بررسی اثرات سمیت و مهار متاستازی نانوذرات‌ اکسید سریم در دو رده‌ی ‌سلولی سرطان‌پستان MCF-7 و T47D

نویسندگان

1 کارشناسی ارشد ژنتیک،گروه ژنتیک و بیوتکنولوژی، دانشکده علوم زیستی، واحدورامین- پیشوا، دانشگاه آزاداسلامی، ورامین، ایران.

2 استادیار، دکترای ژنتیک، گروه ژنتیک و بیوتکنولوژی، دانشکده علوم زیستی، واحد ورامین- پیشوا، دانشگاه آزاداسلامی، ورامین، ایران.

3 استادیار، دکترای سلولی مولکولی،گروه زیست شناسی،واحد تهران مرکزی، دانشگاه آزاد اسلامی، تهران، ایران.

چکیده

هدف: در تحقیق حاضر، به مطالعه اثرات ضد متاستاتیک و کشندگی  نانو ذرات اکسید سریم  در دو رده‌ی سلولی سرطان پستان MCF-7 و T47D پرداخته شده است.
مواد و روشها: رده‌های سلولی ­سرطان پستان MCF-7، T47D و سلول نرمال HEK293 تحت تیمار با غلظت‌های 5/6 میلی‫گرم، 65 و 650 میکروگرم، 65 و 650 نانوگرم، نانو ذرات اکسید سریم قرار گرفتند و آنالیز MTT برای بررسی سمیت نانو ذرات انجام شد. سپس میزان بیان ژن‏های NM23 و KAI-1 با روش Real time PCR اندازه‏گیری شد.
نتایج: غلظت 650 میکروگرم و 5/6 میلی‫گرم از CNP به‫ترتیب باعث مرگ­ تقریبا 60 درصد از سلول‌های MCF-7 و T47D شد. همچنین در تیمار سلول­های نرمال با غلظت 5/6 میلی‫گرم CNP کاهش بقای 25درصدی مشاهده شد. نتایج آنالیز بیان ژن نیز نشان داد دو ژن سرکوبگر توموری NM23 و KAI-1 تحت اثر CNP دچار افزایش بیان  نمی‫شوند.
نتیجه­گیری: بر طبق نتایج این تحقیق، نانو ذرات اکسیدسریم دارای اثر سمیت بر سلول‏های سرطان پستان می باشد. هر چند این تاثیر بسته به دوز و نوع رده سلولی متغیر می باشد. از طرفی بررسی بیان ژن­های ضد متاستازیی نشان داد که این نانوذره قادر به افزایش بیان این ژن­ها نیست و بنابراین در کنترل تهاجم سلولی بی تاثیر است و احتمالا اثر ضد سرطانی خود را از طریق القا مرگ سلولی اعمال می‫کند.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

سرطان پستان یکی از شایع‫ترین انواع سرطان است که هر ساله باعث مرگ ‌و میر فراوانی در بین زنان می‌شود و علی­رغم پیشرفت‌های بسیاری که در مورد تشخیص زود هنگام و درمان این بیماری صورت گرفته است، کماکان سردسته علل مرگ به علت سرطان در بین زنان است (1). انواع سرطان پستان شامل کارسینوم درجای داکتال، کارسینوم درجای لوبولار، سرطان پستان التهابی و سرطان پستان­ راجعه می‫باشد. روش‫های درمانی متفاوتی برای سرطان پستان وجود دارد که چهار نوع روش درمانی متداول برای سرطان پستان شامل جراحی، پرتودرمانی، شیمی‌درمانی و هورمون درمانی می‌باشد (2 و 3).

