بررسی اثر ضد سرطانی عصاره هیدروالکلی بذر خارسنبل) ( Blepharis persica بر رده سلول‫های سرطانی سینه‌ و پروستات و اثر هم‌افزایی آن با داروی دوکسوروبیسین‬‬

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشجوی دکتری بیوتکنولوژی کشاورزی، دانشگاه گیلان، پردیس دانشگاهی، بخش بیوتکنولوژی کشاورزی، رشت، ایران

2 دانشگاه گیلان، دانشکده علوم کشاورزی، گروه بیوتکنولوژی کشاورزی، رشت، ایران

3 دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته کرمان ، پژوهشکده علوم محیطی، پژوهشگاه علوم و تکنولوژی پیشرفته و علوم محیطی، گروه بیوتکنولوژی، کرمان، ایران

4 دانشگاه جیرفت، دانشکده علوم، گروه زیست شناسی گیاهی، کرمان ، ایران

چکیده

هدف: در این تحقیق اثرات ضد­سرطانی و آپوپتوزیسی عصاره هیدروالکلی بذر خارسنبل  Blepharis persica بر روی سلول­های سرطانی سینه­ و پروستات و اثر هم­افزایی آن با دارو دوکسوروبیسین مورد مطالعه قرار گرفت. 
مواد و روش­ها: عصاره هیدروالکلی بذر با روش خیساندن و با اتانول ­70درصد تهیه شد. 8­ غلظت عصاره و 4 غلظت ترکیبی از دوکسوروبیسین (125و 5/62 نانوگرم بر میلی­لیتر) با عصاره غلظت­های (315/0و 625/0 میلی­گرم بر میلی­لیتر) تهیه شد. سلول‫های سرطانی سینه (MCF-7)­­­، پروستات (LNCaP) و سلول­های فیبروبلاست ­(SKM)کشت داده شدند. درصد زنده­مانی رده‫های سلولی با تست­­MTT اندازه­گیری و میزان آپوپتوزیس در رده­های سلولی از روش Annexin/PI سنجیده شد و بررسی بیان ژن BCL2­ در مدت 24 و 48­ ساعت با روش quantitative RT-PCR (RT-qPCR)   Real-Timeصورت گرفت.
نتایج: عصاره به­ترتیب بر رده­های سلولی پروستات، پستان و فیبروبلاست بیشترین اثر­ بازدارندگی رشد را نشان­ داد. اثر ترکیبی دوکسوروبیسین با عصاره در هر سه رده سلولی با کنترل هیچ­گونه تفاوت معناداری نداشت. نتایج Annexin/PI  نشان­داد میزان آپوپتوزیس اولیه، تاخیری و نکروز در رده­های سلولی تیمار شده نسبت به کنترل افزایش داشته است. بیان ژنBCL2  در رده­های سلولی با تیمار غلظت 25/1 میلی­گرم بر میلی­لیتر عصاره گیاه در مدت 24 و 48 ساعت نسبت به ژن کنترل بتااکتین به­طور معنی­داری کاهش یافته بود (­01/0­p<).
نتیجه­گیری: عصاره هیدروالکلی بذر خارسنبل توانایی کاهش تکثیر سلول­های سرطانی سینه و پروستات و القا آپوپتوزیس در سلول­های سرطانی را دارد و هرچند که در غلظت کم موجب افزایش اثرات ضد سرطانی دوکسوروبیسین نمی­شود، ولی می­تواند جایگزنی برای آن با عوارض جانبی کمتر باشد.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

سرطان به‫عنوان یکی از کشنده­ترین عوامل مرگ و میر در دنیا، سالیانه بیش از 5/7 میلیون نفر را در به کام مرگ می­کشاند (1). بر اساس پیش­بینی سازمان بهداشت جهانی بروز سرطان در ایران تقریبا 86000 نفر در سال 1399 شمسی خواهد بود که میزان مرگ و میر ناشی از آن حدود  63000 مورد خواهد رسید (2 و 3). درکشورهای در حال توسعه سرطان پستان از جمله شایع­ترین سرطان­ها در بین زنان است­ (4). این سرطان از عوامل اصلی به خطر انداختن سلامتی در میان زنان است و اولین عامل مرگ و میر بر اثر سرطان در بین زنان محسوب می‫شود (5). بر اساس آمار وزارت بهداشت، درمان و آموزش پزشکی در سال 1392 بیش از 40000 نفر در ایران دچار این بیماری شده­اند و بر این تعداد هر ساله افزوده می­شود ­(6). از سوی دیگر پروستات یکی از غدد مهم دستگاه تولید مثل در مردان است و بیماری­های ناشی از آن دارای اهمیت فراوانی هستند ­(7). سرطان پروستات شایع‫ترین سرطان بدخیم در میان مردان است، بیشترین مورد بروز سرطان در مردان (حدود 28 درصد) و دومین عامل مرگ­و­میر (حدود11 درصد­) را به‫خود اختصاص داده است. فاکتورهای ژنی و عوامل محیطی از مهم­ترین فاکتورهای هستند که در بروز سرطان سینه و پروستات نقش دارند، از طرف دیگر عواملی محیطی مانند رژیم غذایی، نحوه زندگی، شرایط جغرافیایی، عوامل استرس­زا، سن و چاقی در بروز این بیماری دخیل هستند (11-8). متخصصین بالینی از روش­های متعددی در تشخیص و درمان انواع سرطان­ها استفاده می­کنند که شیمی درمانی، پرتو درمانی، جراحی و هورمون درمانی عمده­ترین آن‫ها هستند ولی مهم­ترین روش مبارزه با سرطان، شیمی‫درمانی است که عوارض جانبی  زیادی از  جمله خستگی­، حالت تهوع و ریزش مو و غیره را برای بیمار ایجاد می­کند، این عوارض می­تواند بر روی کیفیت زندگی بیمار تاثیر زیادی داشته باشد (12و13). داروی دوکسوروبیسین با نام تجاری آدریامایسیین یکی از قوی­ترین و اصلی­ترین داروهای شیمی درمانی گروه آنتراسیکلین است. این دارو در درمان بسیاری از سرطان­ها نظیر معده، پستان، ریه، تخمدان، استخوان، بیماری هوچکین و سرطان خون مورد استفاده قرار می‫گیرد، این دارو همانند دیگر داروهای شیمی درمانی دارای عوارض جانبی بسیار زیادی است که می­توان به تب، مسمومیت قلبی و غیره اشاره کرد (16-14). چندین مکانیسم برای اعمال خاصیت سمیت این دارو در نظر گرفته می­شود که مهم­ترین آن‫ها آسیب به DNA  می‫باشد. دوکسوروبیسین با پایداری اتصال کمپلکس آنزیم توپوایزومراز II به DNA از اتصال مجدد رشته­های شکسته شده جلوگیری می­کند. آسیب به DNA به‫عنوان یک محرک سلولی باعث فعال شدن پروتئین­های مسیر آپوپتوزیس می­­شود (17). پروتئین­های خانواده BCL2­، یک گروه از تنظیم کننده­های داخل سلولی آپوپتوزیس یا مرگ برنامه­ریزی شده سلول هستند. تعدادی از پروتئین­ها­ خانوادهBCL2، پروآپوپتوتیک هستند یعنی آپوپتوزیس به‫وسیله افزایش بیان این پروتئین­ها راه اندازی می­شود و  BAX جز این گروه است. تعداد دیگری از پروتئین­های خانواده  BCL2آنتی­آپوپتوتیک هستند یعنی آپوپتوزیس به‫وسیله مهار آزاد­سازی این پروتئین­ها باز­داری می­شود مانند­BCL2  که به‫طور گسترده در سطح غشا خارجی میتوکندری وER  غشا هسته واقع شده­اند و تمامیت غشا را حفظ می­کنند (20-18). تحقیقات زیادی در مدت بیش از بیست سال  بر روی مرگ برنامه­ریزی شده سلول یا آپوپتوزیس پوپتورصورت گرفته است و در نتیجه این تحقیقات ثابت شده است که مرگ برنامه ریزی شده سلول به‫عنوان یک مانع طبیعی رشد سرطان می‫باشد، ترکیبات طبیعی موجود در گیاهان با تاثیر بر روی مسیر آپوپتوزیس سلول­های سرطانی می‫توانند به‫عنوان یک ترکیب ضد توموری شناخته شوند (21).

