بررسی اثرات سمیت سلولی و آپوپتوزیسی داروی اگزالی پلاتین بر روی رده سلولی سرطان کولون (HT29) و آنالیز بیان ژن‫های آپوپتوزیسی کاسپاز 3 و کاسپاز 9 توسط روش Real Time PCR‬‬‬‬‬‬

نوع مقاله: علمی - پژوهشی

نویسندگان

1 گروه زیست شناسی، واحد تهران شرق، دانشگاه آزاد اسلامی، تهران، ایران

2 گروه زیست شناسی، واحد رودهن، دانشگاه آزاد اسلامی، رودهن، ایران

چکیده

هدف: هدف از این مطالعه بررسی اثرات سمیت سلولی داروی اگزالی پلاتین بر رده سلولی سرطان کولون (HT29) و آنالیز بیان ژن­های آپوپتوزی کاسپاز 3 و 9 می­باشد.
مواد و روشها: در این مطالعه، ابتدا سمیت سلولی داروی اگزالی­پلاتین بر روی رده سلولی HT29 با استفاده از روش MTT‌ در غلظت‫های 100، 50، 25، 5/12، 25/6 و 125/3 میکروگرم در میلی لیتر بررسی شد و غلظت 50 درصد کشندگی (IC50) آن تعیین شد. پس از تیمار سلول‫ها با غلظت IC50، RNA سلول‫ها استخراج شده و به cDNA تبدیل شد و میزان بیان ژن‫های آپوپتوزیسی کاسپاز 3 و 9 نسبت به ژن مرجع β-actin با استفاده از روش Real Time PCR بررسی شد.
نتایج: تیمار سلول‫ها در غلظت­های مختلف نشان داد که داروی اگزالی پلاتین در غلظت 100 میکروگرم در میلی‫لیتر بیشترین اثر سمیت سلولی را دارد که از لحاظ آماری معنی‫دار می‫باشد و میزان IC50 µg/ml 6 محاسبه شد. هم‫چنین، نسبت بیان ژن‫های آپوپتوزیسی کاسپاز 3 و 9 به ژن مرجع در رده سلولی HT29‌ تیمار شده با اگزالی پلاتین به‫ترتیب به‫میزان (001/0p<) 72/0±69/2 و (001/0p<) 56/0±26/3 افزایش یافت.
نتیجه گیری: با­ توجه به سمیت سلولی و القای فرایند آپوپتوزیس در رده سلولی سرطان کولون توسط داروی اگزالی پلاتین، می‫توان نتیجه­گیری کرد که داروی اگزالی پلاتین گزینه مناسب جهت درمان سرطان کولون می‫باشد.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

سرطان یک بیماری پیچیده است که توسط تکثیر سلولی کنترل نشده و فرار سلول­ها از سیستم ایمنی ایجاد می‫شود و سبب هموار کردن راه‫های تهاجم سلولی و متاستاز می‫شود. سرطان یک مشکل عمده بهداشت عمومی در همه جهان است و از هر 4 مورد مرگ، 1 مورد مربوط به سرطان است (۱). سرطان روده بزرگ یا سرطان کولون سومین سرطان شایع در دنیا می‫باشد، به‫طوری‫که در ایالات متحده درصد بالایی از مرگ و میر را به‫خود اختصاص داده است. بر طبق آمار سازمان بهداشت جهانی سرطان کولون سومین سرطان شایع در مردان و دومین سرطان رایج در زنان در سال 2016 بوده است (۲). میزان زنده ماندن افراد دارای متاستاز سرطان کولون به‫مدت 5 سال است، به‫طوری‫که این بیماران به داروهای ضدسرطان نیز مقاومت پیدا می‫کنند (۳). در سال­های اخیر به‫علت افزایش شیوع مرگ و میر ناشی از سرطان و نقص روش‫های شیمی درمانی و رادیو درمانی در فرم‫های پیشرفته سرطان، نیاز به یافتن شیوه‫های جدید برای کنترل سرطان احساس می‫شود (۴). انتخاب نوع روش درمانی براساس مرحله بندی بیماری انجام می ‫شود و جراحی درمان قطعی در مراحل اولیه بیماری می‫باشد. امروزه از روش‫های شیمی درمانی و گاها رادیوتراپی در مراحل خاصی از بیماری سرطان کولون استفاده می‫شود (۵). در خصوص نوع رژیم درمانی و داروهای مصرفی و نیز زمان استفاده از آن تحقیقات مختلفی در مراکز جراحی سرطان در سرتاسر دنیا در حال انجام است (۶). داروی اگزالی پلاتین داروی نسل سوم پلاتینوم ضدسرطان است که جهت درمان سرطان کولون پیشرفته استفاده می‫شود. اگزالی پلاتین با از بین بردن سلول­های سرطانی و کند کردن رشد تومور عمل می‌کند اما مکانیسم دقیق مرگ سلول های سرطانی به‫طور کامل مشخص نیست (۷). برخی مطالعات نشان می­دهد که اگزالی پلاتین تحت واکنش‫ های غیرآنزیمی در محلول­های فیزیولوژیک از طریق لیگاند اگزالات ناپایدار به مشتقات فعال تبدیل می‫شود. چندین گونه ناپایدار شامل Monoaquo  و diaquo DACH  پلاتینوم با پیوند کووالانسی به ماکرومولکول­ها متصل می‫شوند و سبب مرگ سلول‫ها می‫شوند (۸). هم‫چنین این دارو پیوند متقاطع داخل زنجیره‫ای و بین زنجیره‫ای با DNA  تشکیل می‫دهند. پیوندها بین موقعیت N7 و دو گوانین مجاور (GG، آدنین- گوانین مجاور  (AG)و گوانین‫های جدا شده توسط نوکلئوتید (GNG) تشکیل می‫شود. این پیوندها باعث مهار تقسیم و رونویسی DNA می‌شوند. اگزالی پلاتین به‫طور انتخابی مانع سنتز دئوکسی ریبونوکلئوتید اسید (DNA) می‫شود، به‫طوری‫که مقدار گوانین و سیتوزین بستگی به مقدار اگزالی پلاتین تجویزی دارد (۹).