امروزه واژه نانو، یکی از مهم­ترین فناوری­ها در علوم کاربردی بخصوص تولیدات دارویی به‫شمار می‫رود. کاربرد نانوتکنولوژی در درمان سرطان یکی از جدیدترین مطالعاتی است که دانشمندان علوم پایه و بالینی به آن روی آورده‫اند (4). نانو ذرات اکسید فلزی (Metal Oxide Nanoparticles) یکی از مهم‫ترین ترکیبات در حیطه­ی تولید نانو ذرات هستند که مدتی است که به‫عنوان یکی از کاندیدای درمان سرطان مورد چالش قرار گرفته‫اند. نانو ذرات اکسید سریم که با نام اختصاری CNP (Cerium Oxid Nanoparticles) شناخته می‌شوند در هسته ی فلزی خود دارای هر دو ترکیب Ce3+/Ce4+ می‌باشند که با اتم‫های اکسیژن احاطه شده‫اند. هر کدام از این کاتیون‫ها نقش خاصی به این نانوذره می‌دهند. Ce3+ منجر به فعالیت احیاکنندگی نانوذره CNP می‌شود و Ce4+ فعالیت اکسیدکنندگی دارد. نسبت Ce3+/Ce4+ در سطح CNP به ریز محیط اطراف نانوذره وابسته است و مکانیسم عمل این نانودارو از طریق القای واکنش های اکسایش-کاهش است، درنتیجه مهم‌ترین کاربرد این نانو ذرات در پاسخ به مکانیسم‫های سلولی ROS (Reactive Oxygen Spieces) است که در تولید رادیکال‫های آزاد نقش بسیار مهمی دارند. در بیولوژی سرطان این مکانیسم در تولید انرژی و تنظیم فعالیت‫های داخل سلولی مطرح می‌شود و از آنجاکه سرطان تکثیر غیرقابل‌کنترل و بی برنامه سلول است لذا این مسیر نیز در سرطان دچار اختلال شده است. تاثیر ضد آنتی اکسیدانتی نانو ذرات اکسید سریم که باعث ایجاد فعالیتی مشابه سوپراکسید دیسموتاز شده و از فعالیت کاتالاز تقلید می کند، به اثبات رسیده است.  جذب این نانو ذرات در سلول‌های سالم و توموری به اثبات رسیده است و حداکثر تا سه ساعت بعد از تجویز، سلول‌ها می‌توانند این نانو ذرات را برداشت کنند. در یکی از مطالعات به اندوسیتوز با واسطه کلاترین این ذرات اشاره شده است. سایر بررسی‫ها نشان داده است که این ذرات می‌توانند به تمام اندامک‫ها از جمله هسته و میتوکندری نفوذ کنند و با توجه به تفاوت pH محیط داخل این اندامک‫ها نقش آنتی اکسیدانتی و یا پرواکسیدانتی آن متغیر است (5).

متاستاز در سرطان، به‫عنوان یکی از علل مهم مرگ و میر بیماران سرطانی محسوب می‫شود. بیش از 20 ژن به‫عنوان مهار کننده های فرایند متاستاز شناخته شده‫اند. که در این میان بیان ژن‫های ضد متاستازی NM23 و KAI-1 در سلول‫های سرطانی از اهمیت ویژه‫ای برخوردارند. مهم‌ترین نقش ژنNM23 در تولید ATP از سایر نوکلئوتید‫هاست و در پردازش و عملکرد آنزیم‫هایی نظیر نوکلئوزید­ دی فسفات کیناز، کیناز‫های اختصاصی سرین/ترئونین، فارنسیل فسفات کیناز و اگزونوکلئازها می‫باشد (6). مطالعات مروری سیستماتیک نشان می‌دهد که افزایش بیان این ژن در بیماران مبتلا به سرطان پستان با پیش‌آگهی خوب و افزایش بقای بیماران ارتباط مستقیم دارد (4و7). همچنین در افرادی که توده بدخیم در آن‫ها متاستاز داده است، میزان بیان این ژن به‫طور معنی‫داری با افراد سالم و یا افراد با توده‫های خوش خیم  تفاوت داشته و کمتر است. و نبود بیان آن در غدد لنفاوی در افرادی که متاستاز به غدد لنفاوی مثبت بود دیده شده است(4 و 5). بیان ژن KAI-1  نیز با مهار متاستاز در ارتباط است. بیان این ژن در مراحل پیشرفته سرطان و با گسترش متاستاز کاهش می‌یابد. مطالعات نشان می‌دهد که فعال شدن پروتئین محافظ ژنوم p53 با افزایش بیان KAI-1 مرتبط است.