جنس Blepharis دارای 100 گونه گیاهی است که در مناطق گرمسیری و نیمه گرمسیری رشد می‫کند. گیاه خارسنبل از جنس Blepharisبا نام علمی Blepharis persica شناخته می­شود (22). گونه مشابه این گیاه­، B.edulis است که در بیابان­های خاورمیانه و آفریقا رشد می­کند (23). خارسنبل گیاهی است چندساله و کم ارتفاع، دارای برگ بیضی و میوه کپسولی است. ریشه آن مدر است و برگ­های آن دارای خاصیت بند آوردن خون هستند. در حال حاضر تحقیقات زیادی بر روی این گیاه انجام نشده است و اطلاعات کمی از خواص و فواید دارویی این گیاه وجود دارد ­(24). با توجه به آن‫که گیاهان دارای اثرات ضد توموری از جمله القای آپوپتوزیس و مرگ سلول­های سرطانی هستند و عوارض جانبی از استفاده آن‫ها کمتر است و همچنین این گیاه در مناطق بومی جنبه دارویی دارد، در این تحقیق بر آن شدیم که در ابتدا اثرات ضدسرطانی عصاره بذر گیاه خارسنبل با کمک تست MTT (Dimethylthiazol-2-yl-2,5-diphenyltetrazolium  bromide) بر روی رده­های سلول­های سرطانی سینه ­(MCF-7) و پروستات (‫LNCaP) سنجیده شود و با رده سلولی نرمال فیبروبلاست (­SKM) به‫عنوان گروه کنترل مقایسه شود و همچنین میزان القا آپوپتوزیس در رده­های سلولی با کمک روش فلوسایتومتری سنجش شود. ترکیب دارو دوکسوروبیسین و عصاره نیز مورد سنجش قرار گرفت و در پایان بیان ژن Bcl2 با کمک روش quantitative RT-PCR  Real-Time برای هر یک از گروه­های مورد مطالعه مورد سنجش قرار گرفت.

 

مواد و روش‌ها

تهیه نمونه گیاهی:این تحقیق یک تحقیق بنیادی، کاربردی است. گیاه خارسنبل از مناطق جنوبی و گرمسیر استان کرمان در فصل بهار در سال 1396 از منطقه کهنوج با طول جغرافیایی 57 و عرض جغرافیایی 27 درجه و ارتفاع از سطح دریا 508 متر جمع آوری شد و بعد از تائید استاد گیاه شناسی ، گیاه در سایه و دمای محیط خشک شد و  سپس بذرهای  گیاه  جدا شدند و تا زمان عصاره­گیری در دمایی اتاق نگه­داری شدند.

 تهیه عصاره گیاهی: برای تهیه عصاره هیدروالکی از روش خیساندن (Macerate) و اتانول 70 درصد استفاده شد (25). ابتدا 40 گرم از بذر به‫کمک دستگاه آسیاب کاملا پودر شد. پودر حاصل در 300 میلی‫لیتر الکل 70 درصد حل شد و به‫مدت 72 ساعت روی دستگاه شیکر با دور متوسط در دمایی اتاق قرار داده شد­. در مرحله بعدی کار با کمک کاغذ صافی واتمن 1 در مدت 30 دقیقه عصاره­های صاف شد و جداسازی الکل با کمک دستگاه روتاری در خلا در دمای 45 درجه سانتی­گراد و مدت 45 دقیقه صورت گرفت. در نهایت برای جداسازی کامل حلال از عصاره در داخل آون به‫مدت 48ساعت در دمایی 45 درجه سانتی­گراد قرار داده شدند. عصاره حاصل تا فرایند آزمایشگاهی در فریزر 20- سانتی­گراد نگه­داری شد .