مطالعات نشان می‫دهد که یکی از مکانیسم­هایی که داروی اگزالی پلاتین رشد سلول های سرطانی روده بزرگ را مهار می‫کند، آپوپتوزیس است. آپوپتوز یس مرگ فیزیولوژیک سلولی است که در شرایط طبیعی سبب حذف سلول‫های پیر، آسیب دیده و مضر می‫شود و برای تکامل و هوموستازی بافتی ضروری است. آپوپتوزیس در ترمیم و نوسازی بافتی و نیز حذف سلول‫های T خود واکنش­گر نقش دارد (۱۰). هرگونه اختلال در روند آپوپتوزیس، منجر به بیماری می‫شود که می‫تواند ناشی از کاهش مرگ سلولی باشد که منجر به ایجاد و رشد سلول‫های سرطانی و یا اختلالات خود ایمنی می‫شود (۱۱). به‫طور معمول داروهای شیمی­درمانی سبب القای آپوپتوزیس و تغییر بیان ژن­های آپوپتوزیس در سلول‫های سرطانی می شوند. آپوپتوز مرگ فیزیولوژیک سلولی است و در طی تحریکات خاصی اتفاق می­افتد، در حالی‫که نکروز مرگ پاتولوژیک سلول بوده و در طی آسیب های شدید به سلول از قبیل هیپوکسی و هیپرترمی این نوع مرگ سلولی اتفاق می افتد. در فرایند آپوپتوزیس سلول چروکیده و کوچک می‫شود در حالی‫که در نکروز سلول متورم و بزرگ می‫شود. ارگانل‫های سیتوپلاسمی در فرایند آپوپتوزیس دست نخورده باقی می‫مانند در حالی‫که در نکروز تخریب می‫شوند (۱۲).

گسترش روز افزون سـرطان کولون و مـشکلات فـراوان ناشی از آن از یک سو و عدم موفقیت کافی روش­های درمـانی رایج و سنتی در مبارزه اختصاصی بـا آن موجـب توجـه ویـژه محققین نسبت به روش­های درمانی هدفمند گشته است (۱۳). بنابراین، هدف از این مطالعه بررسی اثرات سمیت سلولی داروی اگزالی­پلاتین بر روی رده سلولی سرطان کولون (HT29) و آنالیز بیان ژن­های آپوپتوزی کاسپاز 3 و 9 می­باشد.

 

مواد و روش‌ها

داروی اگزالی پلاتین و کشت سلول 

داروی اگزالی پلاتین (Eloxatin®; Sanofi, France) با مشخصات وزن مولی g/mol 2858/397 با فرمول شیمیایی C8H14N2O4Pt تهیه شد. هم‫چنین، رده سلولی سرطان کولون (HT29 cell line) از بانک سلولی انستیتو پاستور ایران با کد NCBI C135 خریداری شد. ابتدا سلول‌ها در محیط کشت RPMI1640 (Biosera, USA) غنی شده با 1 (v/v) پنی‌سیلین ـ استرپتومایسین و 10 درصد سرم جنین گاوی (Fetal Bovine Serum: FBS) کشت داده شدند و در دمای 37 درجه سانتی‌گراد و 5 درصد رطوبت قرار داده شدند.

بررسی سمیت سلولی

به‫منظور بررسی اثرات کشندگی سلولی داروی اگزالی پلاتین بر روی رده سلولی HT29 از روش رنگ سنجی MTT (Sigma Aldrich, Germany ) استفاده شد. غلظت­های 100، 50، 25، 5/12، 25/6 و 125/3 میکروگرم در میلی‫لیتر از دارو در فاصله زمانی 24 ساعت بر روی رده سلولی HT29 تیمار شد. بعد از گذشت زمان فوق، محتوای چاهک‫های پلیت 96 خانه‌ای به دقت خارج شد و به آن رنگ MTT  (Microculture Tetrazolium Test) اضافه شد و به‫مدت 4 ساعت تحت شرایط CO2 5 درصد و دمای 37 درجه سانتی‌گراد نگه داشته شد. سپس رنگ MTT، جداسازی شد و کریستال‌های فورمازان تولید شده به‫وسیله سلول های زنده در ایزوپروپانول حل شد. در نهایت جذب نمونه ها با استفاده از دستگاه قرائت گر الایزا (ELISA reader, Oraganon Teknika­، هلند) در طول موج 570 نانومتر قرائت شد و میزان کشندگی سلول توسط فرمول زیر محاسبه شد:

 100´(جذب نوری سلول‌های کنترل بر جذب نوری سلول های تیمار شده)= میزان بقای سلولی

هم‌چنین میزان دوز 50 درصد کشندگی (IC50 یاHalf maximal inhibitory concentration) نیز محاسبه شد.

