تکوین بلاستومرهای منفرد جداشده از جنین‌های 2 سلولی و 4 سلولی موش به بلاستوسیست‌ جهت استخراج و تولید سلول‌های بنیادی جنینی بدون استفاده از سلول‌های تغذیه کننده

نوع مقاله: علمی - پژوهشی

نویسندگان

1 - دانشگاه خوارزمی، دانشکده علوم زیستی، گروه علوم جانوری، تهران، ایران

2 دانشگاه خوارزمی، دانشکده علوم زیستی، گروه علوم جانوری، تهران، ایران

چکیده

هدف: تعیین شرایط بهینه که در آن بلاستومرهای جنین­های 2 و 4 سلولی موش با کیفیت بالایی به بلاستوسیت تکوین پیدا کنند و تولید سلول­های بنیادی جنینی(ESC) از این بلاستوسیست­ها بدون حضور سلول­های تغذیه کننده.
مواد و روش­ها: ابتدا جنین­های 2 و 4سلولی از اویداکت­ موش­های NMRI جمع آوری شدند. بلاستومرها جدا شده و در سه وضعیت منفرد، گروهی و هم­کشتی با جنین در محیط کشت با حجم 1و5 میکرولیترکشت شدند. سپس بلاستوسیست­های حاصل، بر روی ظروف کشت پوشیده شده با ژلاتین کشت شدند تا به سلول­های ES تبدیل شوند. بیان نشان‫گرهای اختصاصی برای بلاستوسیست­ها و سلول­های ES مشتق شده به‫روش ایمونوسیتوشیمی و PCR بررسی شد.
نتایج:  ثابت شد که حجم 1 میکرولیتر بهتر از 5 میکرولیتر عمل کرد و در حالت هم­کشتی با جنین و کشت گروهی، در مقایسه با کشت منفرد نتیجه بهتری حاصل شد و درصد بلاستوسیست­های حاصل به‫طور معنی‫داری بالا بود. ارزیابی بیان Oct4 که در ناحیه ICM (توده سلولی داخلی) بلاستوسیست بیان می­شود و شمارش سلول، ثابت کرد که کمیت و کیفیت با هم افزایش می­یابد. همچنین مشخص شد که پتانسیل بلاستومرهای 4 سلولی نسبت به 2 سلولی پایین می­باشد. بلاستوسیست­های مشتق از کشت منفرد بلاستومرها توانستند در محیط اختصاصی، تبدیل به سلول­های ES شوند و این سلول­ها توانایی تمایز به سلول­های مختلف را هم نشان دادند.
نتیجه­گیری: روش مطالعه حاضر برای بررسی پتانسیل تکوینی بلاستومرها و تولید سلول­های ES می­تواند برای سایر گونه­ها کاربرد داشته باشد. تولید سلول­های ES بدون سلول­های تغذیه کننده، در مورد انسان موضوع بسیار پراهمیت و پر چالشی می­باشد.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

در رده پستانداران، لقاح از نوع داخلی بوده و بعد از ورود اسپرم به دستگاه تناسلی موجود ماده، شروع به مهاجرت به‫سمت لوله‫های تخمک­بر نموده و بعد از مواجهه با تخمک، آن را بارور می­نمایند و سپس مراحل کلیواژ یا تسهیمات سلولی آغاز می­شود و تا مرحله تشکیل بلاستوسیست پیش می­رود و پس از خروج از پوشش شفاف زوناپلوسیدا که اطراف جنین را فرا گرفته، لانه­گزینی صورت می­گیرد و تکوین پیشرفته شروع می­شود (1). بلاستوسیست دارای دو نوع جمعیت سلولی می­باشد، توده سلولی داخلی  (Inner cell mass, ICM) که از جمله نشان‫گرهای اختصاصی آن، Oct4 بوده و ساختارهای جنینی و خارج جنینی را تشکیل می­دهد و تروفکتودرم (TE) که جفت مادر و جنین را ایجاد می­کند (1و2). در مراحل ابتدایی پیش از لانه گزینی شامل مراحل 2 سلولی و 4 سلولی، هر کدام از سلول­ها یا همان بلاستومرهای منفرد، دارای ظرفیت تکوینی همه­توان می‫باشند، به این معنی که قادر هستند تا در شرایط رشد و نموی مناسب، به تنهایی تکوین پیدا کرده و تبدیل به یک بلاستوسیست شوند (1). در سال 1959 طی یک مطالعه­ای نشان داده­ شد زمانی‫که بلاستومرهای منفرد مراحل 2 یا 4 سلولی در داخل پوشش زوناپلوسیدای خالی قرار داده شوند و سپس به رحم جاندار انتقال یابند، پس از چند روز، تشکیل بلاستوسیست و حتی لانه­گزینی مشاهده می‫شود (3). درصد بسیار پایینی از تولد نیز مشاهده شد که فقط حاصل از بلاستومرهای مرحله 2 سلولی بودند (16 درصد). مطالعه مشابه بر روی بلاستومرهای 4 سلولی و 8 سلولی موش صورت گرفت که مانند مطالعه قبل، فرایند لانه­گزینی قابل مشاهده بود اما در این مورد تولدی گزارش نشد (4). در بعضی از مطالعات دیگر بلاستومرهای مراحل 2 یا چند سلولی، با انواع همتای خود از یک فنوتیپ دیگر جفت می‫شدند و در این صورت تکوین جنین با موفقیت صورت می­گرفت و بازدهی تقریبا 70 درصدی نشان می­داد (5). در دو مطالعه اول، محققین اشاره به این واقعیت داشتند که بلاستوسیست‫های مشتق از بلاستومرهای منفرد، اندازه قطر کوچک‫تری نسبت به انواع مشتق از جنین­های کامل یا Intact دارند و بنابراین بلاستوسیست­های مشتق از بلاستومرهای منفرد تعداد سلول‫های کمتری دارند که این موضوع یکی از دلایل اصلی عدم تکوین کامل بلاستومرها تا تشکیل و تولد نوزاد معرفی شد. این در حالی است که در مطالعه Kelly این مساله وجود نداشت. در تایید این موضوع، به‫ترتیب بلاستومرهای منفرد جنین­های انسانی و موشی از مراحل مختلف جنینی، در شرایط آزمایشگاهی مورد مطالعه قرار گرفتند و مشاهده شد که هرچه بلاستومرها از جنین­های مراحل پیشرفته­تر جداسازی می‫شوند، در نتیجه تکوین، بلاستوسیست­های کوچک‫تری حاصل می­شود. در این دو مطالعه، انتظار می­رفت که شرایط مختلف کشت جنین شامل کشت گروهی جنین­ها یا کشت جنین در حجم­های مختلف محیط کشت نیز لحاظ شود، چون ثابت شده است که در کشت گروهی جنین­ها، عوامل ترشحی از سلول‫ها که مسیرهای سیگنالی مختلفی را فعال یا مهار می­کنند، در محیط تجمع یافته و باعث تکوین بهتر جنین­ها می­شوند (6 و7). به‫هر حال این پارامترها دور از نظر بوده­اند. از آن‫جایی‫که بازدهی تکوین بلاستوسیست از بلاستومرها 70 تا 80 درصد بوده­است که درصد نسبتا خوبی می­باشد، لذا بررسی چنین پارامتری نیز ضروری به‫نظر می‫رسید تا ابهامی باقی نماند.