تهیه غلظت­های مختلف عصاره و دارو: در این تحقیق از 8 غلظت عصاره هیدرو­الکلی بذر خارسنبل و 4 غلظت دارویی دوکسوروبیسین استفاده شد. به‫منظور تهیه 10­ میلی‫لیتر استوک10 میلی­گرم برمیلی‫لیتر عصاره هیدرو الکلی، ابتدا میزان 100 ­میلی­گرم از عصاره نیاز است که این مقدار در 400 میکرو لیتر  Dimethyl sulfoxide (DMSO) (4 درصد) حل شد، در ابتدا 1 میلی‫لیتر محیط کشت فاقد سرم اضافه شد و بعد از آن مابقی محیط کشت اضافه تا کاملا در عصاره حل شود. غلظت­های دیگر به­ترتیب  5/7، 5 ، 5/2، 25/1، 625/0 ، 315/0و 156/0 میلی­گرم بر میلی­لیتر از استوک اصلی با کمک فرمول m1c1=m2c2  به‫دست آمد. در این تحقیق از دارو دوکسوروبیسین 50 میلی­گرم بر 25میلی لیتر به‫صورت محلول با نام تجاریEbedoxo  استفاده شد. ابتدا برای تهیه 7 میلی­لیتر از استوک نانوگرم بر میلی لیتر 500  از این دارو 25/1 میکرولیتر از آن را در 400 میکرولیتر  DMSOو محیط کشت بدون سرم به‫صورت کم کم اضافه شد تا حجم محلول 7 میلی­لیتر شود و از استوک به دست آمده غلطت­های 250 ، 125 و 5/62 نانوگرم بر میلی­لیتر دارو  تهیه شد. عصاره موجود و دارو را قبل از رقت سازی با فیلتر سررنگی 22/0­میکرومتر فیلتر شدند. در این تحقیق همچنین اثر ترکیبی دارو دوکسوروبیسین در غلظت‫های کم (125­و 5/62 نانوگرم برمیلی لیتر با غلظت­های کم عصاره (625/0 و 315/0 میلی گرم بر میلی لیتر) مورد سنجش قرار گرفت .

کشت سلولی : در این پژوهش­، سه رده سلول­های سرطانی سینه (MCF7)­، پروستات (LNCaP) و فیبروبلاست ((SKM در داخل فلاسک 25 سانتی­متر مربع به‫صورت کشت شده از انستیتو پاستور ایران خریداری شدند. سلول­­های سرطانی در محیط کشت 1640 RPMI و سرم جنینی  گاو  FBS 10 درصد به‫همراه 1 درصد آنتی بیوتیک­های استرپتومایسین و پنی­سیلین کشت داده شدند و هر سه رده سلولی را در انکوباتور 5 درصد CO2 و دمای 37 درجه سانتی­گراد کشت داده شدند. سلول­های نرمال فیبروبلاست در محیط کشت­DMEM  حاوی 10 درصد سرم FBS کشت داده شدند. سلول­های سرطانی سینه و پروستات بعد از ده مرحله پاساژ منظم و سلول­های فیبروبلاست بعد از 5 مرحله پاساژ آماده تیمار با غلظت­های مختلف عصاره­، دارو و ترکیب غلظت کم­دارو و عصاره شدند.

تست تترازولیومMTT: رده­های سلولی در فلاسک 25 سانتی­متر مربع به صورت مجزا کشت داده شدند و بعد از چند پاساژ به فلاسک 75 سانتی­متر مربع انتقال داده شدند و در انکوباتور 5 درصد CO2 و دمای 37 درجه سانتی گراد کشت داده شدند. بعد از شمارش سلولی به میزان 100 میکرو‫لیتر شامل تقریبا 7000 سلول از سوسپانسیون سلولی در پلیت‫های 96 خانه ریخته شدند و به‫مدت 24 ساعت در انکوباتور حاویCO2  و دمای 37 درجه سانتی­گراد به‫منظور چسبیدن و رشد سلول­ها به کف پلیت قرار داده شدند. سپس محیط کشت رویی سلول­ها خارج شد و محیط حاوی غلظت­های عصاره، دارو و ترکیب ­دارو با عصاره و همچنین محیط کشت  فاقد سرم به‫عنوان کنترل به سلول­ها اضافه شدند. بعد از 24­ ساعت به‫هر یک از چاهک­ها به میزان 10میکرو‫لیتر  MTT(­MELFORD ساخت اتگلستان ) اضافه شد و  بعد از آن­که 4 ساعت در انکوباتور نگه­داری شدند به هریک از چاهک­ها 150 میکرولیتر­DMSO  اضافه شد و بعد از 30 دقیقه جذب سلول­ها توسط دستگاه الیزا ریدر در طیف جذب 490 و 630 خوانده شد و  بر حسب فرمول مربوطه میزان زنده­مانی محاسبه شد. 

100 ×میانگین جذب سلول های تحت اثر ماده توکسیک- 1= درصد مهار­کنندگی رشد

                                   میانگین جذب کنترل منفی

درصد مهار­کنندگی رشد -100=  درصد بقا یا زنده­مانی

 

بررسی مرگ  برنامه­ریزی شده سلول توسط دستگاه فلوسایتومتری:جهت سنجش میزان آپوپتوزیس در رده سلول­های سینه، پروستات و سلول­های فیبروبلاست عصاره هیدروالکلی با غلظت 25/1 میلی­گرم بر میلی­لیتر انتخاب شد و سلول­های تیمار شده و بدون تیمار (کنترل) از روش Annexin/PI با کیت تشخیصیKit I Pharmingen™, USA)  (BD و با کمک دستگاه فلوسایتومتری (­CYFlow شرکت  partec G mbH ساخت آلمان) انجام گرفت. آزمایش به این صورت انجام شد که سلول­های سرطانی و فیبروبلاست با عصاره هیدروالکی 25/1 میلی­گرم برمیلی لیتر در مدت 24 ساعت تیمار داده شدند و برای هر کدام از رده­های سلولی یک کنترل در نظر گرفته شد. سلول­ها با محلول نمکِ فسفات با خاصیت بافری (PBS) شستشو داده شدند. بعد از سانتریفیوژ سلول­ها، به رسوب حاصل بافر بایندینگ اضافه شد. سپس 5 میکرولیتر از رنگ annexin V اضافه می­شود و به‫مدت 15 دقیقه در دمای اتاق انکوبه شد و سلول­ها در مرحله بعدی با محلول بایندینگ شستشو داده شدند و در 10 ماکرولیتر رنگ PI به سلول­ها اضافه شد و در پایان کار آنالیز توسط دستگاه انجام شد. 