اندازه گیری بیان ژنهای کاسپاز 3 و 9

میزان بیان ژن‌های آپوپتوزیسی کاسپاز 3 و 9 در سلول‫های HT29 تیمار شده با داروی اگزالی پلاتین با استفاده از روش Real Time PCR کمی نسبی (qRT-PCR) سنجیده شد. در ابتدا کل RNA سلول­های تیمار شده و نشده با استفاده از کیت استخراج RNA (کیاژن،آمریکا) طبق دستورالعمل آن استخراج شد و غلظت آن به وسیله دستگاه فتونانومتر(IMPLEN GmbH، آلمان) اندازه‌گیری شد. ساخت مولکول‌های DNA مکمل باکیت Revert AidTM First strand cDNA Synthesis Kit (Fermentas، لیتوانی) انجام گرفت که در آن مخلوط واکنش حاوی 5 میکرولیتر بافر واکنش x5، یک میکروگرم RNA، 5/0 میکرولیتر آغازگر شش نوکلئوتیدی تصادفی، 5/0 میکرلیتر آغازگر الیگوdT، دو میکرولیتر مخلوط داکسی نوکلئوتید تری فسفات (10 میلی‫مولار)، یک میکرولیتر مهارکننده آنزیم RNase (20 واحد در میکرولیتر)، یک میکرولیتر آنزیم رونوشت بردار معکوس و آب مقطر دو بار تقطیر (تا حجم نهایی 20 میکرولیتر) (Fermentas، لیتوانی) بود. برنامه دمایی- زمانی به‫صورت 25 درجه سانتی‫گراد به‫مدت 5 دقیقه (برای اتصال آغازگر)، 42 درجه سانتی‌گراد به‫مدت 60 دقیقه (ساخت cDNA)، 70 درجه سانتی‌گراد به‫مدت 5 دقیقه (غیر فعال شدن رونوشت بردار معکوس) و 4 درجه سانتی گراد به‫مدت 5 دقیقه انجام گرفت. پرایمرهای مورد استفاده برای ژن‌های هدف کاسپاز 3 و 9 بوده و ژن β-actin به‫عنوان کنترل داخلی مورد استفاده قرار گرفت. توالی آغازگرهای جلویی و برگشتی ژن هدف کاسپاز 3 به‫صورت 5'- ATGGGAGCAAGTCAGTGGAC -3'  جلویی، دمای 68 درجه سانتی گراد و                                      5'- CGTACCAGAGCGAGATGACA -3'  برگشتی، دمای 3/65 درجه سانتی‌گراد بود. توالی آغازگرهای جلویی و برگشتی ژن هدف کاسپاز 9 به صورت  5'- GGCGGAGCTCATGATGTCTGTG -3'  جلویی، دمای 67 درجه سانتی گراد و    5'- TTCCGGTGTGCCATCTCCATCA -3' برگشتی، دمای 3/66 درجه سانتی گراد و برای ژن مرجع β-actin به صورت 5'- TCCTCCTGAGCGCAAGTAC -3' جلویی، دمای 9/66 درجه سانتی گراد و   5'- CCTGCTTGCTGATCCACATCT -3'  برگشتی، دمای 4/63 درجه سانتی‌گراد است. در نهایت واکنش Real Time PCR با استفاده از دستگاه Light cycler (Bioneer، کره) با شرایط دمایی 95 درجه سانتی گراد: 1 دقیقه، 95 درجه سانتی‌گراد 15 ثانیه، 60 درجه سانتی‌گراد 60 ثانیه انجام گرفت.

بررسی قطعه قطعه شدن DNA

جهت بررسی آزمون قطعه قطعه شدن DNA  که نشان دهنده آپوپتوزیس است، ابتدا سلول‫های سرطانی HT29 با غلظت IC50 داروی اگزالی پلاتین تیمار شدند و پس از 24 ساعت با محلول PBS سلول ها شستشو داده شدند و سپس تریپسینه شدند. سوسپانسیون سلولی را در g 400 سانتریفیوژ کرده و به رسوب حاصله 600 میکرولیتر بافر لیز کننده (100mM EDAT، 400mM NaCl، 10mM Tris-Hcl) و 10 میکرولیتر محلول RNAase (4mg/mL)‌ اضافه شد و سپس در دور g 18000 در دمای اتاق به‫مدت 10 دقیقه سانتریفیوژ شد. محلول رویی را جمع آوری کرده و به آن 600 میکرولیتر ایزوپروپانول اضافه کرده و به‫مدت 15 دقیقه بر روی یخ انکوبه شد و مجددا در دور g 18000 به‫مدت 20 دقیقه سانتریفیوژ کرده و رسب حاصله با 600 میکرولیتر اتانول 70 درصد شستشو داده شد. رسوب حاصل را در دمای اتاق خشک کرده و در 200 میکرولیتر بافر Tris-EDTA 10mM حل گردید. به دنبال آن DNA حاصله در ژل آگارز 2 درصد در ولتاژ 100 به‫مدت 1 ساعت الکتروفورز شد و با دستگاه Gel document مشاهده شد. 

 

آنالیز آماری

داه‌های جمع‌آوری شده با استفاده از نرم افزار آماری  SPSS و آزمون‌ آماری آنالیز واریانس یک‫طرفه تجزیه و تحلیل شدند. اطلاعات به‫صورت mean±standard deviation (SD) نمایش داده شده و 05/0­p< معنی‫دار در نظر گرفته شد.