یکی دیگر­  از موضوعاتی که در مورد بلاستومرهای منفرد مطرح می­باشد، تولید سلول­های بنیادی جنینی است که مطالعات زیادی در این زمینه صورت گرفته است (8، 9، 10 و 11). تولید این سلول­ها در انسان با محدودیت­های زیادی از جمله مسائل اخلاقی مواجه بوده است (8، 9 و 10) زیرا با روش­های قدیمی، در مورد تمامی گونه­ها، یک بلاستوسیست کامل باید از بین رود تا یک رده از سلول­های بنیادی تولید شود (12) و عملا در مورد انسان شدنی و اخلاقی نیست. روش نوین تولید این سلول­ها، با استفاده از بلاستومرهای منفرد صورت می­گیرد که از مراحل دوسلولی به بعد قابل استفاده هستند و بلاستومرها تکثیر شده و بعد از ورود به مرحله تشکیل بلاستوسیست با اندازه کوچک، ICM آن سریع تکثیر شده و  ساختار گنبدی شکل ایجاد می­کند و بعد قابل پاساژ می­باشد (13 و 14). در مطالعه اخیری که در پژوهشگاه رویان تهران انجام شد، ترکیبی از کوچک مولکول­ها، شامل SB431542 و PD0325901 که به‫ترتیب مسیرهای سیگنال سلولی TGF-β و Erk1/2 را مهار می­کنند و هر دو تحت عنوان ترکیبات R2i (Royan dual inhibitors) به‫ معنی "مهارکننده­های دوگانه رویان" نامیده می­شوند (11) مورد استفاده قرار گرفت. با مهار این مسیرها تکثیر و پرتوانی سلول­ها تقویت شده و بازدهی تولید سلول­های بنیادی جنینی نیز افزایش می­یابد. در مطالعه‫ای که انجام شده است نیز نشان داده شد که مهارکننده­گان مطرح شده با مکانیزم متیلاسیون ژنوم و مهار ژن­های تمایزی عمل می‫کنند (15) همچنین در این مطالعه، بلاستوسیست­ها بعد از این‫که جراحی ایمنی شدند و ICM جدا سازی شد، بر روی سطح پوشیده شده با ژلاتین و بدون لایه سلولی تغذیه کننده در محیط کشت حاوی R2i انتقال داده ­شده و رده سلول­های بنیادی تولید شدند.

بر اساس مطالب فوق، ابتدا دو سوال مهم برای ما مطرح می­‫شود: اول این‫که آیا شرایط کشت اعم از حجم قطره­های کشت و تعداد سلول در حجم معین می­تواند بر کمیت و کیفیت تکوین بلاستومرهای منفرد به‫خصوص افزایش تعداد سلول­های تشکیل دهنده بلاستوسیست تاثیرگذار باشد و دوم اینکه آیا پتانسیل تکوینی بلاستومرهای 2 سلولی و 4 سلولی با یکدیکر تفاوت دارد. سپس قصد داریم به این سوال پاسخ بدهیم که آیا با استفاده از محیط حاوی R2i امکان تولید رده سلول­های بنیادی جنینی از بلاستومرهای منفرد بر روی سطح پوشیده شده با ژلاتین و بدون استفاده از لایه سلولی تغذیه کننده وجود دارد یا نه؟

مواد و روش‌ها

شرایط و آماده سازی موش­های ماده جهت تخمک گذاری بهروش تزریق هورمون: نمونه حیوانی مورد استفاده در این مطالعه، موش نژاد NMRI می­باشد که از پژوهشگاه رویان تهران خریداری شدند. تمامی این موش‫ها طبق اصول و دستورالعمل­های اخلاقی حاکم بر مرکز نگه‫داری و آزمایشگاه حیوانات در پژوهشگاه رویان و دانشگاه خوارزمی نگه‫داری و تیمار شدند (کد اخلاق: IR.ACECR.REC.1396.002). موش‫های ماده 8 تا 10 هفته­ای طی تزریق هورمون‫های PMSG و HCG (Intervet, Belgium) آماده تخمک­گذاری می­شوند. تزریق هورمون اول برای تحریک تخمدان برای رشد فولیکول­ها بوده که در ساعت 12 ظهر انجام شد و دومی برای تخمک‫گذاری می­باشد که بعد از 48 ساعت تزریق شد (11). بلافاصله بعد از تزریق HCG، موش‫های ماده با موش‫های نر به‫صورت یک به یک جفت قرار داده شدند و صبح روز بعد تشکیل VP بررسی شد. موش‫هایی که از این نظر مثبت بودند به‫عنوان موش­های روز 5/0 حاملگی در نظر گرفته شدند و به‫ترتیب 24 ساعت و 36 ساعت بعد برای تهیه جنین­های 2 و 4 سلولی مورد استفاده قرار گرفتند.

 

تهیه جنین­های 2 و 4 سلولی و جدا سازی بلاستومرها: بعد از نخاعی کردن موش‫ها، اویداکت­ها خارج شده و توسط سرنگ انسولین و با سرسوزن G:30 فلاش شده و جنین­ها جمع آوری شدند (11). برای جابه‫جایی جنین­ها در محیط، از پیپت دهانی استفاده شد که از چندین بخش تشکیل می‫شود شامل یک پیپت پاستور شیشه­ای که انتهای آن توسط شعله کشیده شده و به‫صورت مجرای موئینه شکل می­گیرد و یک شیلنگ نازک به آن وصل است که به‫واسطه یک فیلتر 2/0 با نیروی دم و بازدم ملایم می­توان جنین­ها را جابه‫جا کرد. جنین­ها بعد از این‫که در قطره­های PBS شست و شو داده شدند، به قطره آنزیم پروتئاز E انتقال پیدا کردند تا پوشش زوناپلوسیدا هضم شود. در مرحله بعد، جنین­های فاقد زوناپلوسیدا، به‫وسیله پیپت پاستور با نوک موئینه و تنگ شده با شعله، پیپتاژ شده و بلاستومرها از هم جدا شدند.

کشت بلاستومرها در گروههای مختلف با شرایط متفاوت  

 بلاستومرها در محیط کشت T6 (16) که یک محیط استاندارد برای جنین می­باشد، کشت داده شدند. این محیط حاوی مکمل­های مهم شامل: اسیدهای آمینه ضروری (EAA، Sigma)، اسید‫های آمینه غیر ضروری ( NEAA, Sigma)، گلوتامین (L-GLn, Sigma) و سرم جنین گاوی (BSA, Sigma) می­باشد. در قدم اول تعیین حجم بهینه کشت مورد ارزیابی قرار گرفت. در این مرحله، تاثیر حجم‫های 1 و 5 میکرولیتری با یکدیگر مقایسه شد که در هر قطره، یک  بلاستومر جدا شده از جنین 2 سلولی قرار گرفت و به‫مدت 3 روز در انکوباتور کشت داده شد. در مرحله بعد، بر اساس نتایج به‫دست آمده، حجم 1میکرولیتری انتخاب شد و بلاستومرها در سه گروه کشت داده شدند. گروه اول کشت منفرد در قطره، گروه دوم کشت گروهی در قطره (دو بلاستومر در قطره) و گروه سوم هم کشتی با جنین (یک بلاستومر با یک جنین کامل یا Intact در قطره) بود. در یک گروه هم یک جنین کامل یا Intact در قطره 1 میکرولیتری کشت داده شد که به‫عنوان گروه کنترل در نظر گرفته شد تا بقیه گروه­ها نسبت به آن مقایسه شوند. قطره­ها در پلیت مخصوص کشت باکتری قرار داده شده که روی آن‫ها روغن مخصوص به‫نام Mineral oil ریخته شد تا هم مانع نفوذ آلودگی شود و هم از تبخیر قطره­ها جلوگیری نماید. تمام گروه­ها در 40 تکرار تکنیکی و 3 تکرار بیولوژیک انجام شدند. گروه­های کشت در انکوباتور قرار داده شدند تا بعد از 3 روز، تکوین و تشکیل بلاستوسیست بررسی شود. بررسی کمی این مرحله از کار بر اساس درصد بلاستوسیست­های تکوین یافته از بلاستومرها در گروه­های مختلف بیان شد. در مرحله بعدی، ارزیابی کیفیت بلاستوسیست­ها بر اساس میزان بیان Oct4 ارزیابی شد. این ارزیابی براساس شمارش سلول­های ناحیه ICM و TE مشخص شد. برای انجام آزمون رنگ‫آمیزی ایمونوفلئوروسنت، از روش­های استاندارد استفاده شد. به‫منظور ایجاد رنگ زمینه، هسته تمامی سلول­ها با DAPI (Sigma) رنگ آمیزی شد. آنتی­بادی‫های استفاده شده شامل آنتی بادی اولیه  Rat anti-mouse Oct4 (Abcam) و آنتی‫بادی ثانویه Donkey anti-rat (Abcam) می­باشند. 