بررسی بیان ژن BCL2: فرایند استخراجRNA  کل از سلول­های سرطانی پستان­، پروستات و سلول‫های فیبروبلاست بدون تیمار و تحت تیمار عصاره هیدروالکلی 25/1 میلی­گرم بر میلی­لیتر بذر خارسنبل به‫مدت 24 و 48 ساعت و همچنین تحت تیمار ترکیب عصاره  25/1 میلی­گرم بر میلی­لیتر با دارو 5/62 نانوگرم بر میلی­لیتر انجام پذیرفت. ابتدا سلول­های تحت تیمار و کنترل از کف فلاسک­های 25 سانتی­متر مربع با کمک آنزیم تریپسین جدا شدند و برای مراحل استخراج آماده شدند. استخراجRNA  با RNA-X PLUS انجام شد.  بعد از استخراج کمیت و کیفیت RNA موجود با دستگاه اسپکتوفتومتری و ژل الکتروفورز مورد سنجش قرار گرفت.cDNA  با کمک کیت سنتز ­(­Takara ساخت ژاپن­) با دستگاه Biometra GmbH) PCR ساخت آلمان (ساخته شد و توالی پرایمر رفت و برگشت ژن­BCL2  و ژن کنترل داخلی بتااکتین با استفاده از نرم­افزار  Primer3 طراحی شده و به‫منظور اطمینان بیشتر از درصد­GC ، دمای Tm و نداشتن دایمر با همدیگر، پرایمرها با برنامه ( Gene  Runner­­ نسخه 3.50 ( Hasting Software, Inc بررسی شدند (جدول1).

 


Primer

Tm) C°)

Primer sequence

Product   size (bp)

β-   actin

64

F:GGACATCCGCAAAGACCTGTA

R:ACATCTGCTGGAAGGTGGACA

189

BCL2

61

F:GTGGATGACTGAGTACCTGA

R:AGCCAGGAGAAATCAAACAGA

119

جدول 1: توالی و طول محصولات آغازگرهای مورد استفاده

 

 

 

پس از طراحی، پرایمرها برای سنتز به شرکت   FAZA Biotechسفارش داده شدند .محلولCYBR Green  مخصوص فرایند Real time-qPCR از شرکت یکتا تجهیز آزما تهیه شد و بیان ژن­های مورد نظر بعد از تیمار با کمک دستگاه rotor-Gene RG-3000 )ساخت استرالیا و شرکت CORBETT Research)  مورد سنجش قرار گرفت.

 

آنالیز آماری

با توجه با آنکه برای هر تیمار و کنترل در تستMTT  ، 3 تکرار وجود داشت. ابتدا داده­ها وارد اکسل شدند و سپس توسط نرم­افزار SPSS 20 ­در طرح کاملا تصادفی آنالیزها انجام گرفت و از آزمون  ANOVAیک‫طرفه برای مقایسه گروه­ها و آزمون دانکن برای آزمون تفاوت بین گروه­ها استفاده شد. تست­های مربوط به ژن BCL2  و ژن داخلی بتا اکتین برای هر نمونه سه تکرار در دستگاه rotor-Gene RG-3000  گذاشته شد و نتایج حاصل از بیان ژن برای بررسی اختصاصیت محصول تکثیر شده، منحنی ذوب مورد بررسی قرار گرفت و داده­های خام به‫صورت Ct از دستگاه استخراج شد و با کمک فرمول ct  ΔΔ نمونه­های شاهد و تیمار به‫دست آورده و نسبت ژن هدف به ژن مرجع بتااکتین را از طریق ct  ΔΔ -2 محاسبه شد . نتایج حاصل از ct  ΔΔ -2 ­­برای سه تکرار به اکسل منتقل شد و با نرم­افزار SPSS در سطح 5 و یک درصد میزان معنی­دار شدن بیان ژن هدف مورد بررسی قرار گرفت.

 

نتایج

تست MTT

در این تحقیق تاثیر عصاره هیدروالکلی خارسنبل با 8 غلظت مختلف، 4 دوز دارو دوکسوروبیسین و ترکیب غلظت پایین عصاره با غلظت پایین دارو دوکسو روبیسین روی رده­های سلول­های سرطانی سینه، پروستات و سلول فیبروبلاست مورد بررسی قرار گرفت. نتابج با کمک روش MTT در سه تکرار به این شکل بود در هر سه رده سلولی تاثیر عصاره بر روی زنده­مانی سلول­ها در سطح 1درصد و 5 درصد معنی­دار بود. به‫طوری که عصاره هیدروالکلی بذر گیاه خارسنبل در غلظت­های 10­و 5/7 میلی­گرم بر میلی­لیتر به ترتیب بر روی رده­های سلولی پروستات و سینه و فبیروبلاست بیشترین تاثیر را داشت (شکل1)، غلظت 10 و 5/7 میلی­گرم بر میلی­لیتر در پروستات 64/85 و 29/82 درصد سمیت سلولی، در سرطان سینه 03/83 و 20/77 و در فیبروبلاست 68/74و 62/72 بازدارندگی رشد  ایجاد کرده بود.

 

                       

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 1: (a) سلول کنترل یا بدون تیمار فیبروبلاست، (b) سلول تحت تیمار فیبروبلاست غلظت 25/1 میلی‫گرم بر میلی‫لیتر، (c) سلول کنترل یا بدون تیمار پستان‫، (d) سلول پستان تحت تیمار با غلظت  25/1 میلی‫گرم بر میلی‫لیتر، (e) سلول کنترل یا بدون تیمار پروستات، (f) سلول پروستات تحت تیمار با 25/1 میلی‫گرم بر میلی‫لیتر در 24 ساعت (بزرگ‫نمایی  x 100­ ­رده­های سلولی )

 

 

 