 

نتایج

تیمار سلول هایHT29 با داروی اگزالی پلاتین در مدت زمان 24 ساعت

تیمار سلول هایHT29 با غلظت‫های مختلف  µg/ml125/3، 25/6، 5/12، 25، 50، 100 از داروی اگزالی پلاتین با استفاده از تست MTT طی مدت 24 ساعت انجام شد. نتایج نشان داد که داروی اگزالی­پلاتین در غلظت­های µg/ml100بیشترین مهار تکثیر سلولی را داشته اند که از لحاظ آماری معنی‫دار بوده است    (001/0p<). میزان IC50 برای داروی اگزالی پلاتین در مدت زمان 24 ساعت µg/ml 6 محاسبه شد. بر اساس تست آماری آنالیز واریانس یک‫طرفه گروه­های تست با گروه کنترل مورد مقایسه قرار گرفته است. نتایج حاصل از بقای سلول‫ها در مدت زمان 24 ساعت در شکل 1 نشان داده شده است.

 

 

 

 

 

 

 

 

 

شکل 1: درصد بقای سلول های HT29 در برابر غلظت‫های مختلف داروی اگزالی پلاتین در مدت زمان 24 ساعت. نتایج به‫صورت درصد بقا در مقایسه با نمونه‫های کنترل گزارش شده است (*:05/0­ p<­ ، **:01/0 p< ، *** 001/0p< : n=3).

 

 

پروفایل (mRNA) بیانی ژن­های مورد مطالعه در سلولهای HT29 تیمار شده با داروی اگزالی پلاتین

آنالیز تغییر بیان ژن­های آپوپتوزی کاسپاز 3 و 9 در سلول HT29 تیمار شده با غلظت 50 درصد (IC50) بعد از 24 ساعت با روش Real Time PCR انجام شد. تکثیر اختصاصی قطعات ژنی مورد نظر، عدم جفت شدن آغازگرها و عدم تکثیر قطعات غیراختصاصی برای هر ژن با

 

استفاده از منحنی ذوب تعیین شد، به‫طوری‫که رنگ سبز متعلق به ژن بتا-اکتین، رنگ زرد متعلق به ژن کاسپاز 3 و رنک قرمز متعلق به ژن کاسپاز 9 می باشد (شکل 2 و 3).

 

 

 

 

شکل 2: نمودار حاصل از تکثیر ژن‌های β-actin، کاسپاز 3 و 9. همان‫طور که در تصویر مشاهده می‫شود تکثیر و میزان فلورسنت نمونه‫ها از سیکل 14 به بعد به‫صورت لگاریتمی افزایش یافته است.

 

 

شکل 3: آنالیز منحنی ذوب ژنهای β-actin، کاسپاز 3 و کاسپاز 9. رنگ سبز متعلق به ژن بتا-اکتین، رنگ زرد متعلق به ژن کاسپاز 3 و رنک قرمز متعلق به ژن کاسپاز 9 می‫باشد.

 

 

 در این مطالعه، اختلاف چرخه‌های آستانه به‫دست آمده از نمونه‌های مورد آزمایش (سلول‌های تیمار شده با دارو) و نمونه‌های کنترل (سلول‌های تیمار نشده با دارو) محاسبه و میزان بیان ژن با استفاده از فرمول ΔΔCt (نسبت ژن‌ هدف به ژن مرجع (β-actin) از طریق 2 –ΔΔCt) محاسبه شد. نسبت بیان ژن‌های کاسپاز 3 و 9 به ژن مرجع β-actin در رده سلولی سرطانی HT29 تیمار شده با دارو به‫ترتیب به‫میزان (001/0p<) 72/0±69/2 و (001/0p<) 56/0±26/3 طی 24 ساعت افزایش یافت (شکل 4).

 

 

 

 

 

 

 

شکل 4: نمودار بیان ژن‫های بتا-اکتین، کاسپاز 3 و  کاسپاز 9. همان‫طور که در تصویر مشاهده می‫شود تغییر بیان ژن‫های کاسپاز 3 و 9 نسبت به ژن مرجع بتا-اکتین معنی‫دار می‫باشد. (*:05/0­ p<­ ، **:01/0< p ، *** 001/0p< : n=3).

 

 

 

آزمون قطعه قطعه شدن DNA

نتایج حاصل از تیمار سلول‫های سرطانی HT29 با غلظت IC50 داروی اگزالی پلاتین نشان داد که این دارو موجب القا قطعه قطعه شدن DNA ژنومی سلول‫های سرطانی می شود. قطعه قطعه شدن DNA ژنومی که از خصوصیت سلول­های آپوپتوتیک است، بر روی ژل آگارز 2 درصد تایید شد (شکل 5). همان‫طور که در تصویر مشاهده می‫شود داروی اگزالی پلاتین قادر به القا برش DNA در نواحی بین کروموزومی است که در مقایسه با نمونه کنترل (سلول تیمار نشده)‌ اثری بر روی DNA ژنومی نداشته است.

 

 

 

 

 

 

 

 

 

شکل 5: تصویر ژل الکتروفورز از تست قطعه قطعه شدن DNA برای نشان دادن آپوپتوزیس. 1: مارکر DNA، 2: نمونه DNA کنترل، 3: نمونه DNA تیمار شده با دارو. همان‫طور که مشاهده می‫شود نمونه DNA تیمار شده با دارو اگزالی پلاتین قطعه قطعه شده است که نشانگر القا فرایند آپوپتوزیس می‫باشد.

