بررسی وجود جهش¬های FecB و FecGH در بزهای کاموری استان خوزستان

نوع مقاله: علمی - پژوهشی

-

چکیده

بزهای کاموری، FecB، FecGH، GDF9 هدف: هدف از این مطالعه تعیین وجود جهش‏های FecB و FecGH در بزهای نژاد کاموری استان خوزستان بود.  مواد و روش‏ها: در این مطالعه پژوهشی، از 40 راس بز کاموری با حداقل یک‏بار سابقه دوقلوزایی خون‏گیری به‏عمل آمد و DNA آن‏ها با روش اصلاح شده نمکی استخراج گردید و جایگاه ژن‏های FecB و GDF9 با استفاده از پرایمرهای اختصاصی تکثیر یافت. نتایج: پس از تکثیر جایگاه ژن‏ها، محصولات 190 و 139 جفت بازی با استفاده از رنگ آمیزی اتیدیوم بروماید مشاهده گردید. سپس محصولات به‏دست آمده به‏ترتیب در مجاورت آنزیم‏های اختصاصی AvaII و DdeI تیمار گردیدند. پس از هضم محصولات، مشاهده گردید که جهش‌های FecB و GDF9 در جمعیت مورد مطالعه وجود ندارد. نتیجه گیری: در این مطالعه مشاهده شد که جهش‌های FecB و FecGH در بزهای نژاد کاموری استان خوزستان وجود ندارد و همه بزهای مورد مطالعه دارای ژنوتیپ نوع وحشی بودند. بنابراین این جهش‌ها نمی‌توانند از عوامل چندقلوزایی در این نژاد باشند و مطالعات بیشتری برای بررسی ژن‏های موثر بر چندقلوزایی و تعیین ژنوتیپ در این بزها مورد نیاز است.

کلیدواژه‌ها


مقدمه

طی دهه اخیر مطالعات گسترده­ای برای افزایش میزان بهره­وری در سطح دام‏داری‏ها خصوصا دام‏داری‏های گوسفند انجام گرفته است. در این میان یافتن ژن‏های موثر بر چندقلوزایی مورد توجه بسیاری از محققین قرار گرفته است. ژن‏های مهمی مانند FecB، GDF9 و BMP15 از اهمیت ویژه­ای برخوردار هستند. این ژن‏ها جز فوق خانواده TGFβ می‏باشند. TGFβ، فوق خانواده­ای است که دارای بیش از 40 عضو می باشد. اعضای این فوق خانواده نقش مهمی در فرایندهای سلولی دارند و اغلب به‏عنوان فاکتورهای رشد عمل می‏کنند (1، 2 و 3).

بزها حیواناتی هستند که نقش مهمی در اقتصاد خانوارهای روستایی و فقیر نشین دارند. این حیوانات اغلب برای تامین پروتئین، شیر، چرم و مو پرورش می‏یابند. اما بیشتر نژادهای بز برای تامین پروتئین و شیر در مناطق کمتر توسعه یافته و یا فقیر از نظر منابع طبیعی خصوصا مناطق کوهستانی پرورش می‏یابند. در سال 2010 تعداد کل بزها موجود در دنیا در حدود 861 میلیون راس برآورد گردید (4). حدود 90 درصد جمعیت بزها در کشورهای در حال توسعه می‏باشد که در این میان بیشترین جمعیت در کشورهای هند، چین، بنگلادش، ایران، پاکستان و ترکیه می‏باشند (5). کشور پاکستان با دارا بودن جمعیتی حدود 7/56 میلیون راس‏، بیشترین تعداد را دارد که معمولا در گله های متوسط و به‏عنوان واحدهایی جهت تولید شیر، گوشت، مو و پوست پرورش می‏یابند. از این میان در حدود 25 نژاد بز در پاکستان شناسایی شده است که اکثریت آن‏ها از نوع نژاد گوشتی هستند. اما برخی از آن‏ها نیز شیری می­باشند؛ از جمله معروف‏ترین این نژادها شامل بیتال، درادین پانها، ناچی و کاموری می‏باشند (6). نژاد شیری کاموری با اندازه‏ای متوسط تا بزرگ و وزن 44 تا 50 کیلوگرم دارای پوشش بدن به رنگ قهوه‏ای تیره با لکه­های قهوه­ای روشن و یا سیاه و یا سفید می‏باشد. سر حیوان نسبت به جثه بزرگ، بینی خمیده، گوش‏های طویل، نرها و ماده­ها دارای شاخ، پستان و سرپستانک‏های کاملا رشد یافته و تولید شیر در حدود 210 لیتر در مدت 115 روز است. دو قلو زایی در این نژاد معمول می باشد (7).