میزان سمیت سلولی در غلظت‫های بالا (10، 5/7، 5 ، 5/2 و 25/1) تفاوت معنی‫داری در سطح 1 درصد ­بر روی رده­های سلول‫های سرطانی و  فیبروبلاست نسبت به کنترل آن‫ها وجود داشت. غلظت 15/0میلی­گرم بر میلی­لیتر هیچ­گونه سمیت سلولی نداشت ولی غلظت 315/0 و 625/0 میلی­گرم بر میلی­لیتر بر روی پستان، فیبروبلاست و پروستات با آن‫که افزایش میزان سمیت سلولی مشاهده می­شد ولی تفاوت معنی­داری در سطح 5 درصد میزان سمیت سلولی تیمارها با کنترل دیده نشد (شکل 2).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل2: میزان سمیت سلولی غلظت­های مختلف(mg/ml)  عصاره هیدروالکلی بذر خارسنبل بر روی رده­های سلولی سرطان پروستات (رنگ سبز)، فیبروبلاست (رنگ آبی) و سینه  (قرمز) و تفاوت معنی‫دار در سطح 1درصد در اثر افزایش غلظت عصاره

 

 

 

 نتایج نشان می­دهد که با افزایش غلظت عصاره هیدروالکلی درصد زنده­مانی هر سه رده سلولی کاهش یافته است. نتایج تست MTT در 4 غلظت دارویی دوکسوروبیسین بر روی دو رده سلول­های سرطانی سینه و پروستات دارای اثرات سمیت سلولی بوده و بقای سلولی را کاهش می­دهد ، دوزهای500 و 250 نانوگرم بر میلی­لیتر دارو در سرطان سینه و دوز 500 نانوگرم بر میلی لیتر در سرطان پروستات اثرات سمیت قابل توجهی داشتند‫، به‫طوری‫که بیش از 50 درصد سلول­ها را کشته بودند ولی اثر ترکیبی غلظت 125و 5/62 نانوگرم بر میلی­لیتر دارو دوکسوروبیسین با دو غلظت 315/0­و

625/0 میلی­گرم بر میلی­لیتر  عصاره بذر گیاه در هر سه رده سلولی­ با کنترل آن‫ها هیچ‫گونه تفاوت معنی‫داری را نشان نداد (شکل 3).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل3:DOX   :تاثیر دوزهای مختلف داروی دوکسوروبیسین ،  BPE: تاثیرغلظت کم اثر عصاره خارسنبل بر روی سرطان پستان و پروستات. BPE+DOX: اثرترکیبی غلظت کم عصاره خارسنبل و دوز پایین دارو بر روی دو رده سلول­های سرطانی 

 

تست فلوسایتومتری

 

نتایج حاصل از دستگاه فلوسایتومتری در رده سلول‫های پستان، پروستات و فیبروبلاست تیمار شده با عصاره هیدروالکلی با غلظت 25/1 میلی­گرم بر میلی­لیتر و کنترل ­(بدون تیمار) بعد از 24 روز مورد سنجش قرار گرفتند. سلول­های کنترل پروستات، سینه و فیبروبلاست، به‫ترتیب میزان زنده‫مانی سلول­ها 46/84، 18/90­، 28/92 و مقدار آپوپتوزیس اولیه 24/7­، 57/4­، 97/3 و  درصد آپوپتوزیس تاخیری­ 14/5 ،32/4 ، 14/2 و درصد نکروزیس در سلول­های کنترل 15­/1 ­، 93/0­و 61/1 نشان داده شد­ (شکل4).

 

 

 

 

شکل4: نتایج حاصل از دستگاه فلوسایتومتری :Q1= درصد میزان نکروز، Q2= درصد آپوپتوزیس تاخیری، Q3= درصد میزان سلول­های زنده، Q4= درصد سلول­های که وارد آپوپتوزیس اولیه  شدند. سلول­های کنترل یا بدون تیمار (a) فیبرویلاست، (b) پستان و (c) پروستات، سلول­های تحت تیمار با غلظت 25/1 میلی گرم بر میلی‫لیتر در (d) فیبروبلاست، (e) پستان و(f)  پروستات

 

 

 

 

 

 

 

باتوجه به آنکه سلول­ها تحت تیمار قرار نگرفته بودند میزان آپوپتوزیس و نکروزیس دیده شده در رده­های سلولی قابل قبول بودند. درصد زنده­مانی سلول­های تحت تیمار با غلظت 25/1 میلی­گرم بر میلی­لیتر عصاره هیدروالکلی خارسنبل در رده­های سلولی پروستات، پستان، فیبروبلاست به‫ترتیب 10/71 ،23/74 ،02/82 و میزان آپوپتوزیس اولیه 37/24، 20/15 ، 27/13­، درصد آپوپتوزیس ثانویه به‫ترتیب 47/3 ، 28/7 و 48/3 و همچنین درصد نکروز در سلول­های تحت تیمار به‫ترتیب 06/1­­، 28/3 و 23/1 مشخص شد. نتایج نشان داد میزان درصد آپوپتوزیس اولیه، آپوپتوزیس تاخیری، مجموع کل آپوپتوزیس و نکروزیس دیده شده در  رده­های سلولی تیمار شده نسبت به رده­های سلولی بدون تیمار افزایش داشته است.

نتایج بیان ژن BCL2  : استخراج  RNA کل از سه رده سلول­های SKM،  LNCaPو MCF-7 تحت تیمار در مدت 24 و 48 ساعت و ترکیبی عصاره هیدروالکلی 25/1 میلی­گرم بر میلی­لیتر با دارو در مدت 24 ساعت و همچنین استخراج از سلول­های بدون تیمار یا کنترل انجام گرفت. کیفیت RNAهای نمونه­ها روی ژل آگاروز 5/1 درصد بررسی شد. دو باند مربوط بهS  18و  S28به‫وضوح قابل تشخیص بودند که نشان دهنده کیفیت بالای RNA استخراجی بود (شکل 5).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 5: RNA کل استخراج شده رده­های سلولی در مدت 24 ساعت، شماره 1: تحت تیمار پروستات ،2: تحت تیمار پستان  3: مربوط به‫ترکیبی دارو و عصاره، 4: کنترل پروستات ، 5: کنترل فیبروبلاست، 6: کنترل پستان 7: تحت تیمار فیبروبلاست و 8: نردبان ملکولی یا Ladder 1kbp روی ژل اگاروز 5/1 درصد

 

 

 

 