کشت بلاستوسیست­ها برای تولید سلول­های ES، بدون استفاده از سلولهای تغذیه­کننده: بلاستوسیست‫های تکوین یافته، به ظروف کشت پوشانده شده با ژلاتین (Sigma) (که با غلظت 1/0 درصد به‫مدت 15 دقیقه انجام شد) و حاوی محیط کشت ویژه سلول­های ES انتقال داده شدند. این محیط کشت، از محیط­های پایه   (Gibco) DMEM-F12 و (Gibco) Neuro Basal  با نسبت 1:1 تشکیل شده است. همچنین شامل مکمل­های (Sigma)NEAA (1X)  ، (Sigma) L-Glutamin (1X)، (Gibco) B27 (1X) ، (Gibco) N2 (1X) ، Mouse Lif (Royan-bio-tech)، BSA (Sigma)، ترکیبات R2i شامل (Sigma)  SB431542 (10µM) و (Sigma)PD0325901 (1µM)  می­باشد. این محیط همچنین تحت عنوان محیط N2B27 نامیده می­شود.

پاساژ سلول­های بنیادی جنینی تولید شده: برای پاساژ یا انتقال سلول­های بنیادی جنینی، ابتدا محیط روی سلول‫ها را کشیده و بعد به‫مدت 2 دقیقه با بافر PBS شست­وشو داده شدند. بعد PBS کشیده شده و آنزیم Trypsin-EDTA (Gibco) با غلظت x1 اضافه شد تا سلول­ها  از سطح جدا شوند. در مرحله بعد برای خنثی سازی اثر آنزیم، محیط حاوی FBS (Gibco) به آن اضافه شد و بعد به‫وسیله محیط اصلی N2B27 به حجم رسید تا بین ظروف کشت پوشانده شده با ژلاتین تقسیم شود.

القای تمایز به دودمان­های اکتودرمی، مزودرمی و اندودرمی در شرایط in vitro: روش‫های القای تمایز در سلول­های ES، طبق مطالعه اخیر صورت گرفت (11).  ابتدا سلول‫ها در پاساژهای بین 10 تا 15 با تاثیر آنزیم از ظرف کشت جدا شدند و پس از شمارش به‫وسیله لام نئوبار، به غلظت 800 سلول بر میلی­لیتر، در محیط تمایزی سلول‫های بنیادی جنینی موشی با روش قطره معلق به‫مدت 3 روز در انکوباتور قرار داده شدند تا سلول­ها تجمع یافته و اجسام شبه جنینی (Embryoid bodies) تشکیل شود. محیط تمایزی DMED-High Glucose حاوی (1%)L-Glutamin، NEAA (1 درصد) و FBS (15 درصد) بود. برای تمایز اکتودرمی-عصبی در روز سوم تمایز، اجسام شبه جنینی وارد محیط تازه حاوی رتینوئیک اسید (2 میکرومولار) می­شوند. در این‫حالت، کشت به‫صورت سوسپانسیونی در داخل ظروف کشت باکتری انجام شد و تجمعات سلولی در محیط به‫صورت شناور و معلق بودند. اجسام جنینی که در این محیط به سرنوشت عصبی القا می­شوند، تا 7 روز در این محیط، کشت داده شدند و هر دو روز یک­بار نصف محیط تجدید شد. سپس تجمعات سلولی القا شده بعد از 7 روز به ظروف 4 خانه پوشیده شده با ژلاتین منتقل می­شوند تا سلول­ها گسترش یافته و استطاله­های خود را نشان دهند. برای تمایز مزودرمی (عضله قلبی)، تجمعات سلولی یا اجسام شبه جنینی، با روش فوق تولید شدند با این تفاوت که در محیط تمایزی از همان ابتدا از اسید آسکوربیک با غلظت 1/0 میکرومولار استفاده شد. در روز سوم، تجمعات سلولی به‫داخل ظروف کشت باکتری و در همان محیط کشت انتقال پیدا کردند و 3 روز دیگر در این محیط کشت داده شدند. بعد تجمعات سلولی به ظروف کشت 4 خانه پوشیده شده با ژلاتین و در محیط کشت تمایزی انتقال پیدا کردند. 1 تا 5 روز دیگر تجمعات چسبیده و تپنده و ضربان‫دار قابل مشاهده بودند. برای انجام تمایز اندودرمی، از محیط N2B27 بدون R2i و Lif برای تولید تجمعات سلولی یا اجسام شبه­ جنینی استفاده شد. بعد از 3 تا 4 روز، Activin A نیز به‫میزان 50 نانوگرم در میلی­لیتر به محیط اضافه ­شد و به‫مدت 5 روز با همین ترکیب فرایند کشت ادامه پیدا کرد. سپس اجسام شبه جنینی القا شده به ظروف کشت 4 خانه پوشیده شده با ژلاتین محتوای همان نوع محیط کشت انتقال پیدا کردند. بعد از 72 ساعت سلول­های اندودرمی با ظاهر ویژه خود مشخص بودند.

تمایز در شرایط In vivo؛ تشکیل تراتوما: برای این‫کار، سلول­ها بعد از تیمار آنزیمی و جدا شدن از سطح ظرف کشت، به تعداد 10 میلیون، در ناحیه زیر پوست پشتی موش Nude که سیستم ایمنی آن کاملا از کار افتاده تزریق شد (4). بعد از 20 روز در ناحیه مذکور، توده­ای به‫شکل برآمدگی زیر پوست تحت عنوان تراتوما تشکیل شد. بافت تراتوما از زیر پوست خارج شده و بعد از آماده سازی، برش‫گیری و رنگ‫آمیزی به‫روش هماتوکسیلین-ائوزین بر روی لام، زیر میکروسکوپ بررسی شد.

بررسی بیان نشانگرهای اختصاصی بهوسیله روش ایمونوسیتوشیمی: انجام این تکنیک بر اساس روش­های استاندارد گزارش شده در مقالات صورت گرفت (11،15). آنتی­بادی‫های اولیه که در این مطالعه استفاده شدند عبارت‫اند از: (Santacruz)anti-Oct4، (Santacruz) anti-Nanog، (Abcam) anti-sox2، (Abcam) anti-GFAP، (Abcam)anti-Faxa2 و (Abcam)anti-Nkx2.5. آنتی­بادی­های ثانویه نیز عبارت­اند از: Alexa fluor 488 donkey anti-mouse immunoglobulin G (Abcam) و Alexa fluor 568 goat anti-mouse immunoglobulin M (Abcam). برای ایجاد رنگ زمینه، هسته تمام سلول­ها با رنگ فلئورسنت DAPI (Sigma) رنگ­آمیزی شد و زیر میکروسکوپ فلئورسنس (Olympus) مشاهده شد.

ارزیابی بیان ژن در سطح mRNA: در این مرحله از کار، ابتدا توسط محلول Trizol، RNA کل سلول­ها استخراج شد و جهت دو رشته­ای کردن نمونه­های RNA و ساختن cDNA از کیت استفاده شد (Fermentase). پرایمرهای اختصاصی به‫صورت آنلاین و در سایت https://www.ncbi.nlm.nih.gov/pubmed/ طراحی شدند که در جدول1 نشان داده شده ­است. جهت بررسی وجود mRNA های مورد نظر، از روش واکنش زنجیره­ای پلیمراز (PCR) استفاده شد که تمام اصول آن بر اساس مطالعات اخیر صورت گرفت (9و4). در نهایت برای ارزیابی نهایی، محصولات PCR بر روی ژل آگار با غلضت 1 درصد الکتروفورز شده و سپس به‫کمک GelRed (Sinagene) رشته­های DNA ظاهر شده و باندهای تشکیل شده برای بیان ژن­های اختصاصی اکتودرمی، اندودرمی و مزودرمی مورد ارزیابی قرار گرفتند.