ایران یکی از مهم‏ترین کشورهای پرورش دهنده بز در دنیا است به‏طوری‏که بیش از 25 میلیون راس بز و قریب به 15 نژاد مختلف با ویژگی‏های منحصر به‏فرد در مناطق مختلف پرورش می­یابد. طی سالیان اخیر به‏علت مهاجرت و نیاز به منابع پروتئینی، تعدادی از نژادهای بز و گوسفند از کشورهای همسایه مانند پاکستان، افغانستان و چین وارد کشور ایران شده است. بزهای نژاد کاموری از جمله حیواناتی است که طی سالیان اخیر از طریق مرزهای جنوب شرقی و خصوصا استان سیستان و بلوچستان وارد کشورمان شده است. از زمان دقیق ورود آن‏ها اطلاع موثقی در دسترس نمی‏باشد اما باتوجه به خصوصیات لاشه مناسب و تولید بالای شیر و همچنین میزان چندقلوزایی مناسب در سطح بسیاری از استان­ها خصوصا استان‏های کرمان، فارس، بوشهر، خوزستان و حتی به استان‏های غربی مانند کرمانشاه نیز پخش شده است.

طی بررسی‏های انجام گرفته در گله­های استان خوزستان، خصوصیات فنوتیپی آن‏ها شامل وزن یک بز بالغ شش ماه حدود 20 کیلوگرم، یک ساله حدود 40 کیلوگرم، دو ساله حدود 50 کیلوگرم و سه ساله حدود 60 کیلوگرم می­باشد. میانگین قد بزهای یک ساله 85 سانتیمتر می­باشد. وزن زمان تولد بزغاله حدود 5/2 کیلوگرم می­باشد. از مهم‏ترین خصوصیات این نژاد وزن زنده بالا در مقایسه با نژادهای دیگر، تولید شیر روزانه حدود 3 لیتر و میزان چندقلوزایی 9/1 در هر زایمان می­باشد. محل پرورش این بزها در استان خوزستان اغلب شهرستان‏های اهواز، دزفول و رامهرمز است که به‏صورت دسته­های چند تایی تا چند ده راسی پرورش می­یابند. 

ژن FecB یا BMPR1B (Bone Morphogenetic Protein Receptor 1B) که به ALK6 (Activin-Like Kinase 6) نیز معروف است روی کرموزوم 6 گوسفند قرار دارد و به‏صورت سینتنیک (syntenic) روی کروموزم 4 انسان واقع شده است. این ژن دارای یک جهش است که باعث افزایش میزان تخمک‏گذاری در حاملین می­گردد. در این جهش، نوکلئوتید گوانین به‏جای آدنین در جایگاه 746 توالی cDNA قرار گرفته است که سبب جایگزینی اسیدآمینه آرژنین به‏جای گلوتامین در جایگاه 249 پروتئین بالغ می­گردد (8 و 9). برای بررسی وجود جهش FecB محصولات حاصل از تکثیر جایگاه ژن که 190 جفت باز دارد در مجاورت آنزیم محدودگر AvaII قرار می‏گیرد و در صورتی‏که جهش مورد نظر وجود داشته باشد باند 190 جفت بازی شکسته و به دو باند 160 و 30 جفت بازی تبدیل می‏شود. بدین‏صورت که در افراد هموزیگوس باندهای 160 و 30 جفت بازی مشاهده می­شود درحالی‏که در حاملین هتروزیگوت باندهای 190، 160 و 30 جفت بازی ولی اگر جهش در گله نباشد فقط باندهای 190 جفت بازی مشاهده می­شود (8 و 10). تجزیه و تحلیل‌های گسترده فیزیولوژیکی نشان می­دهد که ژن FecB بر فعالیت غدد هیپوفیز و تخمدان و به‏خصوص در فولیکول­های تخمدانی اثر می­گذارد. این ژن فعالیت خود را به‏طور مستقیم یا غیرمستقیم با وادار کردن رشد زودرس فولیکول­های تخمدانی که در اندازه کوچک آزاد می‏شوند اعمال می­کند (11).

