بیان آنزیم فعال بتا-گلوکورونیداز در بذر گیاه توتون

نوع مقاله: علمی - پژوهشی

نویسندگان

- دانشگاه زنجان، دانشکده کشاورزی، گروه زراعت و اصلاح نباتات، زنجان، ایران

چکیده

هدف: طراحی و تهیه سازه ژنی مناسب و انتقال آن به گیاه توتون و بررسی گیاهان تراریخت حاصله بوده است.
مواد و روش‌ها: سازه اختصاصی بذر حاوی پیشبرنده Napin، توالی Ω ، ژن GUS و توالی SAR در پلاسمید pBI121 طراحی و تهیه و در باکتری E. coli تکثیر شد. ریزنمونه‌های برگی توتون با آگروباکتریوم سویه LBA4404 به‫روش استاندارد تلقیح شدند. گزینش جوانه‌های باززایی شده در محیط انتخابی (شامل MS، mg/l  1/0 NAA،  mg/l3 BAP ،mg/L 25 کانامایسین، mg/L 200 سفوتاکسیم) انجام شد. آنالیز گیاهان تراریخت با PCR، RT-PCR و آزمون هیستوشیمیایی انجام شد.
نتایج: بررسی مولکولی گیاهان باززایی شده با PCR و آغازگرهای اختصاصی ژن‌های nptII و GUS نشان‌دهنده انتقال این ژن‌ها به گیاه‫چه‌های باززایی شده بود. نتایج RT-PCR نشان داد که نسخه‌برداری از ژن nptII در هر دو بافت برگ و بذر صورت می‌گیرد در حالیکه نسخه‌برداری از ژن GUS تنها در بذر صورت می‌گیرد. با توجه به اینکه پیشبرنده NOS (کنترل‌کننده ژن nptII) عمومی و Napin (کنترل‌کننده ژن GUS) یک پیشبرنده اختصاصی بذر می‌باشد، این نتیجه مورد انتظار بود. در نهایت با استفاده از SDS-PAGE و آزمون هیستوشیمیایی، تولید و فعالیت آنزیم بتا-گلوکورونیداز در بذر گیاهان تراریخت تائید شد.
نتیجه‌گیری: نتایج مناسب بودن سازه ژنی طراحی شده را نشان داد، چرا که پیشبرنده Napin به خوبی موجب بیان اختصاصی ژن GUS در بذر شده و توالی امگا نیز در افزایش بیان تراژن موثر بوده است. در ادامه کار می‌توان این سازه را با جایگزینی ژن‌های ارزشمند با ژن  GUSبرای تولید پروتئینهای نوترکیب استفاده نمود.