 

 

جدول1: پرایمرهای Forward و Reverse برای نشانگرهای مختلف جهت بررسی بیان ژن در سطح mRNA

Tm

Reverse primer

Forward primer

 

61

GACAAGCTGGAAAGGTGTGG

TTGTCCCAATACAGGCTCACC

Gfap

59

ATGAGCAACCTCTTCGGGTG

CTAGGCTAGGCATTCCCGTG

S100β

60

GTAGTAGCTGCTCCAGTCGG

GCACTCGGCTTCCAGTATGC

Foxa2

60

CTTGGAAAGTTCGGGTCCCA

AGAAGTACGGACATTCATGAACAA

αFP

60

GAGAGGCACAACTCGCTCAA

AGAGCTTCCACCTAGGGACT

Gata4

61

CTCGGTGAGAACCTGCGTTT

AGCGAGTTCCAGAGCAATCT

T

60

CGGTGAGAACTCTTCGGG

ACGGACATTCTCCCAAT

Gapdh

 

 

آنالیز داده­ها

تصاویر مربوط به بلاستوسیست­ها توسط میکروسکوپ نوری یا فلئورسنس معکوس شرکت Olympus گرفته شد. دوربین و نرم­افزار استفاده شده مربوط به‫همین میکروسکوپ، نسخه DP2-BSW بود که قطر بلاستوسیست­ها توسط آن اندازه­گیری شد. آنالیز داده­های به‫دست آمده به‫وسیله نرم افزار Spss16 و با روش ANOVA دوطرفه برای آنالیزهای دو متغیره و یک‫طرفه برای آنالیزهای تک متغیره صورت گرفت. جهت مشخص نمودن تفاوت بین گروه­های مختلف با یکدیگر، از تست Tukey به‫عنوان Post hoc استفاده شد. برای مقایسه داده‫ها به‫صورت دو به دو، آزمون (t) مورد استفاده قرار گرفت.  

 

نتایج

حجم 1 میکرولیتری بهعنوان حجم بهینه برای کشت بلاستومرها

در این بخش از مطالعه، دو حجم 1 و 5 میکرولیتر با محیط کشت T6 مورد آزمون قرار گرفتند. محیط T6 یکی از محیط­های استاندارد برای کشت جنین می­باشد. برای این مرحله از کار،  بلاستومرهای جدا شده از جنین­های 2 سلولی استفاده شدند که در هر کدام از قطره‫های گروه­های

 

1 و 5 میکرولیتری، 1 عدد بلاستومر قرار داده شد (40n= ). نتایج حاصل نشان داد که تعداد بلاستومرهایی که در قطره‫های 1 میکرولیتری به بلاستوسیست تکوین پیدا کرده بودند [(5/32 درصد) 40/13] حدودا 2 برابر قطره­های 5 میکرولیتری بودند [ (15 درصد)40/6] و نسبت به‫دست آمده برابر 1/2 بود (05/0p<، شکل1). بنابراین حجم 1 میکرولیتری به‫عنوان حجم بهینه برای ادامه بررسی­ها مورد استفاده قرار گرفت.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


شکل1: تاثیر حجم کشت بر روند تکوین بلاستومرها. بلاستومرهای جدا شده از جنین­های 2 سلولی در دو حجم 1 و 5 میکرولیتری در هر گروه به تعداد 40 عدد کشت داده شدند. بلاستوسیست­های حاصل در حجم 1 میکرولیتری، 1/2 برابر حجم 5 میکرولیتری بودند. این بررسی در سه تکرار بیولوژیک صورت گرفت و آنالیز آماری با استفاده از آزمون (t) انجام شد  و دادهها بهصورت Mean±SD نمایش داده شده است. 05/0*p<.

 

 

 

 

 

تکوین بلاستومرهای جدا شده از جنین­های 2 و 4 سلولی در شرایط مختلف کشت

در این مرحله، بلاستومرها در سه گروه کشت منفرد، کشت گروهی و هم­کشتی با جنین مورد بررسی قرار گرفتند (شکل2 الف). نتایج نشان داد که  بلاستومرهای جدا شده از جنین­های 2 و 4 سلولی، در گروه­های هم­کشتی جنین و کشت گروهی، نسبت به گروه کنترل تفاوت معنی داری نشان نمی­دهند اما در مقایسه با کشت منفرد، نتیجه بهتری نشان می­دهند که تفاوت بین آن‫ها معنی‫دار بود (05/0p<)، برای هر گروه، n=40) و نتایج مربوط به این ارزیابی در شکل نشان داده شده است (شکل2 ب و ج).

 

 

 

 

 

 

کشت منفرد

هم کشتی با جنین

بلاستومر 4 سلولی

بلاستومر 2 سلولی

کشت گروهی

الف

 

 

 

 

 

 

 

 

 

 

ب

 

 

 

 

 

 

 

 

 

 

 

 

ج

 

 

 

 

 

 

 

 

 

 


شکل2: کشت بلاستومرهای منفرد در شرایط مختلف. بلاستومرهای 2 و 4 سلولی در شرایط مختلف کشت داده شدند که شامل حالت منفرد (یک بلاستومردر قطره 1 میکرولیتری)، کشت گروهی (دو بلاستومر در قطره 1میکرولیتری) و هم­کشتی با جنین (یک بلاستومر و یک جنین2 یا 4 سلولی در قطره 1 میکرولیتری) بود (الف). در هر کدام از گروه­ها 40 عدد بلاستومر کشت داده شدند و این بررسی در سه تکرار صورت گرفت. قطرههای حاوی جنینهای 2 یا 4 سلولی نیز بهعنوان گروه کنترل برای آنالیز آماری در نظر گرفته شدند. نتایج بهصورت Mean±SD نمایش داده شد. تفاوت بین گروههای مختلف بهوسیله تست Tukey مشخص شده و حروف کوچک انگلیسی نشان دهنده اختلاف بین گروه­ها می­باشندکه عبارت­اند از: گروه 2 سلولی (ب) a,b : 05/0p<  ؛ گروه 4 سلولی (ج)،  05/0p<  a,b: ،  01/0p<  a,c: . خط مقیاس: µm50

 

 

 

 

مقایسه ظرفیت تکوینی بلاستومرهای جداشده از جنین­های 2 سلولی و 4 سلولی

مانی­که تمام داده‫های فوق برای بلاستومرهای 2 سلولی و 4 سلولی در.وضعیت­های مختلف کشت، با آزمون (t) با یکدیگر مقایسه شدند، مشخص شد که بلاستومرهای 2 سلولی به‫طور معنی‫داری در مقایسه با بلاستومرهای 4 سلولی ظرفیت تکوینی بالایی دارند (شکل3 الف). در مرحله بعد، بلاستومرهای جفت جنین 2 سلولی و 4 تایی جنین 4 سلولی بر اساس قطر بلاستوسیست­های حاصل، مورد ارزیابی قرار گرفتند و مشخص شد که هر دو بلاستومر­ مربوط به جنین­های 2 سلولی که هردو در یک قطره کشت قرار داده شدند، ظرفیت تکوینی یکسانی نشان دادند یعنی بلاستوسیست­های مشتق از آن‫ها قطر مساوی داشتند (1/4 ± 6/89، 40=n ) که نسبت به بلاستوسیست­های کنترل تفاوت معنی­داری نشان ندادند (1/3 ± 5/98، 5/0p<، 40=n). این در حالی است که چهار بلاستومر از یک جنین 4 سلولی پس از تکوین به بلاستوسیست، به‫صورت دو جفت با اندازه قطر متفاوت و معنی‫داری بوده و نسبت به کنترل نیز کمتر بوده و تفاوت معنی‫داری نشان دادند (8/3 ± 2/69 و 5/4 ± 1/32 ؛ 5/0p<، 40=n). (شکل3 ب،ج).