ژن FecG (GDF9) که دارای وزن ملکولی 5/2 کیلو باز است دارای 2 اگزون و یک اینترون 1126 کیلو بازی است که یک پروپپتید 453 اسیدآمینه­ای را رمزگذاری می‌کند و شکل فعال پپتید دارای 135 اسیدآمینه می‌باشد. این ژن در تخمک­های مرحله اولیه فولیکول‌های در حال رشد تا زمان تخمک­گذاری بیان می­گردد. فقدان این ژن سبب اختلال در رشد فولیکول­ها بعد از مرحله نوع 2 می­گردد. ژن GDF9 برروی فعالیت جسم زرد نیز موثر و بنابراین به‏طور غیرمستقیم برروی تداوم آبستنی نیز موثر می­باشد (12).

خانواده GDF9 دارای 8 چند شکلی تک نوکلئوتیدی است که به اختصار به G1-G8 معروف هستند. در بین این‌ها تنها جهش G8 که به FecGH معروف است اثرات مهمی روی میزان چندقلوزایی دارد (12). این جهش سبب افزایش میزان تخمک‏گذاری در ناقلین هتروزیگوت و سبب عقیمی در ناقلین هموزیگوت می­گردد. در ناقلین FecGH اسیدآمینه فنیل­آلانین به‏جای سرین در جایگاه 77 پروتئین بالغ قرار گرفته است. محصولات 139 جفت بازی حاصل از تکثیر جایگاه ژن GDF9 به‏دست می‏آید که برای تعیین وجود جهش FecGH، این محصولات در مجاورت آنزیم DdeI قرار می­گیرند. در صورتی­که جهش وجود داشته باشد باند 139 جفت بازی پس از تیمار برش نمی‏خورد ولی اگر جهش وجود نداشته باشد محصولات PCR برش و به­صورت دو باند مجزا برروی ژل آگارز مشاهده می­گردند (12). از هفت جهش باقی‏مانده سه جهش تاثیری روی فرایند تولیدمثل ندارند اما چهار جهش باقی‏مانده شامل G1، G4، G6 و G7 ممکن است اثراتی روی باروری داشته باشند، با این وجود اما هنوز به‏طور دقیق مکانیسم آن‏ها مشخص نگردیده است هرچند این جهش­ها در بعضی از نژادهای گوسفند پرزا مشاهده شده اند. نکته دیگر اینکه، حاملین هموزیگوت این جهش­ها نیز نابارور نیستند (11 و 12). جهش FecGH اولین بار توسط Hanrahan و همکاران (12) و جهش FecB نیز توسط Davis و همکاران (13) شناسایی گردید و از آن زمان به بعد مطالعات گسترده­ای برای شناسایی این جهش­های ارزشمند در گوسفندان و بزهای مختلف در سطح بین المللی انجام گرفته است و تاکنون این جهش­ها در بزهای نژادهای مختلف در سراسر دنیا بررسی شده است.

نظر به اهمیت صفت چندقلوزایی، تولید شیر و گوشت، لزوم بررسی ژن‏های موثر بر چند قلوزایی، در این مطالعه، بررسی وجود جهش‏های FecB و FecGH در بزهای نژاد کاموری استان خوزستان بررسی گردیده است.