تازه های تحقیق

-

کلیدواژه‌ها


-

مقدمه

تولید پروتئین‫های نوترکیب در بذرهای تراریخته یک جایگزین جذاب و از لحاظ اقتصادی به صرفه برای سیستم‌های سنتی است که بر پایه سلول‌های باکتریایی و جانوری می‌باشد. تجمع پایدار پروتئین نوترکیب در یک غلظت نسبتا بالا در یک بیوماس فشرده برای استخراج و فرآیندهای بعدی بسیار مفید است (1). موفقیت در تولید پروتئین‌های نوترکیب درون بذر به‫وسیله‌ی فاکتورهای متعددی از جمله استفاده از پیشبرنده مناسب اختصاصی بذر، افزایش بیان ژن، پایداری بیان ژن و ... تعیین می‌شود. از طرف دیگر بیان موفقیت‌آمیز تراژن در گیاه، نیازمند آماده کردن سازه ژنی مناسب قبل از انتقال به گیاه است. در این تحقیق سازه ژنی حاوی پیشبرنده Napin‫، توالی Ω (امگا) در بالادست ژن GUS، ژن GUS و توالی SAR ( Scaffold attachment region) در پایین‌دست ژن GUS طراحی و تهیه شد. پیشبرنده قوی و اختصاصی  بذر Napinاز گیاه کلزا جداسازی شده و موجب بیان ژن تحت کنترل خود در بذر می‌شود. با توجه به اینکه بیان نهائی پروتئین نوترکیب تحت تاثیر دو مرحله­ی اساسی رونویسی و ترجمه قرار می گیرد، بنابراین استفاده از عناصری که اثر افزایندگی آن­ها در مرحله­ی ترجمه نمود می­یابد، راه‫کاری است که می­تواند برای بهبود بیان پروتئین نوترکیب مد­نظر قرار گیرد. توالی Ω از RNA ویروس موزائیک توتون به‫دست آمده که به‫‌طور اختصاصی به‫عنوان یک تنظیم‌کننده ترجمه عمل می‌کند و میزان ترجمه را هم در پروکاریوت‫ها و هم در یوکاریوت‫ها افزایش می‌دهد. (2). یکی از مشکلاتی که در زمینه‌ی انتقال ژن وجود دارد، ناپایداری تراژن درنسل‫های متوالی است که به‫طور کلی به آن خاموشی ژن اطلاق می‫شود. توالی دیگری که در طراحی سازه ژنی مورد نظر، استفاده شد، به اختصار SAR گفته می‌شود و حداقل از دو طریق نقش خود را در جلوگیری از خاموشی ژن‫ها در مرحله نسخه‌برداری ایفا می‫کنند: 1- از آنجا که تراژن‌های چند نسخه‌ای ممکن است انواع متفاوتی از برهمکنش‌های جفت‌شدگی را متحمل شوند که می‌تواند منجر به خاموشی ژن شود، عناصر SAR با اتصال به ماتریکس هسته از جفت‌شدگی بین نسخه‌های تراژن ممانعت به‫عمل می‌آورند (3) . 2- زمانی که چندین نسخه از تراژن به حالت سیس در یک لوکوس وارد می‌شود SAR‌ها به‫عنوان خاتمه‌دهنده رونویسی عمل کرده و از توسعه رونویسی از یک تراژن به تراژن دیگر جلوگیری کرده و پتانسیل رونوشت‌های تکراری معکوس را کاهش می‌دهند (4). نواک و همکاران (5) یک SAR سنتزی را در مجاورت ژن GUS تحت پیشبرنده 35S به کار بردند و گیاهان توتون را توسط اگروباکتریوم تراریخت کردند که اثرش بر سطح بیان 8/3 تا 3/2 برابر بود. در مطالعه­ای که توسط ورما و همکاران (6) انجام شد، برگ­های برنج با استفاده از تفنگ ژنی تحت تراریختی با 35S-GUS در مجاورت RB7 (نوعی توالی SAR) قرار گرفتند و 77 برابر افزایش در بیان ژن خارجی گزارش شد.  در این تحقیق فرض بر این بوده که سازه ژنی تهیه شده ضمن بیان ژن GUS در بذر گیاه، موجب افزایش بیان و نیز پایداری آن خواهد شد برای بررسی این موضوع سازه مدنظر به توتون منتقل شد که یک گیاه رایج در بیان پروتئین‫های نوترکیب می‌باشد.

 

مواد و روش‌ها

سویه‌های باکتری و پلاسمید‌های مورد استفاده: در این تحقیق از باکتری E. coli سویه´TOP10F (مقاوم به تتراسایکلین)، اگروباکتریوم سویه LBA4404، پلاسمید دوگانه pBI121 حاوی پیشبرنده Napin و ژن nptII به‫عنوان نشانگر انتخابی، ناقل همسانه‌سازی pTZ57R/T حاوی ژن lacz و ژن مقاومت به آمپی‌سیلین (شرکت Fermentase) استفاده شد.

 طراحی آغازگر‌ها: از آغازگرهای اختصاصی شماره 1 و2 برای تکثیر ژن GUS به همراه قطعه‌ی امگا و آغازگرهای 3 و 4 برای جداسازی قطعه SAR از ژنوم توتون (جدول 1) استفاده شد. قابل ذکر است که آغازگرهای قطعه SAR با استفاده از توالی pS206-1 با شماره دسترسیAF065883.1  طراحی شد. آغازگر شماره 1 از سمت '5 شامل جایگاه آنزیم برشی XbaI، توالی امگا، کد آغاز ترجمه و 13 نوکلئوتید ابتدایی ژن GUS است. آغازگر شماره 2 از سمت '5 شامل 20 نوکلئوتید ابتدایی SAR، کد پایان ترجمه و 18 نوکلئوتید انتهایی GUS می‌باشد. آغازگر شماره 3 از سمت '5 شامل 18 نوکلئوتید انتهاییGUS، کد پایان و 20 نوکلئوتید ابتدایی SAR است. آغازگر شماره 4 از سمت '5 شامل جایگاه آنزیم برشی SacI و انتهای توالیSAR می‌باشد.