 

 

 

بحث

خاصیت ضد سرطانی داروهای ضدسرطانی از چندین سال قبل مشخص شده است و به‫همین دلیل استفاده از داروهای مناسب جهت درمان سرطان از اهمیت بالایی برخوردار شده است (15-14). با توجه به این که تغییرات ژنتیکی زیادی مورد نیاز است تا فرم سرطانی یک سلول ایجاد شود و به‫علت اینکه ایجاد بسیاری از سرطان‫ها جنبه ارثی دارد، استفاده از موادی که بتوانند فرایند متاستازی را مهار کنند مورد توجه می‫باشد. یعنی اگرچه نمی‫توان از ایجاد تومور اولیه جلوگیری کنیم، ولی این امکان وجود

 

 

دارد که جلوی فرایند متاستازی که علت اصلی مرگ و میر بیماران سرطانی می‫باشد، گرفته شود (19-16). سلول‫های سرطانی از مرگ برنامه ریزی شده سلول یا آپوپتوزیس فرار می‫کنند که یکی از دلایل آن تغییر در بیان ژن‫هایی است که در تنظیم این فرآیند دخیل می‫باشند. بیشتر عوامل ضدسرطانی آثار درمانی خودشان را با القای مرگ سلولی برنامه ریزی شده اعمال می‫کنند (21-20). القای مرگ برنامه ریزی شده یکی از مهم‫ترین روش‫ها در از بین بردن بدون عارضه سلول‫های سرطانی است (۲۲). در این مطالعه، با استفاده از روش رنگ سنجی MTT نشان داده شد که داروی اگزالی پلاتین دارای اثر کشندگی وابسته به دوز در سلول های سرطانی کولون می‫باشد. امروزه مراکز مطالعات سرطان در جستجوی عوامل ضد سرطان با ضریب اطمینان بالاتر و قابلیت پذیرش بیشتر برای بیماران می‫باشند. در این میان درمان‫های هدف‫دار شده با اهداف مولکولی که در رشد و یا پیشرفت تومور مداخله می‫کنند اختصاصیت بالایی به سلول‫های توموری دارند و پنجره درمانی جدیدی با کاهش سمیت را به‫ روی علم باز کرده اند (۲۳). علاوه بر این می‫توان در ترکیب با عوامل شیمی درمانی سایتوتوکسیک برای فعالیت ضد سرطانی بیشتر از عوامل سینرژیسم و یا مازاد استفاده کرد (۲۴). تاکنون مطالعات مختلفی در جهت استفاده از داروی اگزالی پلاتین در درمان انواع سرطان‫ها انجام شده است که نتایج این مطالعات با مطالعات ما همسو بوده است. Shisheng Tan و همکاران (۲۵) اثرات سمیت سلولی داروی اگزالی پلاتین را به‫همراه ترکیب 3-متیل آدنین مورد بررسی قرار دادند. در این مطالعه با استفاده از روش MTT‌ اثرات سمیت سلولی داروی فوق الذکر را مورد مطالعه قرار دادند. نتایج این مطالعه نشان داد که داروی اگزالی پلاتین قابلیت سمیت سلولی قابل توجهی در رده سلولی سلولی CT26  (سرطان کولون) دارد. هم‫چنین نتایج نشان داد که این دارو فرایند آپوپتوز و اتوفاژی را القا می‫کند. Teixeira SF و همکاران (۲۶) اثرات سمیت سلولی داروی اگزالی پلاتین را به‫همراه پیریدینیل کربوکساماید را بر روی رده سلولی سرطان ریه (NCI-H1299) مورد مطالعه قرار دادند. نتایج این مطالعه نشان داد که سمیت سلولی ترکیب فوق وابسته به دوز است و توانایی القا آپوپتوز را دارد. همچنین مطالعه دیگری، ارزیابی آنتی اکسیدانتی و ضد سرطانی نانوژل‫های حاوی داروی اگزالی پلاتین روی سلول‫های سرطان کولون (HT29) را نشان دادند. نتایج این پژوهش پتانسیل بالای نانوژل‫ها در کاهش 39/16 درصدی زنده ماندن رده سلولی سرطان کولون را نشان داد (۲۷).

