoculation by Agrobacterium rhizogenes. Biotech. J. of Agri. 2012; 4(2):61-75.

27. Veena V, Taylor C. Agrobacterium rhizogenes: recent developments and promising applications. In Vitro Cell. Dev. Biol. 2007; 43: 383–403.