 

 

 

جدول1: آغازگرهای طراحی‌شده برای جداسازی و تکثیر قطعات  Ω-GUSو SAR

1) F:5'ATTCTAGAGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAACAACAAACAACAA

ATGTTACGTCCTGTAG-3'

2) R: 5' CTATAATAATAGCTGGATCTTTACTGTTTACCTCCCTGCTG-3'

3) F: 5'CAGCAGGGAGGTAAACAGTAAAGATCCAGCTATTATTATAG-3'

4) R: 5'  TGAGCTCGAGCTTCTATTGCTTGCTTAATAAAACTACTAATTATAAG-3'

 

 

 

تکثیر قطعه‌ی -GUSΩ و جداسازی SAR: به‫منظور قرار دادن قطعه‌ی امگا در ابتدای ژن GUS، در هنگام طراحی آغازگرها توالی این افزاینده (55 نوکلئوتید) در ابتدای آغازگر مستقیم (شماره 1) قرار گرفت و واکنش PCR با استفاده از آغازگرهای شماره‌ی 1 و 2 انجام شد. مواد واکنش PCR مطابق با غلظت‫های استاندارد و برنامه واکنش نیز برنامه استاندارد برای 25 سیکل واکنش، دمای اتصال آغازگرها 58 درجه سانتی‫گراد و زمان یک دقیقه در نظر گرفته شد. از پلاسمید pBI121 حاوی ژن   GUS به‫عنوان الگو در واکنش PCR استفاده شد.

از برگ گیاه‫چه‌های توتون (در مرحله‌ی 3 تا 4 برگی) استخراج DNA ژنومی به روش دلاپورتا (7)  انجام شد. سپس قطعه‌ی SAR با استفاده از آغازگرهای شماره 3 و 4، از ژنوم توتون جداسازی و تکثیر شد. مواد واکنش PCR به استثناء MgCl2 (mM75/2) مطابق با PCR

 

استاندارد و دمای اتصال آغازگرها در این واکنش، 7/55 درجه ساتی‫گراد می‌باشد. به‫منظور استفاده از محصولات PCR در مراحل بعدی، خالص‌سازی آن‫ها از روی ژل

 

آگارز 1 درصد با استفاده از کیت استخراج از ژل (شرکت Qiagene) و مطابق با دستورالعمل کیت انجام شد.

اتصال قطعات Ω-GUS و SAR با استفاده از SOEingPCR: برای انجام واکنش SOEingPCR، ابتدا مقادیر مناسبی از محصولات خالص‌سازی شده‌ی دو قطعه Ω-GUS و SAR حاصل از PCR اول و دوم ‌به ‌صورت مخلوط، تحت تیمار با آنزیم Taq polymerase (بدون استفاده از آغازگرها) به تعداد 5 چرخه قرار گرفتند؛ سپس با افزودن آغازگرهای شماره 1 و 4، قطعه‌ی نهایی (Ω-GUS-SAR) تکثیر شد. مراحل و شرایط انجام این واکنش در جدول 2 آورده شده است.

 

 

 

 

 

جدول2: شرایط چرخه دمایی-زمانی SOEing PCR

 

 

مرحله2

 

مرحله1

 

زمان

دما

نام مرحله

تعداد چرخه‌ها

زمان

دما

نام مرحله

تعداد چرخه‌ها

2 ´

95 0C

Initial denaturation

1x

2 ´

95 0C

Initial denaturation

1x

1 ´

95 0C

Denaturation

 

1 ´

95 0C

Denaturation

 

1 ´

57 0C

Annealing (overlapping parts)

25 x

1 ´

58 0C

Annealing (overlapping parts)

5x

1´:30´´

72 0C

Extension (overlapping parts)

 

1 ´

72 0C

Extension (overlapping parts)

 

72 0C

Final Extension

 

72 0C

Extension (overlapping parts)

 

 

 

 

 

Pause

 

Add primers

 

 

تهیه قطعه -GUS-SARΩ در ناقل‌های همسانه‌سازی و بیانی بعد از تهیه قطعه‌ی نهایی (-GUS-SARΩ) برای تعیین توالی و نیز تسهیل کلونینگ آن در ناقل pBI121، ابتدا این قطعه مطابق با پروتوکل کیت در ناقلpTZ57R/T  کلون و انتخاب اولیه کلونی‌های سفید در محیط حاوی X-Gal و IPTG صورت گرفت شد. ناقل pTZ57R/T حاوی قطعه‌ی موردنظر، جهت توالی‌یابی به شرکت Macrogen کشور کره ارسال شد. برای انتقال قطعه‌ی -GUS-SARΩ به ناقل بیانی pBI121 ابتدا هر دو ناقلpTZ57R/T (حاوی قطعه موردنظر) و pBI121 با آنزیم‌های SacI و XbaI برش داده شد و پس از خالص‌سازی قطعه‌ی Ω-GUS-SAR و پلاسمید pBI121 فاقد GUS اولیه از ژل آگاروز 1 درصد، با توجه به غلظت باندهای مشاهده‌شده، واکنش اتصال بین آن‫ها انجام گرفت و پلاسمید نوترکیب pBI121-N-Ω-GUS-SAR به سلول‌های مستعد باکتری  E.coli سویه ′TOP10F انتقال داده شد. به‫منظور اطمینان از کلون‌شدن قطعه‌ی موردنظر، PCR بر روی کلونی‫های رشد کرده در محیط کشت حاوی تتراسایکلین و کانامایسین انجام شد و جهت اطمینان از صحت طول