همان‫طور که اشاره شد نتایج این مطالعه نشان داد که اثر کشندگی دارو بر روی سلول‫ها، بستگی به غلظت دارو دارد. نتیجه گیری کلی نشان داد که داروی اگزالی پلاتین اثرات مهاری برروی سلول‫های سرطانی از خود نشان می‫دهند که این پدیده به‫دلیل اثر مستقیم آن‫ها برروی سامانه تنفسی سلول در میتوکندری می‫باشد. به‫طور کلی القای مرگ برنامه ریزی شده سلولی یکی از رویکردهای جذاب در حوزه پزشکی به شمار می‫رود. مسیر مرگ سلولی می‫تواند شامل فعال سازی رویدادهای پروآپوپتوتیک اندامک میتوکندری در سلول باشد که با آزاد سازی سیتوکروم c از آن آغاز می‫شود. علاوه بر این اثرات داروی اگزالی پلاتین در افزایش بیان ژن پروتئاز کاسپاز 3 و 9 در سلول‫های سرطانی و القای مرگ برنامه ریزی شده سلولی در مطالعات مختلف نشان داده شده است. بنابراین با توجه به میزان فعالیت بالای میتوکندری در فرایند تنفس سلول‫های سرطانی نسبت به سلول‫های طبیعی، بستر مناسبی برای داروی اگزالی پلاتین جهت تخریب سلول‫های سرطانی فراهم می­شود (28). یکی دیگر از اهداف این مطالعه بررسی میزان بیان ژن‫های آپوپتوزی کاسپاز 3 و 9 بود. نتایج این مطالعه نشان داد که بعد از تیمار سلول‫های HT29 با داروی اگزالی پلاتین، بیان ژن‫های آپوپتوزیسی نسبت به ژن مرجع افزایش بیان چشم‫گیری داشتند که نشان دهنده القای پدیده آپوپتوزیس در سلول‫های سرطان کولون می‫باشد. از آنجاکه فعالیت ژن های کاسپاز 3 و 9 در اثر تیمار با داروی اگزالی پلاتین افزایش می‫یابد، به‫نظر می‫رسد که سیتوکروم C‌ رها شده به‫درون سیتوزول به همراه کاسپاز 3 و 9 کمپلکس پروتئینی آپوپتوزوم را تشکیل می‫دهد و موجب القای آپوپتوزیس شده است. بدیهی است که شناسایی اهمیت الگوی بیان این ژن در پاسخ به‫فعالیت متاستازی داروهای ضد سرطانی حائز اهمیت است. بنابراین بررسی‫های بیشتری برای اثبات این که آیا پروفایل بیانی mRNA این ژن می‫تواند مدرکی باشد برای نقش آن در پیش گویی دقیق تر و اختصاصی پاسخ سرطان به درمان ضروری است (29).

نتایج به‫دست آمده از این مطالعه استفاده درمانی داروی اگزالی پلاتین را در سلول‫های سرطانی کولون نشان داد. طبق این بررسی‫ها مطالعات بالینی روی مدل حیوانی و انسانی برای تایید اثر دارو ضروری می‫باشد. بنابراین استفاده از نانوژل‫های حاوی دارو در افزایش بیان برخی ژن‫های پروآپوپتوزیسی می‫تواند موثر باشد. می‫توان براساس این تحقیق و تحقیقات پیشین نتیجه گرفت که داروی اگزالی پلاتین اثرات ضد سرطانی قدرتمندی بر سلول‫های سرطانی دارد و مشتقات این ترکیب در آینده می تواند نقش مهمی در درمان این نوع از سرطان‫ها بازی کنند. بنابراین درصورتی که پروسه بالینی این دارو تایید شود، این دارو می‫توانند در موارد بالینی برای بیماران مبتلا به سرطان کولون به‫کار گرفته شوند. مطالعه حاضر در مدل آزمایشگاهی از سلول‫های رده سرطانی کولون انجام گرفت که اثرات ضد سرطان را نشان داد. پیشنهاد می‫شود برای تایید اثرات ضد سرطان داروی اگزالی پلاتین در بدن موجود زنده، مطالعه تاثیر آن روی مدل حیوانی و انسانی انجام گیرد.

به‫دلیل خواص ضدسرطانی داروی اگزالی پلاتین، مطالعه اثرات ضد سرطانی در سطح پروتئوم از رده سرطانی کولون برای اکتشافات بیشتر پیشنهاد می‫شود. قابلیت طراحی لیگاند‫های اختصاصی در سطح نانوذرات بارگذاری شده با دارو، برای گیرنده‫های خاص با بیان زیاد در سطح سلول‫های سرطانی، توانایی هدف‫گیری نانوذرات را در رسیدن به‫محل تومور افزایش می‫دهد و امکان آزادسازی دارو در ناحیه سرطانی مورد نظر را بالا خواهد برد. بنابراین تغییرات سطحی نانوذرات قابلیت هدف‫گیری اختصاصی و دقیق تر آن‫ها را میسر می­سازد. لذا اعمال این تغییرات بر سطح نانوذره و بررسی میزان اثر بخشی آن‫ها در سیستم‫های انتقال دارو، قابلیت تحقیق و پیگیری دارند.

 

نتیجه‫گیری

با توجه به نتایج این مطالعه که سمیت سلولی و القا فرایند آپوپتوزیس در رده سلولی سرطان کولون توسط داروی اگزالی پلاتین نشان داده شد، می‫توان نتیجه گیری کرد که داروی اگزالی پلاتین گزینه مناسب جهت درمان سرطان کولون می‫باشد.

 

تشکر و قدردانی

بدین‌وسیله از تلاش همکاران دانشگاه آزاد اسلامی و جناب آقای آرین رحیمی و تمام کسانی‌که در انجام این پروژه همکاری کرده‌اند، تشکر و قدرانی می‌نماییم.

 

منابع

  1. Fass L. Imaging and cancer: a review. Mol Oncol. 2008; 2(2): 115-52. 
  2. Carini FMazzola MRappa FJurjus A. Colorectal Carcinogenesis: Role of Oxidative Stress and Antioxidants. Anticancer Res. 2017; 37(9): 4759-4766.
  3. Dahan L, Sadok A, Formento JL, Seitz JF, Kovacic H. Modulation of cellular redox state underlies antagonism between oxaliplatin and cetuximab in human colorectal cancer cell lines. Br J Pharmacol. 2009; 158(2): 610–620.