 

 

ب

ج

الف

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


ش

 

 

 

 

شکل3: مقایسه ظرفیت تکوینی بلاستومرها. الف) مقایسه درصد بلاستوسیست­های تکوین یافته از بلاستومرهای 2 سلولی و 4 سلولی. ب، ج) مقایسه قطر بلاستوسیست­های مشتق از بلاستومرهای جفت جنین 2 سلولی و چهارتایی جنین 4 سلولی. بلاستومرهای 4 سلولی از نظر اندازه دو جفت می­باشند (P1 , P2) در حالی که بلاستومرهای جفت 2 سلولی تفاوتی باهم نداشتند.نتایج به صورت Mean±SD نمایش داده شد. 05/0*p<،   01/0**p<. خط مقیاس: µm50

 

بررسی کیفیت بلاستوسیست­ها بر اساس تعداد سلول­های تشکیل دهنده ICM و TE

*

شمارش سلول

** 

*

تعداد سلول­ها در بلاستوسیست­های تکوین یافته براساس رنگ آمیزی هسته سلول و نیز مارکر اختصاصی سلول­های ICM شمارش شد. در این حالت هسته تمام سلول­ها با DAPI که رنگ فلئورسنت آبی می­باشد مشخص شد. درحالی‫که نشان­گر اختصاصی بخش ICM یعنی OCT4، هم با رنگ آبی DAPI و هم با رنگ فلئورسنت سبز (FITC) مشخص بودند (شکل4 الف). در این فرایند، 4 پارامتر مورد نظر بود که عبارتند از: تعداد کل سلول­ها (TCN)، سلول‫های TE، سلول­های ICM و نسبت تعداد سلولهای ICM بر سلول­های TE (ICM:TE). با توجه به آزمایشات انجام شده مشاهده گردید که TCN در بلاستوسیست­های مشتق از بلاستومرهای 2 سلولی و 4 سلولی در تمام شرایط کشت نسبت به گروه کنترل یا همان جنین­های Intact کاهش معنی­داری نشان داد. تعداد سلول­های ICM و TE در گروه 4 سلولی و فقط TE در گروه 2 سلولی در تمامی شرایط کشت نسبت به گروه کنترل کاهش نشان دادند، این در حالی است که در گروه 2 سلولی، تعداد سلول­های ICM حاصل از کشت بلاستومرهای منفرد در حالت کشت گروهی و هم­کشتی با جنین، کاهش معنی‫داری نشان نداد ولی در حالت کشت منفرد کاهش معنی­داری نشان داد (شکل4ب و ج).

 

 

 

 

 

 

 

 

 

 

الف

ب

 ج

شمارش سلول

 د

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


شکل4: بررسی بیان نشانگر Oct4 و شمارش سلول. Oct4 نشانگر اختصاصی ناحیه ICM در بلاستوسیست می­باشد که بهروش ایمنی رنگآمیزی شد و سلولهای مثبت نسبت به تمام سلول­ها شمارش شدند (الف). پارامترهای مورد نظر شامل TCN (جمعیت کل سلول­ها)، سلول­های ICM، سلول­های TE ب) و نیز نسبت ICM به TE (TCM:TE) (ج).نتایج بهصورت Mean±SD نمایش داده شد. (د) تفاوت در نسبت تعداد سلول­های ICM به TE برای هر گروه در مقایسه با گروه جنین­های Intact. و نیز  05/0*p<، 01/0**p<، 001/0***p<. خط مقیاس: µm50

 

 در بررسی پارامتر ICM:TE، مشاهده شد که بلاستوسیست­های مشتق از بلاستومرهای2 و 4 سلولی که در شرایط منفرد کشت داده شده بودند و نیز بلاستوسیست‫های مشتق از هم­کشتی بلاستومرهای 4 سلولی با جنین نسبت به گروه کنترل تفاوت معنی‫داری نشان دادند (05/0*p< ، 01/0**p<، 001/0 ***p<) (شکل 4 د). تفاوت بین بقیه گروه‫ها نسبت به‫یکدیگر نیز در این شکل نشان داده شده­است.

تولید سلول­های ES بر روی سطح پوشیده شده با ژلاتین

در مرحله بعد برای نشان دادن اینکه بلاستوسیست­ها دارای کیفیت و عملکرد برای کاربرد را دارند، جهت تولید رده سلول­های ES مورد استفاده قرار گرفتند. بعد از انتقال بلاستوسیست­ها به محیط کشت اختصاصی ESC در ظروف پوشانده شده با ژلاتین، مشاهده شد که بعد از 5 روز، به سطح ظروف چسبیدند و سلول­های TE به‫طور کامل بر روی سطح گسترده شدند اما سلول­های ناحیه ICM، به‫صورت تجمعات گنبدی شکل قابل تشخیص بودند (شکل5).

 

بلاستوسیست

برون رشد بر روی ژلاتین

پاساژ 10

جنین Intact

بلاستومر جنین 2 سلولی

بلاستومر جنین 4 سلولی

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


شکل5: تولید رده سلول­های بنیادی جنینی از بلاستوسیست­های مشتق از بلاستومرها. الف) مقایسه تکوین بلاستومرهای منفرد در محیط­ T6 و T6+R2i. آنالیز داده‫ها به‫وسیله آزمون (t) صورت گرفت. p<0.05. ب) جنین­های Intact و بلاستومرهای جدا شده از جنین­های 2 سلولی و 4 سلولی در قطره­های 1 میکرولیتری محیط T6+R2i کشت داده شدند و بعد از 5/2 روز به بلاستوسیست تکوین پیدا کردند. سپس بلاستوسیست­ها به ظروف پوشیده شده با ژلاتین و حاوی محیط N2B27+R2i منتقل شدند و بعد از 5 روز برون رشد سلول­های ES مشاهده شد که این ساختار­ها تحت تیمار آنزیمی پاساژ داده شده و کلونی­های ویژه سلول­های بنیادی جنینی را تولید نمودند. خط مقیاس: mµ50

 

 

این سلول­ها بعد از اولین پاساژ، در محیط گسترده شده و تمام سطح ظرف کشت را پوشاندند (شکل5). درصد بلاستوسیست­های مشتق از بلاستومرهای 2 سلولی، 4 سلولی و جنین­های 2 سلولی به‫عنوان گروه کنترل به ترتیب برابر بود با 63، 27 و 90 (جدول2). بعد از این‫که بلاستوسیست­ها به محیط کشت اختصاصی سلول­های ES منتقل شدند، درصد بلاستوسیست­هایی که برون­رشدOut growth) ) نشان داده­ بودند به‫ترتیب فوق برابر بودند با3/58، 40 و 100 (جدول2)  و از این تعداد نیز به‫ترتیب 100، 75 و 100 درصد موارد تبدیل به سلول­های ES شدند (جدول2).

 

 

جدول2: درصد بلاستوسیست­های تکوین یافته از بلاستومرها و سلول­های بنیادی جنینی تولید شده

SB/Embryo

NO

Culture volume (µl)

*BL rate (%)

Outgrowth (%)

Established ESC line (%)

Intact 2-cell

 10

 5

 9/10 (90)

 9/9 (100)

 9/9 (100)

 2-cell SB

 38

 1

 24/38 (63.1)

 14/24 (58.3)

 14/14 (100)

 4-cell SB

 36

 1

 10/36 (27.7)

 4/10 (40)

 3/4 (75)

 

 

 

 

 

 

 

 

*BL: blastocyst

 

 

بیان نشانگرهای اختصاصی سلول­های ES

سلول­های بنیادی جنینی همچنین تحت عنوان سلول­های بنیادی پرتوان نامیده می­شوند که ویژگی­های بیان ژنی مختص خود را دارند. از جمله این ژن­ها که در این مطالعه نیز بیان آن‫ها در سطح پروتئین مورد ارزیابی قرار گرفته­ است شامل Oct4، Nanog و Sox2 هستند و در شکل 6 الف، نتیجه رنگ­آمیزی به‫روش ایمونوسیتوشیمی این نشانگرهای پروتئینی داخل هسته­ای نشان داده شده است که به‫واسطه رنگ­های فلئورسنتی قرمر (Alexa Flour 568) و سبز (Alexa Fluor 488) مشخص می­باشند. دیگر نشانگر اختصاصی سلول­های بنیادی پرتوان، آلکالین فسفاتاز(ALP) می­باشد که نتیجه رنگ­آمیزی آن نیز مثبت بود (شکل6 ب). 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

سلول­های ES مشتق از

سلول­ای ES مشتق از

Oct4/DAPI

Nanog/DAPI

Sox2/DAPI

الف 

بلاستومر2 سلولی

بلاستومر4 سلولی

ALP

بلاستومرهای 2 سلولی

بلاستومرهای 4 سلولی

ب

 

 

 

 

 

 

 

 

 

 

 

 