قطعه‌ی کلون‌شده، هضم آنزیمی توسط آنزیم‫های برشی XbaI و SacI انجام شد. در ادامه پلاسمید pBI121-N-Ω-GUS-SAR  با روش انجماد و ذوب به اگروباکتریوم

 

 

سویه LBA4404 انتقال داده شد (8).

انتقال سازه ژنی به ریزنمونه‌های برگی توتون و باززایی گیاهان تراریخت ضدعفونی بذرهای توتون رقم Xanthi با استفاده از هیپوکلریت سدیم 5 درصد به‫مدت 10 دقیقه و 5 بار شستشو با آب مقطر استریل هر بار به‫مدت 10 دقیقه انجام شد. ﺑﺮای ﺟﻮاﻧﻪ زﻧﻲ ﺑﺬور از ﻣﺤﻴﻂ MS در دﻣﺎی 26 درجه سانتی‫گراد ﺑﺎ دوره ﻧﻮری 16 ﺳﺎﻋﺖ روﺷﻨﺎﻳﻲ و 8 ﺳﺎﻋﺖ ﺗﺎرﻳﻜﻲ اﺳﺘﻔﺎده ﺷﺪ. بعد از تقریبا ۲ هفته،  گیاهان رشد کرده و جوان‫ترین برگ‫ها با طول تقریبا ۴ سانتی‌متر برای تراریخت نمودن انتخاب (که هرکدام از آن‌ها به ۸ تا ۱۰ قطعه تقسیم شدند) و جهت تلقیح آماده شدند. ﻳﻚ روز ﻗﺒﻞ از اﻧﺠﺎم آﻟﻮدﮔﻲ، ﺗﻚ ﻛﻠﻨﻲﻫﺎی اﮔﺮوﺑﺎﻛﺘﺮﻳﻮم ﺣﺎوی ﺳﺎزه ﻣﻮرد‌ﻧﻈﺮ در ﻣﺤﻴﻂ    (g/ml + LBµ 50) ﻛﺎﻧﺎﻣﺎﻳﺴﻴﻦ در دﻣﺎی 28 درجه سانتی‫گراد و ﺗﺎرﻳﻜﻲ ﻛﺸﺖ داده ﺷﺪ، وﻗﺘﻲ ﻛﻪ OD ﺑﺎﻛﺘﺮی رﺷﺪ ﻛﺮده ﺑﻪ 5/0 تا 1 رﺳﻴﺪ، در دﻣﺎی 4 درجه سانتی‫گراد و دور ×g 3500 ﺑﻪ‫ﻣﺪت 5 تا 8 دﻗﻴﻘﻪﺳﺎﻧﺘﺮﻳﻔﻮژ ﺷﺪ. ﭘﺲ از ﺧﺎرج ﻧﻤﻮدن ﻣﺤﻴﻂ ﻛﺸﺖ ﺑﺎﻛﺘﺮی (LB)، ﻣﺤﻴﻂ ﺗﻠﻘﻴﺢ (MS مایع و هورمون‌های BAP با غلظت  mg/l3 و NAA به مقدار   mg/l1/0، ﺑﻪ سلول‫های ﺑﺎﻛﺘﺮی اﺿﺎﻓﻪ و ﺳﻠﻮل‌ﻫﺎﻛﺎﻣﻼ در آن ﺣﻞ ﺷﺪﻧﺪ. ﺑﻌﺪ ازآﻣﺎده ﻛﺮدن ﺳﻮﺳﭙﺎﻧﺴﻴﻮن ﺑﺎﻛﺘﺮی، رﻳﺰﻧﻤﻮﻧﻪ‌ﻫﺎ ﺑﻪ‫ﻣﺪت 20 تا 30 ﺛﺎﻧﻴﻪ در ﺗﻤﺎس ﺑﺎ ﺳﻮﺳﭙﺎﻧﺴﻴﻮن اﮔﺮوﺑﺎﻛﺘﺮﻳﻮم ﻗﺮار ﮔﺮﻓﺘﻪ و در ﻣﺤﻴﻂ ﻫﻢ‫ﻛﺸﺘﻲ (MS کامل و هورمون‌های BAP با غلظت  mg/l3 و NAA به‫مقدارmg/l 1/0) ﺑﻪ‫ﻣﺪت 48 اﻟﻲ 72 ﺳﺎﻋﺖ در دﻣﺎی 26 درجه سانتی‫گراد در ﺗﺎرﻳﻜﻲ ﻗﺮار داده ﺷﺪﻧﺪ. در ﻣﺮﺣﻠﻪ ﺑﻌﺪی اﻳﻦ رﻳﺰﻧﻤﻮﻧﻪ‌ﻫﺎ در ﻣﺤﻴﻂ ﻛﺸﺖ اﻧﺘﺨﺎﺑﻲ (شامل محیط هم‌کشتی و آنتی‌بیوتیک‌های کانامایسین با غلظت  µg/ml100-25 و سفوتاکسیم با غلظت  µg/ml200) در دﻣﺎ و دوره ﻧﻮری ﻣﺸﺎﺑﻪ ﻣﺮﺣﻠﻪ ﻗﺒﻞ ﺑﻪ ﻣﺪت 4 ﻫﻔﺘﻪ ﻧﮕﻬﺪاری ﺷﺪﻧﺪ. واﻛﺸﺖ ﻧﻤﻮﻧﻪ‫ﻫﺎ ﺑﻪ‫ﻓﺎﺻﻠﻪ ﻫﺮ 15 روز ﻳﻚﺑﺎر اﻧﺠﺎم ﺷﺪ. ﺑﺮای ﻃﻮﻳﻞ ﺷﺪن نوﺳﺎﻗﻪ‌ها از ﻣﺤﻴﻂ طویل شدن ساقه (MS کامل به‌همراه  µg/ml100 آنتی‌بیوتیک کانامایسین) و ﺑﺮای رﻳﺸﻪ‌زایی گیاهچه‌ها از ﻣﺤﻴﻂ ریشه زایی (MS کامل به‌همراه  µg/ml1/0 هورمون NAA) اﺳﺘﻔﺎده ﺷﺪ. ﮔﻴﺎﻫﺎن رﻳﺸﻪ دار ﺷﺪه اﺑﺘﺪا ﺑﻪ ﮔﻠﺪان‫ﻫﺎی ﺣﺎوی ﭘﺮﻟﻴﺖ (در دﻣﺎ و ﻧﻮر ﻣﺸﺎﺑﻪ ﻣﺮﺣﻠﻪ ﻗﺒﻞ) ﺳﭙﺲ ﺑﻪ ﺧﺎک ﻣﻨﺘﻘﻞ ﺷﺪه و تا زمان جمع‌آوری بذور در ﺷﺮاﻳﻂ ﮔﻠﺨﺎﻧﻪ نگه‫داری ﺷﺪﻧﺪ (9).