هدف از این مطالعه بررسی اثر نانو ذرات اکسید سریم بر سمیت و بیان ژن‌های سرکوبگر متاستازیNM23 و KAI-1 در دو رده‌ی سلولی سرطان پستان MCF-7 و T47D می‫باشد.

 

مواد و روش‫ها

این مطالعه تجربی کاربردی از فروردین تا اسفند سال 1396 انجام پذیرفت. رده‫های سلولی سرطانی MCF-7 و T47D و نرمال  HEK293از بانک سلولی انستیتو پاستور ایران تهیه شدند و سپس سلول‫ها در شرایط استاندارد مطابق با پروتکل در دمای 37 درجه سانتی‫گراد و شرایط 5 درصد، CO2، کشت و تکثیر شدند. نانو ذرات اکسید سریم نیز از شرکت  US Research Nanomaterials, Inc.  خریداری شد. به‫منظور اطمینان از سایز و بار نانو ذرات آنالیز توزیع سایز و زتا صورت پذیرفت و مشخص شد میانگین سایز نانو ذرات حدود 300 نانومتر بوده و دارای بار منفی می‫باشند. سپس میزان سمیّت سلولی نانو ذرات اکسید سریم، با روش MTT مورد بررسی قرار گرفت. به‫طوری‫که رده‌های سلولی با غلظت‌های 5/6 میلی‫گرم، 65 و 650 میکروگرم و 65 و 650 میکروگرم، نانو ذرات اکسید سریم  به‫مدت 48 ساعت تیمار شدند. سپس با استفاده از رنگ MTT   و بررسی میزان شدت رنگ حاصل از حل شدن  کریستال‫های فورامازان تولید شده توسط سلول‫های زنده در ایزوپروپانول، توسط دستگاه قرائت­گر الایزا (DNM-9602G) در طول موج 570 نانومتر درصد بقای سلولی با استفاده از فرمول زیر محاسبه شد:

100× (جذب نوری کنترل/جذب نوری تست)= میزان بقای سلولی

در این تست برای هر غلظت 8 بار تکرار در نظر گرفته شد.

 به‫منظور اندازه‫گیری بیان ژن ها، استخراج RNA از رده‫های سلولی سرطانی MCF-7 و T47D تیمار شده با غلظت IC50 نانوذره  انجام شد و سنتز cDNA صورت گرفت. جهت استخراج RNA از واکنش‌گر Trizol Invitrogen ساخت کشور آمریکا استفاده شد و به‫منظور بررسی کمّی و کیفی RNA، از روش اسپکتوفتومتری  استفاده شد. بعد از استخراج RNA سنتز cDNA  با استفاده از کیت  Transgene Biotech AE301-02 صورت پذیرفت.

به‫منظور انجام واکنش Real Time PCR حجم نهایی هر میکروتیوپ 20 میکرولیتر لحاظ شد که حاوی 10 پیکومول از پرایمر‫های جلوبر و برگشتی مربوط به‫هر ژن، 35 نانوگرم cDNA، 10 میکرولیتر Master mix و 7 میکرولیتر آّب RNase free بود. در این واکنش ژن‫های NM23 و KAI-1 به‫عنوان ژن هدف و ژن GAPDH به‫عنوان ژن مرجع در نظر گرفته شدند. توالی پرایمر‫های به‫کارگرفته شده در این واکنش در جدول 1 مشخص شده است.