بررسی تغییر بیان ژن آپوپتوزیسیBCL2  نسبت به ژن کننرل بتا اکتین در رده­های سلولی­MCF7  و LNCaP در غلطت 25/1 میلی­گرم بر میلی­لیتر عصاره و ترکیب این غلطت با غلظت کم­دارو  با روش qPCR-Realtime  در مدت 24 و 48 ساعت بدین‫شکل بود که در مدت 24 و 48 ساعت بیان ژنBCL2  در تمامی رده­های سلولی کاهش یافته بود و این کاهش بیان در مدت ­24 و 48 ساعت نسبت به ژن کنترل در سطح 1 درصد معنی‫دار بود. بیشترین کاهش بیان به‫ترتیب در سلول­های سرطانی پروستات، سینه نشان داده شد (شکل 6).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 6: مقایسه بیان ژن BCL2 نسبت به ژن کنترل داخلی بتااکتین در مدت زمان 24 و 48 ساعت در رده سلول­های سرطانی LNCap  و MCF-7

 

 

 

تفاوت معنی­داری در سطح 1 درصد بین دو تیمار غلظت 25/1 میلی­گرم بر میلی­لیتر عصاره و اثر ترکیبی آن با دارو مشاهده نشد و کاهش چشم­گیری در بیان

 

ژن BCL2  بین این دو تیمار مشاهده نشد. به­منظور اطمینان از تک باند بودن پرایمرهای موجود، محصولات حاصل از Realtime-qPCR را روی ژل آگاروز 2 درصد بارگذاری شدند (شکل 7).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 7: محصول Realtime-PCR –  سمت راست چاهک اول نردبان ملکولی 1kbp  ( Ladder) و بقیه مربوط به ژن Bcl2 با طول 119 bp  در رده سلولی روی ژل آگاروز 2درصد

 

 

بحث

سرطان به‫عنوان یک بیماری کشنده در جهان شناخته می­شود و هر ساله تعداد زیادی از افراد جدید درگیر این بیماری می­شوند، در کشورهای در حال توسعه مانند ایران این بیماری عامل اصلی مرگ و میر انسان­

هاست. سرطان سینه در زنان ایرانی و سرطان پروستات در مردان ایرانی به‫عنوان شایع­ترین سرطان‫ها مطرح است و در دهه­های اخیر شیوع آن افزایش یافته است (27و 26). بیشتر گیاهان و سبزیجاتی مورد استفاده قرار می­گیرند و در طبیعت وجود دارند دارای خاصیت دارویی هستند. این گیاهان به‫دلیل داشتن ترکیبات دارویی و خاصیت آنتی اکسیدانتی می­توانند به‫عنوان یک عامل ضد سرطانی عمل کنند (28). خاصیت دارویی گیاهان به‫دلیل وجود متابولیت­های ثانویه است. این ترکیبات برای رشد و نمو گیاهان ضروری نیستند ولی برای حیات و  بقا گیاهان ضروری هستند و همچنین دارای پیچیدگی­های بیشتری  نسبت به متابولیت­های اولیه هستند (29). در این تحقیق از گیاه خارسنبلBelepharis persica ، گیاه بومی مناطق جنوبی ایران استفاده شد تا اثرات ضد سرطانی آن مورد سنجش قرار گیرد. گیاه  خارسنبل دارای خواص دارویی است و در مناطق بومی از قسمت­های مختلف آن استفاده می­کنند. از ترکیبات شیمیایی موجود در گیاه خارسنبل می­توان آلانتوان، کاتچول، تانن، ساپونین و گلوکز را نام برد (25). ساپونین یک متابولیت ثانویه است که در بسیاری از گیاهان دارویی و حتی جانوران دیده شده است. این ترکیب دارای طیف وسیعی از خواص دارویی از جمله: ضد آسم، ضد التهاب، ضد باکتریایی­، مفید برای قلب، تقویت کننده سیستم ایمنی، ضد قارچ و ضدسرطان است (31و30). با توجه به آنکه این گیاه دارای متابولیت ثانویه متعددی از جمله ساپونین است می‫توان گفت این گیاه دارای خواص ضد سرطانی می‫باشد. در این تحقیق­ با روش خیساندن­، عصاره هیدروالکلی این گیاه طی مدت 72 ساعت تهیه شد. نتایج حاصل از تست MTT این عصاره بذر خارسنبل  نشان داد که تفاوت معنی­داری در اثر سمیت سلولی این عصاره در غلظت­های مختلف با کنترل آن وجود دارد­. غلطت­های 10و 5/7 میلی­گرم بر میلی­لیتر این عصاره با آن‫که در هر سه رده سلولی بالای 50 درصد مهار رشد سلول­ها را داشت ولی کمترین بازدارندگی رشد را بر روی سلول­های فیبروبلاست داشته است. در تحقیقBaskar  و همکاران (32) اثر عصاره‫های مختلف قسمت هوایی گیاه maderaspatensisBlepharisهم­خانواده­Blepharis persica  بر روی رده­های سلول­های سرطانی MCF7 وAGS   مورد مطالعه  قرار گرفت و نتایج نشان داد که غلظت­های مختلف عصاره الکلی این گیاه در 24، 48 و 72 ساعت بر روی رده­های سلولی معده و سینه دارای اثر مهار کنندگی رشد دارد و با افزایش غلظت و زمان، میزان تاثیر گزاری عصاره بیشتر شده است. همتا و پروینی (33) به بررسی اثرات سمیت عصاره گیاه رزماری روی رده­های سلول­های سرطانیMCF7  القا شده توسط DMBA در رت­های نژاد SD پرداختند، نتایج نشان داد که عصاره الکلی رزماری بر روی سلول­های MCF7 دارای اثرات سمی قابل توجهی بوده است ولی عصاره آبی خواص ضد سرطانی بسیار ضعیفی داشت­. اثر عصاره هیدروالکلی میوه خارخسک بر تکثیر سلول‫های سرطان پروستات و روده بزرگ انسان در شرایط آزمایشگاهی توسط Yaghoobi و همکاران (34) انجام شد. نتایج نشان­داد افزایش غلظت عصاره هیدروالکلی میوه خارخسک باعث افزایش اثر بازدارندگی رشد بر روی رده­های سلول­هایLNCaP  شده است و عصاره موجود بر روی سلول­های فیبروبلاست اثر کمتری داشته است. در تحقیق Ashour (35) در مصر  صورت گرفت با کمک تست radical DPPH  اثبات شد که قسمت‫های هوایی گیاه blepharis edulis خاصیت آنتی اکسیدانتی و ضد سرطانی دارند و همچنین نتایج حاصل از تحقیق Mahboubi و همکاران (36) در ایران نشان داد گیاه  blepharis edulisیا خارسنبل بومی ایران در قسمت‫ های هوایی این گیاه ترکیبات فنولی زیادی وجود دارد که این ترکیبات دارای خواص آنتی اکسیدانتی و ضد میکروبی هستند، نتایج این تحقیقات یه‫همراه نتایج حاصل از این تحقیق دال بر این مطلب است که عصاره گیاه خارسنبل دارای خواص آنتی اکسیدانتی و ضد سرطانی است. در این مطالعه بیان ژن BCL2 با کمک Realtime-PCR  نیز مورد سنجش قرار گرفت و نتایج نشان داد بیان این پروتین به‫صورت معنی­داری تحت تیمار عصاره 25/1 میلی‫گرم بر میلی‫لیتر در مدت 24 و 48 ساعت کاهش یافته است. این نشان دهنده این است که عصاره هیدروالکلی تاثیر بر روی مسیر آپوپتوزیسی گذاشته است. احمدی و همکاران (37) تاثیر عصاره هیدروالکلی برگ گیاه سدر (Ziziphus spina-christi) بر زنده­مانیMCF7  و بیان ژن­های BAX و BCL2 مورد بررسی قرار دادند. نتایج  به این شکل بود که با افزایش غلظت عصاره زنده­مانی سلولی نسبت به کنترل کاهش معنی­داری پیدا کرد و همچنین در غلظت 1/0 میلی­گرم بر میلی‫لیتر عصاره گیاه، بیان ژن BCL2 دچار کاهش معنی­داری (01/0p<) شده است. از عوامل دیگری که می­تواند در کاهش بیان BCL2موثر باشد ساپونین است، ساپونین به‫عنوان یک متابولیت ثانویه می­تواند یک عامل موثر در آپوپتوزیس سلول­های سرطانی و کاهش دهنده بیان ژن BCL2باشد (38). نتایج این تحقیق نیز نشان داد که عصاره هیدروالکلی این گیاه کاهش دهنده بیان BCL2 است که می­توان به‫دلیل وجود ساپونین در این گیاه نسبت داد. نتایج حاصل از دستگاه فلوسایتومتری نشان­دهنده همین مطلب بود که سلول­های سرطانی رو به آپوپتوزیس آورده­اند و عصاره حاصل بر روی مسیر آپوپتوزیس سلول­های سرطانی سینه و پروستات تاثیر داشته است.