شکل6: بررسی بیان نشانگرهای پرتوانی در سلول­های ES. الف) نشانگرهای Oct4، Nanog و Sox2 جزو عوامل رونویسی داخل هسته­ای می­باشند که به‫روش ایمونوسیتوشیمی و با مواد فلئورسنت سبز(Alexa Flour 488) و قرمز (Alexa Flour 568) کونژوگه شده با آنتی­بادی، رنگ‫آمیزی شدند. رنگ آبی فلئورسنت اختصاصی برای هسته سلول­، به‫وسیله DAPI برای رنگ­آمیزی زمینه استفاده شد. ب) الکالین­فسفاتاز یکی دیگر از نشانگرهای اختصاصی در این سلول­ها می­باشد که با استفاده از کیت مخصوص رنگ‫آمیزی شده و به‫رنگ ارغوانی مشخص می­باشد. خط مقیاس: mµ50

 

 

 

بیان نشانگرهای تمایزی پس از القای تمایز در سلولهای ES در شرایط in vivo

سلول­های ES بعد از القای تمایز به دودمان­های اکتودرمی، اندودرمی و مزودرمی، از نظر مورفولوژی و بیان نشانگرهای تمایزی مورد ارزیابی قرار گرفتند و با استفاده از روش ایمونوسیتوشیمی، نشانگرهای اختصاصی برای این سلول­ها به‫ترتیب فوق شامل GFAP، Foxa2 وNkx2.5 رنگ­آمیزی شدند و همگی با رنگ فلئورسنت­ سبز (Alexa Fluor 488) مشخص می­باشند (شکل7 الف). برای ارزیابی بیان ژن در سطح mRNA، از روش RT-PCR نیز استفاده شد که نشانگرهای gfap و S100β (برای آستروسیت)، T و Gata4 (برای مزودرم) و ژن­های Foxa2 و αFP (برای اندودرم) برای این منظور مورد بررسی قرار گرفتند (شکل7 ب).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

الف

Teratoma tissue

ج

Ectoderm

(Neural rosette)

Endoderm

(Gastrointestinal tract)

Mesoderm

(Cartilage)

2 سلولی

4 سلولی

Gfap

S100β

Foxa2

αFP

Gata4

T

Gapdh

ب

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


شکل7: بررسی ظرفیت تمایزی سلول­های ES. الف) نشانگرهای GFAP، Foxa2 و Nkx2.5 به‫ترتیب برای دودمان­های اکتودرمی-عصبی، اندودرمی و مزودرمی-قلبی مورد بررسی قرار گرفتند که  با ماده فلئورسنت سبز (Alexa Flour 488) کونژوگه شده با آنتی­بادی، رنگ آمیزی شده و در شکل، مشخص می­باشند. رنگ آبی فلئورسنت اختصاصی برای هسته سلول­، به‫وسیله DAPI برای رنگ­آمیزی زمینه استفاده شد. ب) بیان ژن‫های ویژه تمایزی برای سه دودمان اصلی جنینی در سطح mRNA  مورد ارزیابی قرار گرفتند. Gfap و S100β برای آستروسیت (اکتودرم)، Foxa2 و αFP برای اندودرم و Gata4 و T برای پیش ساز عضله قلبی (مزودرم) مورد نظر بودند. Gapdh به‫عنوان کنترل داخلی ارزیابی شد. U: غیر تمایز یافته، D: تمایز یافته. ج) الکالین­فسفاتاز یکی دیگر از نشانگرهای اختصاصی در این سلول­ها می­باشد که با استفاده از کیت مخصوص رنگ آمیزی شده و به‫رنگ ارغوانی مشخص می‫باشد. خط مقیاس: mµ50

 

 

تمایز سلول­های بنیادی جنینی تولید شده در شرایط in vivo و تشکیل تراتوما

سلول­ها با غلظت 10 میلیون در میلی­لیتر در ناحیه زیر پوست موش Nude که فاقد سیستم ایمنی فعال بود تزریق شدند. پس از 20 روز تورم زیر پوست نشان­دهنده تشکیل تراتوما بود که حاوی سلول­های بنیادی پرتوان و سلول­های تمایز یافته از هر سه دودمان اکتودرمی، مزودرمی و اندودرمی بود. در شکل7 ج، ساختارهای اکتودرمی (Neural rosette)، مزودرمی (Cartilage) و اندودرمی (Gastrointestinal tract) نشان داده شده است.

 