 

 

 

 

 

 

 

 

 

جدول1: مشخصات پرایمرهای استفاده شده در Real Time PCR

 

نام ژن

توالی پرایمر

اندازه قطعه تکثیر شده

NM23

F: ATGGCCAACTGTGAGCGTACC

R: CATGTATTTCACCAGGCCGGC

204 جفت باز

KAI-1

F: CTCAGCCTGTATCAAAGTCACCA

R: CCCACGCCGATGAAGACATA

183 جفت باز

GAPDH

F; CCCACTCCTCCACCTTTGAC

R; CATACCAGGAAATGAGCTTGACAA

74 جفت باز

 

 

 در این تحقیق برنامه زمانی دمایی دستگاه  PCR (مدل ABI 7300، Applied Biosystems ,Foster City,CA,USA) به‫صورت 95 درجه سانتی‫گراد به‫مدت 8 دقیقه، مرحله دوم 95 درجه سانتی‫گراد به‫مدت 25 ثانیه و 60 درجه سانتی‫گراد به‫مدت 1 دقیقه و مرحله آخر دمای 72 درجه سانتی‫گراد به‫مدت 10 دقیقه صورت گرفت. در آخر آنالیز نتایج Real Time PCR با استفاده از روش Ct ∆∆ طبق فرمول های زیر صورت گرفت:

∆Ct=Ct target-Ct reference

∆∆Ct = ∆Ct T - ∆Ct C

RQ=2-∆∆Ct

در این فرمول Ct T∆ اختلاف بین سیکل‫های آستانه ژن هدف  و کنترل داخلی در نمونه مورد آزمون و Ct C∆ نیز اختلاف میان سیکل‫های آستانه ژن هدف و کنترل داخلی در نمونه کنترل می‫باشد. این روش کارایی پرایمرها را کامل در نظر گرفته، به این‫صورت که میزان محصول در تمام سیکل‫ها دو برابر می‫باشد.

 

آنالیزآماری

داده‫ها با استفاده از آنالیز واریانس یک‫طرفه (one way ANOVA) ­و تست Tukey مورد تجزیه و تحلیل قرار گرفت و محاسبه P value با استفاده از نرم افزار SPSS نسخه 22 انجام گرفت. مقدار 05/0p< در هر تست معنی‫دار در نظرگرفته شد.

 

نتایج

تیمار دو رده سلولی سرطان پستان شامل MCF-7 و T47D و همچنین  یک رده سلولی نرمال HEK293  با نانو ذرات اکسید سریم نشان داده که این نانوذره اثر سمیت وابسته به دوز در هر دو رده سلولی دارد. طبق شکل1 نتایج سمیت به‫دست آمده برای رده سلولی MCF-7 حاکی از آن است که نانو ذرات اکسید سریم پس از بازه زمانی 48 ساعت در غلظت­های 5/6 میلی‫گرم، 65 و 650 میکروگرم، باعث کاهش معنی‫دار (‫001/0p<). بقای سلولی در رده سلولی MCF-7 می‫شوند.

نتایج آزمون MTT برای بررسی اثرات سمیت نانو ذرات اکسید سریم بر رده سلولی سرطانی  T47D  (شکل1) نیز نشان داد که غلظت 650 میکروگرم، نانوذره باعث کاهش بقای 40 درصد از سلول‌ها شد و با افزایش غلظت به  5/6 میلی‫گرم  از نانوذره، کاهش بقای 60 درصدی رده سلولی T47D را شاهدیم که این کاهش از نظر آماری معنی‫دار می باشد (001/0p<).

اثرات سمیت نانو ذرات اکسید سریم بر رده سلولی سرطانی HEK-293 به عنوان رده سلولی نرمال (شکل1)  نیز نشان داد که تنها غلظت 5/6 میلی‌گرم نانو ذرات اکسید سریم باعث مرگ 25 درصدی سلول‌های HEK293 می‌ شود (001/0p<). در غلظت‫های دیگر نانو ذرات تغییری در بقای سلول‌های HEK293 ایجاد نمی‌شود.