4.Valdivieso MKujawa AMJones TBaker LH. Cancer survivors in the United States: a review of the literature and a call to action. Int J Med Sci. 2012; 9(2): 163-73.

5. Urruticoechea AAlemany RBalart JVillanueva AViñals FCapellá G. Recent advances in cancer therapy: an overview. Curr Pharm Des. 2010; 16(1): 3-10.

6.Shannon AM1, Williams KJ. Antiangiogenics and radiotherapy. J Pharm Pharmacol. 2008; 60(8): 1029-36.

7. Alcindor TBeauger N. Oxaliplatin: a review in the era of molecularly targeted therapy. Curr Oncol. 2011; 18(1): 18-25.

8. Raez LEKobina SSantos ES.  Oxaliplatin in first-line therapy for advanced non-small-

 

cell lung cancer. Clin Lung Cancer. 2010; 11(1): 18-24. 

9. Stordal BPavlakis NDavey R. Oxaliplatin for the treatment of cisplatin-resistant cancer: a systematic review. Cancer Treat Rev. 2007; 33(4): 347-57. 

10. Elmore S. Apoptosis: a review of programmed cell death. Toxicol Pathol. 2007; 35(4): 495-516.

11. Saraste APulkki K. Morphologic and biochemical hallmarks of apoptosis. Cardiovasc Res. 2000; 45(3): 528-37.

12. Pistritto GTrisciuoglio DCeci CGarufi AD'Orazi G. Apoptosis as anticancer mechanism: function and dysfunction of its modulators and targeted therapeutic strategies. Aging (Albany NY). 2016; 8(4): 603-19.

13. Hopkins BDGoncalves MDCantley LC. Obesity and Cancer Mechanisms: Cancer Metabolism. J Clin Oncol. 2016: 10; 34(35): 4277-4283.

14. De Rosa MPace URega DCostabile VDuraturo FIzzo PDelrio P. Genetics, diagnosis and management of colorectal cancer (Review). Oncol Rep. 2015; 34(3): 1087-96. 

15. Nussbaumer SBonnabry PVeuthey JLFleury-Souverain S. Analysis of anticancer drugs: a review. Talanta. 2011: 15; 85(5): 2265-89.

16. Ali IHaque AWani WASaleem KAl Za'abi M.  Analyses of anticancer drugs by capillary electrophoresis: a review. Biomed Chromatogr. 2013; 27(10): 1296-311.

17. Kratz FMüller IARyppa CWarnecke A. Prodrug strategies in anticancer chemotherapy. Chem Med Chem. 2008; 3(1): 20-53.

18. Leah M. Cook, Douglas R. Hurst, Danny R. Welch. Metastasis Suppressors and the Tumor Microenvironment. Semin Cancer Biol. 2011; 21(2): 113–122. 

19. Toni Celià-Terrassa, Yibin Kang. Distinctive properties of metastasis-initiating cells. Genes Dev. 2016: 15; 30(8): 892–908.

20. Darren F, Peter T, Mitchell V, Nicholas DP. Cosford KV. Inducing death in tumor cells: roles of the inhibitor of apoptosis proteins.  F1000Res. 2017; 6: 587.

21. Carl D. Bortner, John A. Cidlowski. Ion channels and apoptosis in cancer. Philos Trans R Soc Lond B Biol Sci. 2014; 19; 369(1638).

22. Zhenyi S, Zuozhang Y, Yongqing X, Yongbin C, Qiang Y. Apoptosis, autophagy, necroptosis, and cancer metastasis. Mol Cancer. 2015; 14(1): 14: 48.

23. Li-Xia Feng, Min Li, Yong-Jun Liu, Shao-Mei Yang, Na Zhang. Synergistic enhancement of cancertherapy usinga combination of ceramide and docetaxel. Int J Mol Sci. 2014; 15(3): 4201–4220. 

24. Zhang N. Ceramide: Therapeutic potential in combination therapy for cancer treatment. Curr Drug Metab. 2015; 17(1): 37-51.

25. Shisheng T, Xingchen P, Wen P, Yinglan Z, Yuquan W. Enhancement of oxaliplatin-induced cell apoptosis and tumor suppression by 3-methyladenine in colon cancer. Oncol Lett. 2015; 9(5): 2056–2062.

26. Teixeira SFde Azevedo RASilva ACBraga RC. Evaluation of cytotoxic effect of the combination of a pyridinyl carboxamide derivative and oxaliplatin on NCI-H1299 human non-small cell lung carcinoma cells. Biomed Pharmacother. 2016; 84: 1019-1028.

27. Zeng CYu FYang YCheng X, Preparation and evaluation of oxaliplatin thermosensitive liposomes with rapid release and high stability. PLoS One. 2016 14; 11(7): e0158517.

28. MacKenzie SHClark AC. Targeting cell death in tumors by activating caspases. Curr Cancer Drug Targets. 2008; 8(2): 98-109.

29. Leah M. Cook, Douglas R. Hurst, Danny R. Welch. Metastasis suppressors and the tumor microenvironment. Semin Cancer Biol. 2011; 21(2): 113–122.