 

مواد و روشها

از 40 راس بز نژاد کاموری که حداقل یک‏بار سابقه دوقلوزایی داشتند از گله­های شهرستان‏های اهواز و رامهرمز با استفاده از لوله خلا دار حاوی EDTA، خون‏گیری به‏عمل آمد و پس از جدا کردن بافی کوت، DNA آن‏ها با استفاده از روش محمدی و صابری‏وند (14) استخراج گردید. از DNA استخراج شده نمونه کاری تهیه و در یخچال نگهداری و مابقی DNA در فریزر 20- درجه سانتی‏گراد ذخیره گردید.

براساس جدول شماره 1، پرایمر اختصاصی برای شناسایی موتاسیون های FecB و FecGH با استفاه از مطالعات Davis و همکاران (13) و Hanrahan و همکاران (12) توسط شرکت TAG Copenhagen دانمارک تهیه گردید.

واکنش زنجیره­ای پلیمراز برای تکثیر قطعه 190 و 139 جفت بازی جایگاه ژن‏هایFecB و GDF9 با 35 چرخه (94 درجه سانتی‏گراد به مدت 30 ثانیه برای واسرشت و دمای مناسب براساس جدول 1، برای اتصال،72 درجه­ سانتی‏گراد به مدت 30 ثانیه برای امتداد) در دستگاه ترموسایکلر Xp Cycler (ساخت کشور چین) انجام گردید. این واکنش در حجم 25 میکرولیتر با محتویات 5/2 میکرولیتر بافر 10X، 5/1 میلی‏مول Mgcl2، 5/0 میکرومول از هرکدام از پرایمرها، 200 میکرومول dNTP، 1 واحد آنزیم Taq  پلیمراز، 100 نانوگرم DNA استخراج شده استفاده گردید. پس از پایان PCR، محصولات به‏دست آمده با استفاده از ژل آگارز 2 درصد بررسی گردید. پس از تایید انجام PCR و مشاهده باندهای190 و 139 جفت بازی به‏ترتیب برای ژن‏های FecB و GDF9 محصولات به‏دست آمده برای شناسایی موتاسیون های FecB و FecGH با آنزیم‏های اختصاصی AvaII و DdeI (Fermentas) به‏مدت یک شب تیمار گردید. بدین‏منظور مقدار 10 میکرولیتر محصول PCR، 3 میکرولیتر 10X بافر، 1 واحد آنزیم برشی و 15 میکرولیتر آب مقطر در حجم نهایی 30 میکرولیتر مخلوط گردید. واکنش به مدت 12 ساعت در دمای 37 درجه سانتی‏گراد انجام شد. پس از پایان هضم، محصولات حاصله با استفاده از ژل آگارز 3 درصد و رنگ آمیزی اتیدیوم بروماید بررسی شدند.

 

جدول1: توالی پرایمرها، دما و مدت زمان اتصال و آنزیم اختصاصی محدودگر ژن‏های FecB و GDF9

آنزیم محدودگر

اندازه باند (جفت باز)

دما و مدت زمان اتصال

توالی پرایمر    3-5

جهش

AvaII

190

60°C-

30 ثانیه

CAAGATGTTTTCATGCCTCATGAACACGGTC

CCAGAGGACAATAGCAAAGCAAA

FecB

DdeI

139

62 °C-

40 ثانیه

ATGGATGATGTTCTGCACCATGGTGTGAACCTGACTTTAGTCAGCTGAAGTGGGACAAC

FecGH

 

 

نتایج

نتایج حاصل از آزمایش‏ها نشان داد که جایگاه ژن‏هایFecB  و GDF9 در تمام بزهای کاموری مورد مطالعه تکثیر یافت و محصولات PCR پس از رانش روی ژل آگارز 2 درصد به‏ترتیب الگوی باندی 190 و 139 جفت بازی را نشان دادند.

برای یافتن جهش‏های FecB و محصولات PCR به‏دست آمده در مجاورت آنزیم محدودالاثر AvaII قرار گرفتند. محصولات PCR ژن FecB پس از مجاورت با آنزیم اختصاصی بدون هیچ برشی باقی ماندند و تنها باندهای 190 جفت بازی بدون تغییر مشاهده شدند، ولی DNA لامبدا که در مجاورت آنزیم قرار گرفته برش خورد و به‏صورت قطعات مجزایی مشاهده گردید (شکل 1).