بحث

در این مطالعه، نتایج به­دست ­آمده نشان دادند که کشت بلاستومرهای 2 سلولی و 4 سلولی موش در محیط کشت T6 با حجم 1 میکرولیتر صورت گرفت که بسیار کمتر از روش­های معمول می­باشد تکوین آن‫ها به بلاستوسیست را میسر می­کند. در مطالعات پیشین کشت بلاستومر بیشتر با هدف تولید سلول­های بنیادی جنینی و نیز با کمک لایه سلولی تغذیه کننده انجام می­شد (14، 22-20). گروهی از محققین نیز توانایی و پتانسیل تکوینی بلاستومرها را در شرایط in vivo و نیز در شرایط in vitro مورد بررسی قرار داده­اند که قابل بحث می­باشد. یکی از اولین کارهایی که نشان داد که یک یا چندین بلاستومر کنار هم قادر هستند یک بلاستوسیست را ایجاد کنند مطالعه تارکووسکی در سال 1959 بود (3). این محقق چنین نشان داد که اگر در مرحله 2 سلولی یا 4 سلولی جنین موش، نیمی از جمعیت بلاستومرها باقی بماند قادر هستند تا یک بلاستوسیست کامل هر چند با اندازه کوچک را ایجاد کنند. همچنین وی بلاستوسیست­های تشکیل شده درون زوناپلوسیدا را به رحم موش ماده آماده حاملگی انتقال داد و تشکیل جفت و حتی جنین زایی تا مرحله تولد را مشاهده کرد. اما بازدهی این مطالعه بسیار پایین بود و دلیل این مساله جمعیت کم سلول­های بلاستوسیست مشتق از بلاستومر منفرد بود. بنابراین در این مطالعه قصد بر این بود که روشی اتخاذ کنیم تا تکوین و تشکیل بلاستوسیست از بلاستومر منفرد هم از نظر کمیت در قالب درصد بلاستوسیست­ها و هم از نظر کیفیت در قالب تعداد سلول­های ICM و TE افزایش یابد. برای مشخص شدن این‫که عوامل ترشحی اتوکراین و پاراکراین تا چه حد می­توانند بر فرایند تکوین تاثیر مثبت داشته ­باشند، کشت بلاستومرها در سه وضعیت متفاوت انجام شد که عبارتنداز: کشت منفرد، کشت گروهی (دو بلاستومر در یک قطره) و هم­کشتی با جنین­ Intact. این آزمون نشان داد که هرچه تجمع فاکتورهای اتوکراین (در حجم کمتر) و پاراکراین (کشت گروهی و هم­کشتی با جنین) بیشتر باشد سرعت و کیفیت تکوین بلاستومرها و نیز درصد تشکیل آن‫ها نیز بیشتر می­شود (شکل2). طراحی چنین آزمایشی بر اساس مطالعات پیشین در گذشته بود که تاثیر مثبت عوامل اتوکراین و پاراکراین بر تکوین جنین را نشان داده­ بودند. در سال 2012 نشان داده شد که وقتی به محیط کشت جنین­های پیش از لانه­گزینی انسان، تعدادی از عوامل رشد و نموی که جزو عوامل اتوکراین/پاراکراین می­باشند اضافه شود، تکوین جنین­ها با سرعت و کیفیت بالایی پیش می­رود (4). در مورد جنین­های گاو نیز ثابت شده است که برهم­کنش­های اتوکراین و پاراکراینی بین جنین­های پیش از لانه­گزینی، سرعت و کمیت تکوین آن­ها را افزایش داده است (7). این بررسی به این شکل بوده که حضور بیش از یک جنین در محیط، می­توانست نتایج بهتری در مقایسه با نبود آن‫ها نشان دهد. در مطالعه حاضر نیز، اولین ایده­ی مشابه و مهمی که مطرح می­شود، کاهش حجم محیط کشت و یا افزایش تعداد جنین­ یا بلاستومر در حجم مشخصی برای تجمع سریع و بیشتر عوامل ترشحی می­باشد و تاکید اصلی مطالعات فوق بر این مبنا بوده است. به‫علاوه ثابت شده­ است که اگر تعداد جنین در یک حجم مشخص افزایش یابد باعث بهبود تکوین جنین خواهد شد (7 و 24). اما این در‫حالی است که تا به‫حال، هیچ مطالعه‫ای، تکوین بلاستومرهای منفرد در وضعیت‫های کشت مختلف شامل حالت منفرد، گروهی و هم­کشتی با جنین و با تاکید بر تاثیر عوامل اتوکراین و پاراکراین بررسی نکرده و گزارش نداده است. طراحی آزمایشی که در مطالعه حاضر صورت گرفت، به‫خوبی نشان داد که بلاستومرهای منفرد به تنهایی دارای فعالیت پیام­رسانی به‫صورت ترشح عوامل پیام‫دهنده می­باشند که این عوامل می­توانند به‫صورت اتوکراین بر روی خود سلول اثر کرده و مسیرهای سیگنال دهنده داخل سلول را به‫نفع تقویت چرخه سلولی و تکثیر، فعال می­کنند و به پیشروی تکوین آن کمک می­نمایند و این واقعیت در اولین بررسی یعنی مقایسه تاثیر حجم های 1 و 5 میکرولیتری به‫وضوح نشان داده شد. تایید بیشتر بر این موضوع این بود که در حالت دو بلاستومر در یک قطره یا هم­کشتی بلاستومر با جنین نتایج به‫مراتب بهتری مشاهده شد. هرچند ایده تاثیر اتوکراینی و پاراکراینی قبلا در مورد جنین­های Intact نشان داده شده است (7،17،23) اما نقطه قوت مطالعه ما این بود که ننایج نشان داد علاوه بر اینکه کمیت تکوین بلاستومرها با غلظت بالای فاکتورهای ترشحی، افزایش می­یابد بلکه کیفیت تکوین در قالب افزایش جمعیت سلول­های بلاستوسیست به‫خصوص سلول­های ICM نیز مشاهده می­شود. فراهم نمودن چنین شرایطی این امکان را ایجاد کرد که مقایسه ظرفیت تکوینی بلاستومرهای 2 سلولی و 4 سلولی نیز به‫طور دقیق قابل انجام باشد. توضیح بیشتر این‫که لازم بود تا هر دو بلاستومر جدا شده از جنین 2 سلولی و یا 4 بلاستومر جدا شده از جنین 4 سلولی در شرایط مشابه کشت، تکوین یافته تا وضعیت تکوینی آن‫ها مورد ارزیابی قرار گیرد. . این بررسی به این صورت بود که تعداد بلاستوسیست­های تکوین یافته از بلاستومرهای هر جنین 2 سلولی یا 4 سلولی مورد نظر قرار گرفته و قطر آن‫ها با یکدیگر مقایسه شد. آن‫چه که قابل انتظار و بدیهی بود، بلاستومرهای 2 سلولی دارای ظرفیت تکوینی بالایی بودند چون طبق داده­های ما درصد بالایی از بلاستوسیست‫های تکوین یافته را نشان دادند و نیز قطر هر دو بلاستوسیست مشتق از جفت بلاستومر 2 سلولی یکسان بود و این نتیجه، طبق مطالعه اخیر که در مورد بلاستومرهای 2 سلولی گزارش شده هم‫خوانی دارد (17). طی مطالعه­ای بر روی مراحل مختلف تکوین جنین­های پیش از لانه­گزینی موش صورت گرفت، الگوی بیان ژنی بین بلاستومرهای 2 سلولی و 4 سلولی تفاوت جزئی نشان داد (18). این تفاوت جزئی، در مطالعه ما، در قالب تفاوت در کمیت و کیفیت تکوین به بلاستوسیست خود را نشان داد. در مورد بلاستومرهای جنین­های 4 سلولی مشاهده شد که از نظر اندازه و قطر بلاستوسیست حاصل، به دو جفت تقسیم می­شوند که یک جفت آن اندازه کوچکتری داشتند. به نظر می­رسد که تکوین این بلاستومرها احتمالا فقط به‫صورت گروهی یا هم­کشتی با جنین امکان‫پذیر باشد و در شرایط منفرد امکانپذیر نباشد که شاید بتوان گفت پایین بودن درصد بلاستوسیست­های تکوین یافته حاصل از بلاستومرهای منفرد 4 سلولی در بررسی­های ابتدایی مطالعه به این خاطر بوده ­است. این واقعیت که بلاستومرهای 4 سلولی درصد پایینی در تکوین به بلاستوسیست را نشان دادند احتمالا به این دلیل است که فقط دو عدد از بلاستومرهای جنین 4 سلولی به‫خاطر این‫که ماهیت قطب جانوی دارند یعنی تماما در تشکیل جنین شرکت می­کنند، تکوین بهتری نشان می­دهند. سومین بلاستومر، جانوری-گیاهی بوده و چهارمین به‫طور کامل گیاهی می­باشد. دو بلاستومر آخر طبیعتا ظرفیت محدودی دارند. این مساله تاحدودی قابل انتظار بود چون در مطالعه­ای که در سال 2005 صورت گرفت این واقیت به‫وضوح در شرایط In vivo به اثبات رسیده است (19). در حقیقت امر، طراحی آزمایش در تجربه ما، این مساله را به طریقی ساده­ترکه بدون مداخله پارامترهایی دیگر از جمله تاثیر سلول­های مجاور یا دورتر می­باشد بیان نمود.

در قدم بعدی نشان دادیم که بلاستوسیست­هایی که از بلاستومرهای منفرد تکوین پیدا می­کنند قابلیت تبدیل شدن به رده سلول­های بنیادی را دارند. مهم‫ترین نکته از این مرحله از مطالعه، استفاده از کوچک مولکول­های SB431542 و PD0325901 تحت عنوان R2i می­باشد که به‫ترتیب مسیرهای سیگنال سلولی TGF-β و Erk1/2 را مهار می­کنند. در سال 2012 طی مطالعه­ای نشان داده شد که فعال نمودن مسیر سیگنالی TGF-β باعث سرعت­ بخشی به فرایند تمایز می­شود (23). مطالعات دیگری در این مورد نشان دادند که مسیر TGF-β علاوه براینکه باعث توقف چرخه سلولی می­شود که متعاقب آن، سلول می­تواند وارد تمایز می­شود، همچنین باعث فعال شدن مسیر آپوپتوزیس نیز می­شود (24،25). بنابراین چنین نتیجه‫گیری می­شود که مهار این مسیر سیگنالی، هم به ادامه تکوین جنین سرعت می­بخشد و هم مانع از توقف چرخه سلولی در بلاستومرها می­شود. مسیر MAPK یکی دیگر از مسیرهای سیگنالی می­باشد که بر رفتارهای مختلف سلولی از جمله آپوپتوزیس، تکثیر، تمایز و تکوین جنینی تاثیر نشان می­دهد (17). مسیر سیگنالی MAPK، انشعابات متفاوتی دارد که هرکدام موارد بالا را وساطت می‫کنند اما یکی از مهم‫ترین انشعابات این مسیر، MAPK⁄ERK1 می‫باشد که سطح بیان آن در تخمک لقاح نیافته بسیار پایین است ولی از مرحله زایگوت تا مرحله بلاستوسیست به‫تدریج رو به افزایش است، به‫ویژه در مرحله 2 سلولی که ژن­های زایگوتی شروع به بیان می­کنند، افزایش ناگهانی نشان می­دهد (19و18). این مطالعات ثابت می­کنند که این مسیر می­تواند تاثیرات مثبتی بر روند تکوین جنین داشته باشد. در مغایرت با این مطالعات، شواهدی نیز ثابت کرده­اند که مسیر MAPK/ERK1 می‫تواند باعث توقف چرخه سلولی و یا آپوپتوزیس شود (20). به‫علاوه مطالب فوق، اخیرا محققین پژوهشگاه رویان ثابت کرده­اند که مهار کردن دو مسیر سیگنالی فوق (TGF-β و MAPK⁄ ERK1) یعنی استفاده از R2i، باعث متیلاسیون بیشینه در سلول­های ES شده که مشخص ترین نتیجه این متیلاسیون، مهار تقریبا تمام ژن‫های تمایزی می‫باشد (15). در مطالعه مذکور، برای اطمینان از صحت این نتیجه­، یکی از مهم‫ترین عوامل متیلاسیون به نام متیل­ترانسفراز RG108، مهار شد و مشاهده شد که در چنین شرایطی، تاثیر قبلی R2i مشاهده نشد و بازدهی تولید سلول‫های ES کاهش پیدا کرد.