  1. Fass L. Imaging and cancer: a review. Mol Oncol. 2008; 2(2): 115-52. 
  2. Carini FMazzola MRappa FJurjus A. Colorectal Carcinogenesis: Role of Oxidative Stress and Antioxidants. Anticancer Res. 2017; 37(9): 4759-4766.
  3. Dahan L, Sadok A, Formento JL, Seitz JF, Kovacic H. Modulation of cellular redox state underlies antagonism between oxaliplatin and cetuximab in human colorectal cancer cell lines. Br J Pharmacol. 2009; 158(2): 610–620.

4.Valdivieso MKujawa AMJones TBaker LH. Cancer survivors in the United States: a review of the literature and a call to action. Int J Med Sci. 2012; 9(2): 163-73.

5. Urruticoechea AAlemany RBalart JVillanueva AViñals FCapellá G. Recent advances in cancer therapy: an overview. Curr Pharm Des. 2010; 16(1): 3-10.

6.Shannon AM1, Williams KJ. Antiangiogenics and radiotherapy. J Pharm Pharmacol. 2008; 60(8): 1029-36.

7. Alcindor TBeauger N. Oxaliplatin: a review in the era of molecularly targeted therapy. Curr Oncol. 2011; 18(1): 18-25.

8. Raez LEKobina SSantos ES.  Oxaliplatin in first-line therapy for advanced non-small-

 

cell lung cancer. Clin Lung Cancer. 2010; 11(1): 18-24. 

9. Stordal BPavlakis NDavey R. Oxaliplatin for the treatment of cisplatin-resistant cancer: a systematic review. Cancer Treat Rev. 2007; 33(4): 347-57. 

10. Elmore S. Apoptosis: a review of programmed cell death. Toxicol Pathol. 2007; 35(4): 495-516.

11. Saraste APulkki K. Morphologic and biochemical hallmarks of apoptosis. Cardiovasc Res. 2000; 45(3): 528-37.

12. Pistritto GTrisciuoglio DCeci CGarufi AD'Orazi G. Apoptosis as anticancer mechanism: function and dysfunction of its modulators and targeted therapeutic strategies. Aging (Albany NY). 2016; 8(4): 603-19.

13. Hopkins BDGoncalves MDCantley LC. Obesity and Cancer Mechanisms: Cancer Metabolism. J Clin Oncol. 2016: 10; 34(35): 4277-4283.

14. De Rosa MPace URega DCostabile VDuraturo FIzzo PDelrio P. Genetics, diagnosis and management of colorectal cancer (Review). Oncol Rep. 2015; 34(3): 1087-96. 

15. Nussbaumer SBonnabry PVeuthey JLFleury-Souverain S. Analysis of anticancer drugs: a review. Talanta. 2011: 15; 85(5): 2265-89.

16. Ali IHaque AWani WASaleem KAl Za'abi M.  Analyses of anticancer drugs by capillary electrophoresis: a review. Biomed Chromatogr. 2013; 27(10): 1296-311.

17. Kratz FMüller IARyppa CWarnecke A. Prodrug strategies in anticancer chemotherapy. Chem Med Chem. 2008; 3(1): 20-53.

18. Leah M. Cook, Douglas R. Hurst, Danny R. Welch. Metastasis Suppressors and the Tumor Microenvironment. Semin Cancer Biol. 2011; 21(2): 113–122. 

19. Toni Celià-Terrassa, Yibin Kang. Distinctive properties of metastasis-initiating cells. Genes Dev. 2016: 15; 30(8): 892–908.

20. Darren F, Peter T, Mitchell V, Nicholas DP. Cosford KV. Inducing death in tumor cells: roles of the inhibitor of apoptosis proteins.  F1000Res. 2017; 6: 587.

21. Carl D. Bortner, John A. Cidlowski. Ion channels and apoptosis in cancer. Philos Trans R Soc Lond B Biol Sci. 2014; 19; 369(1638).

22. Zhenyi S, Zuozhang Y, Yongqing X, Yongbin C, Qiang Y. Apoptosis, autophagy, necroptosis, and cancer metastasis. Mol Cancer. 2015; 14(1): 14: 48.

23. Li-Xia Feng, Min Li, Yong-Jun Liu, Shao-Mei Yang, Na Zhang. Synergistic enhancement of cancertherapy usinga combination of ceramide and docetaxel. Int J Mol Sci. 2014; 15(3): 4201–4220. 

24. Zhang N. Ceramide: Therapeutic potential in combination therapy for cancer treatment. Curr Drug Metab. 2015; 17(1): 37-51.

25. Shisheng T, Xingchen P, Wen P, Yinglan Z, Yuquan W. Enhancement of oxaliplatin-induced cell apoptosis and tumor suppression by 3-methyladenine in colon cancer. Oncol Lett. 2015; 9(5): 2056–2062.

26. Teixeira SFde Azevedo RASilva ACBraga RC. Evaluation of cytotoxic effect of the combination of a pyridinyl carboxamide derivative and oxaliplatin on NCI-H1299 human non-small cell lung carcinoma cells. Biomed Pharmacother. 2016; 84: 1019-1028.

27. Zeng CYu FYang YCheng X, Preparation and evaluation of oxaliplatin thermosensitive liposomes with rapid release and high stability. PLoS One. 2016 14; 11(7): e0158517.

28. MacKenzie SHClark AC. Targeting cell death in tumors by activating caspases. Curr Cancer Drug Targets. 2008; 8(2): 98-109.

29. Leah M. Cook, Douglas R. Hurst, Danny R. Welch. Metastasis suppressors and the tumor microenvironment. Semin Cancer Biol. 2011; 21(2): 113–122.