 

 

شکل1: اثر غلظت‌های متفاوت نانو ذرات اکسید سریم بر سمیت رده سلولی سرطانی MCF-7  ، T47D، و رده سلولی نرمال HEK293. نتایج به‫صورت درصد بقا در مقایسه با نمونه‫های کنترل و به‫صورت میانگین± انحراف معیار گزارش شده است. 05/0 ˂p معنی‫دار در نظر گرفته شده است (***: 001/0p<).

 

پس از انجام Real Time PCR ، به‫منظور تائید اینکه آیا قطعات ژنی به‌صورت اختصاصی، بدون آلودگی و دایمر پرایمر تکثیرشده است، از آنالیز منحنی ذوب استفاده شد. طبق شکل2 وجود تنها یک پیک برای ژن­­های NM23،  KAI-1 و GAPDH در دمای ذوب ویژه آن‌ها، تائیدکننده اختصاصی بودن محصول تکثیر واکنش می‌باشد. همچنین نمودار تکثیر هرکدام از ژن‌ها در هر واکنش PCR مورد بررسی قرار گرفت و Ct به‌دست‌آمده، ثبت شد. منطبق بودن نمودار تکثیر مربوط به سه تکرار هرکدام از ژن­ها در هر آزمون PCR نیز کنترل شد.

 

 

 

 

 

 

شکل 2: منحنی ذوب ژن‌های مورد بررسی: الف) منحنی ذوب NM23 ب) منحنی ذوب KAI-1  ج)منحنی ذوب GAPDH. تک قله بودن و دمای ذوب یکسان منحنی‫های مربوط به ژن‌ها نشان دهنده اختصاصیت محصول تکثیرشده و صحت واکنش می‌باشد.

 

 

بعد از تیمار سلول‌ها با غلظت 600 میکروگرم نانو ذرات اکسید سریم به‫مدت 48 ساعت، بیان ژن‌ NM23 در رده‌ سلولی MCF-7 و T47D بررسی شد. طبق آنچه در شکل3 نشان داده شده بیان ژن NM23 نسبت به ژن مرجع در رده سلولی MCF-7 تیمار شده با نانو ذرات

 

 

 

اکسید سریم کاهش بیان معنی‫داری دارد (001/0p<). این در حالی است که بیان این ژن در رده سلولی T47D پس از تیمار با نانوذره تغییری را نشان نداد.

 

 

 

 

 

 

شکل3: بررسی بیان ژن NM23 در رده‌های سلولی MCF-7 و T47D: الف) بیان ژن NM23 در رده سلولی سرطانی پستان MCF-7 کاهش‌یافته و آنالیز آماری تفاوت معناداری را نشان داد. ب) بیان ژن NM23 در رده سلولی T47D تفاوتی را نشان نمی دهد.(***: 001/0p<).

 

شکل 4 نیز میزان تغییرات بیان ژن‌ KAI-1  در هر دو رده سلولی MCF-7 و T47D را پس از تیمار با نانوذره اکسید سریم نشان می‫دهد. به‫طوری‫که بیان این ژن در هر دو رده سلولی کاهش معناداری دارد. اما میزان این کاهش بیان در رده سلولی MCF-7 بیشتر می‫باشد.

 

 

 

 

 

 

شکل 4: بررسی بیان ژن KAI-1 در رده‌های سلولی MCF-7 و T47D بعد از تیمار با نانو ذرات اکسید سریم: الف) بیان ژن KAI-1 در رده سلولی T47D  ب) بیان ژن KAI-1 در رده سلولی MCF-7  (*:05/0p<، ***: 001/0p<).

 

 

 

بحث

نانو ذرات اکسید سریم یک هسته سریم دارد که توسط اتم‫های اکسیژن احاطه شده است. مطالعات نشان دادند که شرایط محیط اطراف سلول ها و نیز شرایط داخلی آن‫ها اثر مهمی در تعیین نقش این ترکیبات دارد، به‫طوری‫که اثرات کشندگی این نانو ذرات بسته به نوع سلول متغییر است  (8). همچنین تاکنون چندین مطالعه اثر ضد سرطانی و ضد متاستازی این نانو ذرات را متذکر شده اند (9). لذا در پژوهش حاضر در مرحله اول اثر نانو ذرات اکسید سریم بر سمیت و کشندگی دو رده سلولی مختلف از سرطان پستان و رده سلول نرمال بررسی شد و سپس نقش احتمالی این نانو ذرات روی مهار متاستاز از طریق تاثیر روی بیان ژن‫های سرکوبگر متاستازی NM23 و KAI-1 بررسی شد.