برای مشخص شدن وجود جهش FecGH محصولات به‏دست آمده در مجاورت آنزیم DdeI قرار گرفتند و تمامی محصولات PCR ژن GDF9 در مجاورت آنزیم برش خوردند. در این آزمایش DNA لامبدا نیز در مجاورت آنزیم برش خوردند (شکل 2). بنابراین بر اساس مطالعه Davis و همکاران (14) و Hanrahan و همکاران (12)، جهش‏های FecB و FecGH در بزهای مورد مطالعه وجود نداشت.

این مطالعه نشان می‌دهد که جهش های FecB و FecGH در جمعیت‌ بزهای کاموری موردهای مطالعه وجود ندارد و تنها ژنوتیپ نوع وحشی است که با محیط، سازگاری کامل یافته است (جداول 2 و 3).

 

                       

شکل 1: وضعیت جهش FecB در بزهای نژاد کاموری بر روی ژل آگارز 2 درصد: ستون M مارکر 50 جفت­بازی، ستون­های 1 تا 7 باندهای برش نخورده و ستون L، DNA لامبدا که به‏وسیله آنزیم AvaII برش خورده است.

 

شکل 2: وضعیت جهش FecGH: بر روی ژل آگارز 2 درصد: ستون M مارکر 50 جفت­بازی، ستون­های 1 تا 4 محصولات PCR، قبل از هضم آنزیمی. باندهای 1c-4c محصولات PCR برش خورده به‏وسیله آنزیم DdeI در بزهای نژاد کاموری و ستون L، DNA لامبدا که به‏وسیله آنزیم برش خورده است.

 

 

جدول 2: فراوانی ژنوتیپی و آللی ژن FecB در بزهای کاموری

نژاد

تعداد/راس

ژنوتیپ

فراوانی ژنوتیپ

BB

B+

++

بز کاموری

40

-

-

+

100

 

جدول 3: فراوانی ژنوتیپی و آللی ژن GDF9 در بزهای کاموری

نژاد

تعداد/راس

ژنوتیپ

فراوانی ژنوتیپ

++

H+

HH

بز کاموری

40

+

-

-

100

 


بحث

در نشخوارکنندگان کوچک به‏خصوص در گوسفندان، تاثیر ژنتیک برروی تعداد جنین­ها به‏خوبی بررسی شده است. در گوسفندان، از مهم‏ترین ژن‏های موثر بر چندقلوزایی می‏توان به BMP15، GDF9 و BMPRIB اشاره کرد. BMPRIB بر روی کروموزوم 6 قرار دارد و دارای یک جهش به‏نام FecB می باشد که سبب افزایش میزان تخمک‏گذاری می­گردد. افزایش میزان تخمک­گذاری و تعداد جنین در این جهش با تعداد کپی­های جهش ارتباط دارد. این جهش اولین بار در گوسفندان چندقلوزای بورولا مشاهده گردید. مکانیسم اثر این جهش به این‏صورت است که سبب افزایش حساسیت سلول‏های گرانولوزا به FSH)) می‏گردد که سبب تسریع رشد فولیکول­ها و تخمک‏گذاری فولیکول­ها در اندازه کوچک­تر می‏شود. در جهش­های GDF9 و BMP15 میزان تخمک­گذاری در حاملین هتروزیگوت بالاتر از گوسفندان فاقد جهش می­باشد، اما حاملین هموزیگوت برای این جهش­ها، نابارور می­باشند. GDF9 دارای 8 جهش است و بر روی کرموزوم 5 قرار دارد. یکی از مهم‏ترین جهش­های این ژن، FecGH نام دارد که سبب افزایش میزان چندقلوزایی در حاملین هموزیگوت و ناباروری در حاملین هتروزیگوت می­گردد (11، 12 و 13).