 

نتیجه گیری

 نتایج این تحقیق حاکی از اثر بالقوه عصاره عصاره هیدروالکلی بذر گیاه خارسنبل بر بیان ژن BCL2 در سلول‌های سرطانی پستان و پروستات انسان و ارتباط آن با مهار رشد سلول‌های سرطانی است. با توجه به آن در مرحله بعدی کار با جداسازی ماده موثره این گیاه و تحقیقات تکمیلی می­توان به‫عنوان یک ترکیب موثر در درمان سرطان معرفی شود. نتایج همچنین نشان داد عصاره این گیاه بر روی مسیر آپوپتوزیس تاثیر دارد با تحقیقات تکمیلی از جمله بررسی بیان ژن­های دیگری که در مسیر آپوپتوزیس درگیر هستند و می­تواند به‫طور دقیق­تری پاسخگو این مطلب باشد که عصاره حاصل به‫عنوان ترکیبی موثر برای درمان سرطان سینه و پروستات  مورد استفاده قرار گیرد.

 

تشکر و قدردانی

این مقاله از پایان­ نامه دوره دکترای رشته بیوتکنولوژی کشاورزی مصوب در دانشکده کشاورزی دانشگاه گیلان استخراج شده است. از مسئولین آزمایشگاه ژنتیک و بیوتکنولوزی دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته کرمان جهت قرار دادن امکانات و وسایل آزمایشگاهی و آقایان دکتر علی درخشانی­، دکتر فیروز جنت علی پور که ما را در انجام و ارتقاء کیفی این پژوهش یاری دادند، صمیمانه تشکر و قدردانی می شود.

1. Deka SJ, Mamdi N, Manna D, Trivedi V. Alkyl Cinnamates Induce Protein Kinase C Translocation and Anticancer Activity against Breast cancer cells through Induction of the Mitochondrial Pathway of Apoptosis. J Breast Cancer. 2016; 19(4): 358-371.

2. Ferlay J, Soerjomataram I, Dikshit R, Eser S, et al. Cancer incidence  and  mortality  worldwide:  sources,  methods  and major patterns in GLOBOCAN. Int J Cancer .2015; 136(5): 359-386.

3. Mousavi  SM,  Gouya  MM,  Ramazani  R,  Davanlou  M , et al.  Cancer incidence and mortality in Iran. Ann  Oncol. 2009; 20(3): 556-563.

4. Salehi F, Mohsenzadeh F, Aefi M. Prevalence of anxiety of death in patients with breast cancer in Kermanshah , 2015. Ir Jof Breast Dis. 2015; 8(4): 36-40.

5. Kruk J, Aboul-Enein Hy. Psychological stress and the Risk of breast cancer: A case-control study. Cancer Detect Prev. 2004; 28(6): 399-408.

6. Jamshidinaeeni Y, Davoodi H, Esmaeili S. Effects of Vitamin D on risk of breast cancer. Iran J Nutr Sci Food Technol. 2013; 7(4)(27): 53-62.

7. Jemal A, Murray T, Ward E, Samuls A, et al. Cancer statistics . CA cancer J. Clin. 2005; 55(1): 10-30.

8. Moheghi N, Afshari JT, Brook A. The Cytotoxic Effect of Zingiber Afficinale in Breast Cancer (MCF7) Cell line. J Ofogh Danesh. 2011; 17(3): 28-34.

9. Chikezie O. Madu and Yi Lu.Novel diagnostic biomarkers for prostate cancer. J cancer. 2010; 1(1):150-177.

10. DeMarzo AM, Nelson WG, Isaacs WB, Epstein JI. Pathological and molecular aspects of prostate cancer .Lancet .2003; 361; 955-964.