نتایج مطالعه حاضر بیانگر اثرات کاهنده بقای سلولی نانوذره در غلظت‌های 5/6 میلی‫گرم و 650 میکروگرم در رده سلولی T47D و غلظت‌های 5/6 میلی‫گرم، 65 و 650 میکروگرم، در رده سلولی MCF-7 است که می‌توان گفت نانو ذرات اکسید سریم در یک فرایند وابسته به دوز و نوع سلول می‫تواند اثر کشندگی روی سلول‌های سرطان پستان داشته باشد. همچنین در این مطالعه رده سلولی HEK293 نیز به‫عنوان رده نرمال تحت تیمار با نانو ذرات سریم قرار گرفتند و آنالیز نتایج MTT نشان داد که تنها در غلظت 5/6  میلی‌گرم نانوذره سریم، سلول‌های HEK293 مرگ 25 درصدی را نشان می‌دهند، به‫عبارتی نانوذره سریم تنها در غلظت‌های بالا دارای اثرات سمی برای سلول‌های نرمال است اما در غلظت‌های پایین‫تر مانند غلظت 650 میکروگرم که نانو ذرات اکسید سریم باعث مرگ بیش از  50 درصد سلول‌های سرطانی پستان MCF-7 و T47D شدند، اثرات سمیتی بسیار پایینی برای سلول‌های HEK293  دارند. بنابراین در صورت فرمولاسون نانوذره اکسید سریم به‫عنوان یک داروی ضد سرطان با بهینه کردن غلظت می‫توان به یک داروی با اثرات جانبی کم رسید. این مساله جهت درمان سرطان بسیار مهم است زیرا در حال حاضر معضل اصلی درمان سرطان اثرات جانبی منفی داروها روی سلول های طبیعی است.

در مطالعه‫ای که در سال 2013 روی بیماران مبتلا به سرطان پانکراس انجام شد مشخص شد که نانو ذرات اکسید سریم (CONP) علاوه بر نقش حمایتی سلول‫های غیر سرطانی در برابر اثر اکسیداتیو رادیودرمانی، سبب افزایش pH و باعث افزایش حساسیت سلول‫های سرطانی به رادیودرمانی شده و باعث افزایش آپوپتوزیس می‫شود. در این بررسی از موش‫های سرطانی شده استفاده شد و همین‫طور در یک مرحله این دارو به بیماران قبل و بعد از رادیوتراپی تجویز شد (10). هم­چنین در مطالعه ای که Colon J و همکارانش (11) روی سرطان GI (Gastro-Intestinal cancer) داشتند گزارش کردند که CONP در pH کمتر از 3/4 که در اثر برخورد پرتو ها در محیط اطراف سلول های توموری ایجاد می‫شود فعال شده و نقش کاتالاز را ایفا می‫کند. همین‫طور فعالیت آن مشابه سوپر اکسید دیسموتاز است و می‫تواند باعث مهار آسیب‫های شدید DNA شود. نتایج مطالعات پاتولوژیک نیز نشان داد که استفاده از نانو ذرات باعث افزایش بروز آپوپتوزیس در سلول‫های توموری شده و باعث افزایش مقاومت سلول‫های سالم در برابر پرتوهای یونیزان می‫شود. نتایج مطالعه حاضر تاییدی است بر این مطالعات بوده که اثر ضد سرطانی این نانوذره را نشان دادند. هرچند در مطالعه حاضر اثرات حفاظتی و یا آپوپتوتیک نانوذره در سرطان پستان بررسی نشد که لازم است در ادامه این مطالعه تکمیل شد.