تعداد بزهای پرورشی در کشورمان حدود 25 میلیون راس میباشد. بزهای کاموری از نژادهای وارداتی است که طی سالیان اخیر وارد کشور شده است و هنوز وضعیت تولیدمثلی آن‏ها و میزان تلاقی آن با دیگر نژادهای ایرانی مشخص نمی­باشد. بزهای نژاد کاموری چون وزن لاشه مناسبی دارند (بالغ 40 کیلوگرم)، تولید شیر بیشتری نسبت به دیگر نژادهای ایرانی دارند و میزان چندقلوزایی در آن‏ها زیاد است (9/1 در هر زایمان) و بنابراین مورد توجه دامداران واقع شده است. به‏همین علت در این مطالعه به بررسی وجود جهش­های FecB و FecGH در این نژاد پرداخته شده است. 

مطالعه الگوی باندی مشاهده شده در الکتروفورز پس از هضم آنزیمی، وجود موتاسیون های FecB و FecGH را در بزهای کاموری استان خوزستان نشان نداد به­طوری­ که پس از تیمار محصولات PCR با آنزیم برشی، تنها باندهای 190 جفت بازی بدون هیچ برشی برای ژن FecB مشاهده گردید اما همه محصولات 139 جفت بازی ژن GDF9 در مجاورت آنزیم اختصاصی برش خوردند.

مطالعات انجام گرفته در نژادهای مختلف بز نشان می‏دهد که فقط جهش FecB در نژاد چندقلوزای بنگال سیاه مشاهده شده است، اما جهش FecGH در این نژاد مشاهده نشده است (9). مطالعات انجام گرفته نشان می­دهد که جهش FecB در نژادهای بز چینی مثل بوئر (Boer)، هایمن (Haimen)، هونقایی (Huanghuai)، نوبی (Nubi)، متیو (Matou)، جنینگ خاکستری (Grey Jining) (10) و یونلینگ سیاه (Black Yunling) وجود ندارد (15). مطالعات انجام گرفته برروی بزهای ایرانی نیز نشان می­دهد که جهش FecB در بزهای نجدی و بومی استان خوزستان مشاهده نشده ­است (16).

با این‏حال تاکنون وجود جهش­های FecB و FecGH در هیچ‏کدام از نژادهای گوسفند و بز ایرانی گزارش نگردیده است.
مطالعات انجام گرفته نشان می­دهد که جهش ژن­های FecB و FecGH فقط عامل چندقلوزایی در بز و گوسفندان نمی­باشد بلکه جهش­های دیگری نیز وجود دارد که از عوامل مهم چندقلوزایی هستند (8، 17 و 18).

مطالعه حاضر نشان می‌دهد که جهش­های FecB و FecGH در بزهای کاموری استان خوزستان وجود ندارد، بنابراین این جهشها نمی‌توانند از عوامل موثر بر چندقلوزایی در این نژادها باشد. در نتیجه با توجه به اهمیت بزهای نژاد کاموری برای دامداران استان­های مختلفی که این نژاد ورود پیدا کرده است، انجام مطالعات ژنتیکی بیشتری برای بررسی وضعیت ژنتیکی و بهبود اصلاح نژادی آن‏ها ضرورت دارد (18 و 19).

فراوانی­های ژنوتیپ وحشی (++) برای هر دو جایگاه (FecB و FecG) 100 ولی برای ژنوتیپ جهش­ها چه در حالت هموزیگوت و چه در حالت هتروزیگوت صفر می‏باشد، بنابراین چون جهش­های مورد مطالعه در بزهای کاموری مشاهده نمی‏شود در نتیجه ارتباطی بین میزان چندقلو زایی و جهش­های مورد مطالعه وجود ندارد.

 

نتیجه گیری

نتایج حاصل از این مطالعه نشان میدهد که موتاسیونهای FecB و FecGH در بزهای کاموری استان خوزستان وجود ندارد بنابراین این موتاسیونها نمیتوانند عامل چندقلوزایی در این نژاد باشند.

 

تشکر و قدردانی

این مطالعه از محل اعتبارات اختصاص یافته از طریق معاونت محترم پژوهشی دانشگاه شهید چمران اهواز انجام گرفته است که بدین‏وسیله مراتب تشکر خود را اعلام می­دارد.