11. Shingo A, Hidewaki N, Toyomasa K. Molecular Features of the Transition from prostatic  Intraepithelial Neoplasia (PIN) tp prostate cancer: Genome-wide Gene- expression Profiles of Prostate cancers and PINs. Cancer Res. 2004; 64(17): 5963-72.

12. Glause A, Muller S. Hemoglobin and fatigue in cancer patients in separable twice. Sohweiz Med Wochenschr  .2000; 130(13): 471-477.

13. Hyun  lee. Fatigue  and  hope: Relationships  to Psychosocial adjustment in Korean woman with breast cancer. Appl Nurs Res. 2001; 14(2): 87-93.

14. Kajstura  J,  Cheng  W,  Sarangarajan  R,  Lim  P, et al. Necrotic and apoptotic  myocyte cell  death  in  the  aging  heart  of  Fischer  344 rats. Am. J. Physiol. 1996; 271 (3 Pt 2): 1215-1228.

15. Frias  MA,  Somers  S,  Gerber-Wicht  C,  Opie  LH, et al.  The  PGE2-Stat3  interaction  in  doxorubicin-induced  myocardial apoptosis. Cardiovasc. Res. 2008;  80 (1): 69-77.

16. Thorn  CF,  Oshiro  C,  Marsh  S,  et  al. Doxorubicin  pathways: pharmacodynamics  and  adverse  effects.  Pharmacogenetics  Genomics. 2011; 21(7): 440-6.

17. Cruet Hennequart S, Prendergast ÁM, Shaw G, Barry FP, et al. Doxorubicin induces the DNA damage response in cultured human mesenchymal stem cells. International journal of hematology. 2012; 96(5): 649-656.‏

18. Cory S, Adams, JM, The Bcl2 family: regulators of the cellular life-or-death switch, Nature Reviews Cancer. 2002; 2(9): 647-656.

 

19. Gross A, McDonnell JM, Korsmeyer S J. BCL-2 family members and the mitochondria in apoptosis, Genes & development. 1999; 13(15): 1899-1911

20. Green DR, Kroemer G.The pathophysiology of mitochondrial cell death.Science Signalling. 2004; 305: (5684): 626.

21. Kaufmann  B, Christen P, Veuthey JL. Parameters  affecting  microwave-assisted extraction of withanolides. Phytochemical Analysis. 2002; 12(5): 327–331.

22. Mozffarian V. A Dictionary of Iranian Plant names.Farhang Moaser. Tehran, Iran.1996; p. 172.

23. Gutterman Y. Delayed seed dispersal and rapid germination  as  survival  mechanisms of  the desert  plant Blepharis persica (Burm.) Kuntze. Oecologia.1972; 10(2): 145-149.

24. Mir Heydar H. Plant Education.Office of the Publishing Islamic Culture . Tehran, Vol. 8. 2006. 8 (3): 21-4.

25. Khacha-ananda S, Tragoolpua Kh, Chantawannakul p, Tragoolpua Y. Antioxidant and Anti-cancer Cell Proliferation Activity of  Propolis Extracts from Two Extraction Methods. A PJC. 2013; 14: 6991-6995.

26. Hairrchi I, Kolahdoozan S, Karbakhsh M, Chegini N, et al. Twenty years o breast cancer in Iran : downstaging without a formal screening program. Ann Oncol. 2011 ; 22(1): 93-97.

27. Jemal  A,  Siegel  R,Ward  E,  Murray  T, et al.  Cancer  statistics.  CA  Cancer  J Clin. 2006; 56(2): 106-30.

28. Shukla  Y,  Singh  M.  Cancer  preventive properties of ginger: a brief review. Food Chem Toxico. 2007; 45(5): 683-690.

29. Montoro  P, Baraca  A, Pizza  C, De Tommasi N. Structure antioxidant activity realionships of flavonoids isolated from different plants species. Food chemistry. 2005; 92: 249-355.

30. Lacaille-Dubois M.A, Wagner H. Bioactive  saponins from plants: an update. In:Studies in natural Products Chemistry. Rahman A.U.(ed). Elsevier, Amsterdam; 2000;  21: 633-687.

31. Hostettmann K, Marston A Chemistry and pharmacology of natural product : saponins. Cambridge University Press, UK. 1995 :286.

32. Baskar AA, KhalidS. Al, Mohammed A, et al. In vitro antioxidant and antiproliferative potential of medicinal plants used in traditional Indianmedicine to treat cancer. Redox Report. 2012; 17(4): 145- 156 .

33. Hamta A, Parvini P. Study of Cytotoxic Effects of Taxol and Rosemary Extracts on Cancerous  Cells Derived From DMBA-induced Breast Cancer in SD Rats. Journal of Cell & Tissue. 2011; 2(2) : 117-126.

34. Pourali M, Yaghoobi MM,  Salehii MH. Cytotoxic, Anti-Proliferative and Apoptotic Effects of Tribulus terrestris L. Fruit Extract on Human Prostate Cancer Lncap and Colon Cancer HT-29 Cell Lines. Jundishapur J Nat Pharm Prod. 2017; 12(2): e33561.

35. Ashour MAG. Isolation, HPLC/UV characterization and antioxidant activity of phenylethanoids from Blepharis edulis (Forssk.)Pers. growing in Egypt. Bulletin of Faculty of Pharmacy, Cairo University. 2012; 50(1): 67-72.

36. Mahboubi M, Haghi GH ,Kazempour N, Hatemi AR. Total phenolic content, ntioxidant and antimicrobial activities of Blepharis edulis extracts. Songklanakarin J. Sci. Technol. 2013; 35(1): 11-16.

37. Ahmadi R, Rahimi S, Ehteshamzad N. The effect of hydroalcoholic Ziziphus spina-christi leaf extract on viability  of breast cancer cell line (MCF7) and evaluation of Bax and Bcl2 genes expression level. Feyz, Journal of Kashan University of Medical Sciences. 2017; 21(5): 407-413.

38. Dikavsakaya D, Schiffmam D , Lan  P. Loss of  APC  incidence  polypoidy  as  a  results  of  a combination  of  defects  in  mitosis  and  apoptosis. Journal of Cell Biol. 2007; 176(2): 183-195.