ژن NM23 به‌عنوان ژن سرکوبگر متاستاز شناخته می‌شود و میزان بیان این ژن در سلول‌هایی که سرطانی شده‌اند کاهش می‫یابد.. بیان این ژن ارتباط مستقیمی با ایجاد متاستاز در سرطان پستان نشان داده است بنابراین می‌توان میزان بیان این ژن را به‌عنوان نشانه‌ای از درجه متاستاز و سرطان در نظر گرفت. هرچند گزارش‌ها متفاوت نیز وجود دارد. برای مثال کوبوکو و همکاران (12 و 13) گزارش دادند که ارتباط معنی‫داری بین بیان ژن NM23 اندازه‌گیری شده با روش ایمنوهیستوشیمی و سرطان پستان مشاهده نکردند.

همچنین ژن KAI-1 با مهار متاستاز در ارتباط است به‌طوری‌که نشانداده شده بیان این ژن در مراحل پیشرفته سرطان و گسترش متاستاز کاهش می‫یابد (13 و 14). بنابراین می‌توان میزان بیان این ژن ها را به‌عنوان نشانه‌ای از درجه متاستاز و سرطان در نظر گرفت. با توجه به اینکه چندین مطالعه اثر ضد متاستازی نانو ذرات اکسید روی را متذکر شدند (15 و 16). در این مطالعه نیز با بررسی اثر نانوذره مذکور روی بیان این دو ژن تاثر نانوذره سریم روی متاستاز سلول‫های سرطان پستان بررسی شد. به‫طوری‫که نتایج نشان داد که بیان ژن NM23 و KAI-1 در هر دو رده سلولی تیمار شده با نانو ذرات اکسید سریم نسبت به سلول‌های تیمار نشده دچار افزایش بیان نشدند در‫صورتی‫که اگر نانوذره اکسید سریم باعث مهار متاستاز در سرطان پستان می‫شد انتظار می رفت این دو ژن دچار افزایش بیان شوند. بنابراین می‫توان چنین استدلال کرد که یا CONP در سرطان پستان اثر ضد متاستازی ندارد یا اینکه این اثر را از مسیرهای سیگنالینگ دیگری که در آن‫ها این دو ژن دخالت ندارند اعمال می‫کند. در تایید این استدلال می‫توان به مطالعه جیری و همکاران  (17) در اشاره کرد که نشان  دادند نانو ذرات اکسیدسریم از طریق مهار رگ‫زایی در سرطان تخمدان می‌توانند با مهاجرت و تهاجم رده سلولی سرطان تخمدان مقابله کند. بنابراین لازم است مطالعات بیشتری در این زمینه روی سرطان پستان صورت گیرد.

 

نتیجه‫گیری

در این مطالعه مشاهده شد که نانو ذرات اکسیدسریم در یک روند وابسته به دوز و نوع سلول می تواند اثر سمی روی رده‏های سلولی سرطان پستان داشته باشد. بنابراین نتایج استفاده از نانو ذرات اکسید سریم برای درمان سرطان پستان امیدوارکننده است ولی از طرف دیگر دیده شد تأثیر این نانوذره بر ژن‌های سرکوب‌کننده متاستاز که یکی از مهم‌ترین مراحل سرطان است، کاهنده هست و در نتیجه حداقل در مورد ژن‌های بررسی ‌شده در این پژوهش می‌توان گفت نانو ذرات اکسیدسریم نمی‫تواند باعث سرکوب متاستاز ئر سرطان پستان شود. برای پی بردن به‫دلیل این خواص نانو ذرات اکسید سریم نیاز به مطالعات بیشتر است به‫طور مثال می توان با ارزیابی دیگر ژن‫های مهم در مسیر آپوپتوزیس و متاستاز در سلول‌های تیمار شده با نانو ذرات سریم و یا افزایش کارایی نانو ذرات از طریق کانجوگیشن با عوامل ضد سرطانی، ارزیابی دقیق‫تری از مکانیسم‫های ضد سرطانی این نانوذره در سرطان پستان به‫دست آورد.