  1. 1.     Juengel JL, Bodensteiner KJ, Heath DA, Hudsun Nl. Physiology of GDF9 and BMP15 signalling molecules. Animal Reproduction Science. 2004; 82-83: 447-460.
  2. 3.     Souza CJ, MacDougall C, MacDougall C, Campbell BK, et al. The Booroola (FecB) phenotype is associated with a mutation in the bone morphogenetic receptor type 1 B (BMPR1B) gene. Journal of Endocrinology. 2001; 169(2): R1–R6.
  3. 4.     Abdel Aziz M. Present status of the world goat populations and their productivity. Lohmann Information. 2010; 45(2): 42-52.
  4. 5.     Haenlein, GFW. Goat milk in human nutrition. Small Ruminant Research. 2004; 51: 155-163.
  5. 6.     Iqbal E, Bakht B, Khan MT, Mirza MA. Goat-A potential dairy animal: present and future prospects; Pakistan Journal of Agriculture Science. 2008; 45(2): 227-230.
  6. 7.     Baidar Khan B, Iqbal A, Mustafa MI. Sheep and goat production.b Department of Livestock Management University of Agriculture Faisalabad. 2003; 18-28.
  7. 8.     Davis GH, Balakrishnan L, Ross IK, Wilson T, et al. Investigation of the Booroola (FecB) and Inverdale (FecXI) mutations in 21 prolific breeds and strains of sheep sampled in 13 countries. Animal Reproduction Science. 2006; 92: 87–96.
  8. 9.     Polley S, Dea S, Batabyal S, Kaushik V, et al. Polymorphism of fecundity genes (BMPR1B, BMP15 and GDF9) in the Indian prolific Black Bengal goat. Small Ruminant Research. 2009; 85: 122–129.

2.     Montgomery GW, Galloway SM, Davis GH, McNatty KP. Genes controlling ovulation rate in sheep. Reproduction. 2001; 121: 843–852.

10. Hua GH, Chena SL, Ai JT, Yang LG. None of polymorphism of ovine fecundity major genes FecB and FecX was tested in goat. Animal Reproduction science. 2008; 108: 279-286.

11. McNatty KP, Galloway SM, Wilson T, Smith P, et al. Physiological effects of major genes affecting ovulation rate in sheep. Genetics Selection Evolution. 2005; 37(1): S25–S38.

12. Hanrahan JP, Gregan SM, Mulsant P, Mullen M, et al. Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries). Biology of reproduction. 2004; 70: 900–909.

13. Davis GH, Galloway SM, Ross IK, Gregan SM, et al. DNA Tests in Prolific Sheep from Eight Countries Provide New Evidence on Origin of the Booroola (FecB) Mutation. Biology of Reproduction. 2002; 66(6): 1869-74.

14. Mohammadi G, Saberivand A. [Modified Method to Extract DNA from Mammalian Whole Blood for mathods based PCR]. Iran Veterinary Journal. 2012; 8(2): 93-100. Persian

15. Cui HX, Zhao SM, Cheng ML, Guo L, et al. Cloning and expression levels of genes relating to the ovulation rate of the Yunling black goat. Biology of Reproduction. 2009; 80 (2): 219–226.

16. Mohammadi G, Alimahmoudi M. [Determination of Polymorphism of FecB gene in Najdi and native goats of Khouzestnian province by PCR-RFLP]. Iranian Veterinary and Laboratory Journal. 2009; 3(1): 13-20. Persian

17. Guan F, Liu SR, Shi GQ, Yang LG. Polymorphism of FecB gene in nine sheep breeds or strains and its effects on litter size, lamb growth and development. Animal Reproduction Science. 2007; 99: 44-52.

18. Hua GH, Yang LG. A review of research progress of FecB gene in Chinese breeds of sheep. Animal Reproduction Science. 2009; 116(1-2): 1-9.

19. Gootwine E, Reicher S, Rozov A. Prolificacy and lamb survival at birth in Awassi and Assaf sheep carrying the FecB (Booroola) mutation. Animal Reproduction Science. 2008; 108(3-4): 402–411.