 

نتیجه‫گیری

آنچه که به‫عنوان نتیجه­گیری نهایی می­توان به آن اشاره کرد موفقیت این مطالعه در خصوص شفاف سازی و نحوه بررسی ظرفیت تکوینی بلاستومرهای 2 سلولی و 4 سلولی به‫طور مقایسه­ای بود که در سه شرایط کشت منفرد، گروهی و هم کشتی با جنین انجام گرفت. این شرایط کشت، تاثیر و اهمیت عوامل ترشحی اتوکراین و پاراکراین را مشخص می‫کنند که درصد موفقیت هم از نظر کمی (درصد تشکیل) و هم از نظر کیفی (تعداد سلول) به‫ترتیب در سه شرایط مختلف که مطرح شد بیشتر می­شود. مهم‫تر این‫که در میان نتایج به‫دست آمده، توانایی یک سلول منفرد در تولید عوامل اتوکراین و بهره­گیری از آن‫ها در فعال نمودن و تنظیم مسیرهای سیگنالی در جهت مسیر رشد و نموی نشان داده شد. در زمینه تولید سلول­های ES، می­توان یک ادعا مبنی بر این باشد که ما در این مطالعه توانستیم  سلول­های بنیادی جنینی را از بلاستومرهای منفرد  2 سلولی و 4 سلولی و بدون لایه تغذیه کننده تولید کنیم که برتری نسبی در مقایسه با سایر مطالعات نشان می­دهد و این دستاورد می­تواند در مورد گونه­های دیگر جانوری و یا حتی انسان داشته باشد که تولید سلول­های بنیادی جنینی انسانی در شرایط بدون سلول­های تغذیه کننده، یک مزیت خوب و در عین حال یک چالش جدی محسوب می­شود.

 

تشکر و قدردانی

بدین‫وسیله از عوامل و کادر محترم دانشکده علوم زیستی دانشگاه خوارزمی تشکر به‫عمل می­آید. همچنین به‫طور ویژه از جناب آقای دکتر حسین بهاروند و سرکار خانم دکنر نفیسه حسنی از پژوهشگاه رویان تهران جهت هماهنگی برای استفاده از امکانات و تجهیزات نهایت قدردانی را داریم.

 1. Gilbert SF. Birds and mammals early development and axis formation. Developmental biology.9th Ed. Sunderland: Sinauer Associates, Inc. 2010; 300-310.

 

 2. Sadler TW. Gametogenesis: Conversión of germ cells into male and female gametes. Langman’s medical embryology. 13th Ed. Philadelphia: Williams & Wilkins; 2015; 18-29.

 

 3. Tarkowski AK. Experiments on the development of isolated blastomers of mouse eggs. Nat. 1959; 7-12.

 

 4. Rossant J. Postimplantation development of blastomeres isolated from 4- and 8-cell mouse eggs. J Embryol Exp Morphol. 1976; 36(2): 90-99.

 

 5. Kelly SJ. Studies of the developmental potential of 4- and 8-cell stage mouse blastomeres. J Exp Zool. 1977; 20(3): 69-77.

 

 6. Gandolfi F. Autocrine, paracrine and environmental factors influencing embryonic development from zygote to  blastocyst. Therio. 1994; 4(1): 95-100.

 

 7. Gopichandran N, Leese HJ. The effect of paracrine/autocrine interactions on the in vitro culture of bovine preimplantation embryos. Reprod. 2006; 131(2): 69-77.

 

 8. Hasegawa K, Pomeroy JE, Pera MF. Current technology for the derivation of pluripotent stem cell lines from human embryos. Cell stem cell. 2010; 6(6): 521-31.

 

 9. Hug K. Sources of human embryos for the stem cell research: ethical problems and their possible solutions. Medicina J. 2005; 41(12): 1002-1010.

 

 10. Sivarama MAF, Noor SNM. Ethics of embryonic stem cell research according to Buddhist, Hindu, Catholic, and Islamic religions: perspective from Malaysia. Asi Biomed. 2014; 8(1): 43-52.

 

 11. Hassani SN, Asgari B, Taei A, Baharvand H. Suppression of transforming growth factor beta signaling promotes ground state pluripotency from single blastomeres. Hum Reprod. 2014; 29(8): 1739-48.

 

 12. Fischbach GD, Fischbach RL. Stem cells: science, policy, and ethics. 2004; 114(10): 1364-1370.

 

 13. Klimanskaya I, Chung Y, Becker S, Lu SJ, Lanza R. Human embryonic stem cell lines derived from single blastomeres. Nature. 2008; 444(7118): 481-5.

 

 14. Geens M, Mateizel I, Sermon K, De Rycke M, et al. Human embryonic stem cell lines derived from single blastomeres of two 4-cell stage embryos. Hum Reprod. 2009; 24(11): 2709-17.

 

 15. Totonchi M, Hassani SN, Sharifi-Zarchi A, Tapia N, et al. Blockage of the Epithelial-to-Mesenchymal Transition Is Required for Embryonic Stem Cell Derivation. Stem cell reports. 2017;9(4):1275-90.

 

 16. Caro CM, Trounson A. Successful fertilization, embryo development, and pregnancy in human in vitro fertilization (IVF) using a chemically defined culture medium containing no protein. J In Vitro Fert Embryo Transf. 1986; 3(4): 7-12.

 

 17. Casser E, Israel S, Witten A, Schulte K, et al. Totipotency segregates between the sister blastomeres of two-cell stage mouse embryos. Sci Repo. 2017;7(1): 82-99.

 

 18. Fernando H, Biase XC, Sheng Z. Cell fate inclination within 2-cell and 4-cell

 

mouse embryos revealed by single-cell RNA sequencing. Genome Research. 2014; 24(11): 17-29

  

 19.  Piotrowska Nitsche K, Perea Gomez A, Haraguchi S, Zernicka-Goetz M. Four-cell stage mouse blastomeres have different developmental properties. Dev. 2005; 132(3): 479-90.

 

 20. Gonzalez S, Ibanez E, Santalo J. Establishment of mouse embryonic stem cells from isolated blastomeres and whole embryos using three derivation methods. J Ass. Reprod gen. 2010; 27(12): 67-82.

 

 21. Lorthongpanich C, Yang SH, Piotrowska-Nitsche K, Parnpai R, et al. Development of single mouse blastomeres into blastocysts, outgrowths and the establishment of embryonic stem cells blastomeres. Reproduction. 2008;135(6): 805-13.

 

 22. Suwinska A, Czolowska R, Ozdzenski W, Tarkowski AK. Blastomeres of the mouse embryo lose totipotency after the fifth cleavage division: expression of Cdx2 and Oct4 and developmental potential of inner and outer blastomeres of 16- and 32-cell embryos. Dev Biol. 2008; 322(1): 133-44.

 

 23. Kawamura K, Chen Y, Shu Y, Cheng Y, et al. Promotion of human early embryonic development and blastocyst outgrowth in vitro using autocrine/paracrine growth factors. PloS one. 2012; 7(11): 81-93.

 

 24. O'Neill C. Evidence for the requirement of autocrine growth factors for development of mouse preimplantation embryos in vitro. Biol reprod. 1997; 56(1): 29-37.

 

 25. Casser E, Israel S, Witten A, Schulte K, et al. Totipotency segregates between the sister blastomeres of two-cell stage mouse embryos. Sci Repo. 2017;7(1): 82-99.

 

  26. Piotrowska-Nitsche K, Perea-Gomez A, Haraguchi S, Zernicka-Goetz M. Four-cell stage mouse blastomeres have different developmental properties. Dev. 2005; 132(3): 479-90.