 

تشکر وقدردانی

مقاله حاضر مستخرج از پایان نامه دانشجوی کارشناسی ارشد دانشگاه آزاد اسلامی واحد ورامین -پیشوا (شیوا زمانی) می‫باشد. نویسندگان اعلام می دارند که تضادی در منافع وجود ندارد.

  1. Li CI, Weiss NS, Stanford JL, Daling JR. Hormone replacement therapy in relation to risk of lobular and ductal breast carcinoma in middle aged women. Cancer. 2000; 88(11): 2570-7.
  2. Katz SJ, Lantz PM, Janz NK, Fagerlin A, et al. Patient involvement in surgery treatment decisions for breast cancer. J Clin Oncol. 2005; 23(24): 5526-33.
  3. Han W, Zhang C, Cao F-y, Cao F, et al. The prognostic role of Sirt1 expression in solid malignancies: a meta-analysis. Oncotarget. 2017; 8(39): 66343–51.
  4. Duan S, Nordmeier S, Buxton IL. Exploring the metastatic potential of exosomal NM23 signaling using a triple negative breast cancer model in mice. Cancer Research. 2016;76(14 Supplement): 4275-.
  5. Lacombe M-LL, Milon L, Munier A, Mehus JG, et al. The human Nm23/nucleoside diphosphate kinases. J Bioenerg Biomembr. 2000; 32(3): 247-58.
  6. Steeg PS, De La Rosa A, Flatow U, MacDonald NJ, et al. Nm23 and breast cancer metastasis. Breast Cancer Res Treat. 1993; 25(2): 175-87.
  7. Asati A, Santra S, Kaittanis C, Nath S, et al. Oxidase-like activity of polymer-coated cerium oxide nanoparticles. Angew Chem Int Ed Engl. 2009; 48(13): 2308-12.
  8. Alili L, Sack M, Karakoti AS, Teuber S, et al. Combined cytotoxic and anti-invasive properties of redox-active nanoparticles in tumor-stroma interactions. Biomaterials. 2011; 32(11): 2918-29.

10.Wason MS, Colon J, Das S, Seal S, et al. Sensitization of pancreatic cancer cells to

 

radiation by cerium oxide nanoparticle-induced ROS production. Nanomedicine. 2013; 9(4):558-69.

11. Colon J, Hsieh N, Ferguson A, Kupelian P, et al. Cerium oxide nanoparticles protect gastrointestinal epithelium from radiation-induced damage by reduction of reactive oxygen species and upregulation of superoxide dismutase 2. Nanomedicine. 2010; 6(5): 698-705.

12. Cubukcu E, Kanat O, Fatih Olmez O, Kabul S, Canhoroz M, Avci N, et al. Prognostic significance of estrogen receptor, progesterone receptor, HER2/neu, Ki-67, and nm23 expression in patients with invasive breast cancer. J BUON. 2013; 18(2): 359-65.

13.Yamauchi H, Cristofanilli M, Nakamura S, Hortobagyi GN, et al. Molecular targets for treatment of inflammatory breast cancer. Nat Rev Clin Oncol. 2009; 6(7): 387-94.

14. Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, et al. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science. 1994; 266(5182): 66-71.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

15. Liu WM, Zhang XA. KAI1/CD82, a tumor metastasis suppressor. Cancer Lett. 2006; 240(2): 183-94.

16. Ouyang Z, Mainali MK, Sinha N, Strack G, et al. Potential of using cerium oxide nanoparticles for protecting healthy tissue during accelerated partial breast irradiation (APBI). Phys Med. 2016; 32(4): 631-5.

Giri S, Karakoti A, Graham RP, Maguire JL, et al. Nanoceria: a rare-earth nanoparticle as a novel anti-angiogenic therapeutic agent in ovarian cancer. PLoS One. 2013; 8(1): e54578.