بررسی مولکولی گیاهان تراریخت: بررسی در ﺳﻄﺢ :DNA از ﺑﺮگ‌ﻫﺎی ﺟﻮان ﮔﻴﺎهچه‌های رشد‌ کرده در محیط انتخابی و گیاهان ﺷﺎﻫﺪ (ﮔﻴﺎه ﻏﻴﺮﺗﺮارﻳﺨﺖ)، DNA ژﻧﻮﻣﻲ به‫روش دلاپورتا اﺳﺘﺨﺮاج ﺷﺪ. ﺳﭙﺲ ﺑﺎ اﺳﺘﻔﺎده از آﻏﺎزﮔﺮﻫﺎی اﺧﺘﺼﺎﺻﻲ ژن nptII F: 5'ATGATTGAACAAGATGGATTGCACGCAG -3')  و R: 5'-TCAGAAGAACTCGTCAAGAAGGCGATAG-3') و آغازگرهای ژن GUS (F: 5'-GTAATTATGCGGGCAACGTCTGGTATC -3' و R: 5'-(TCAGAAGAACTCGTCAAGAAGGCGATAG-3' واکنش PCR انجام شد.

بررسی در ﺳﻄﺢ RNA: ﺑﺮای ﺑﺮرﺳﻲ ﺑﻴﺎن ژن در ﺳﻄﺢ RNA از روش RT-PCR اﺳﺘﻔﺎده ﺷﺪ. استخراج RNA از بافتهای بذری و برگی با استفاده از محلول استخراج RNA (RNX-Plus - 25ml RN7713C) تهیه شده از شرکت سیناژن انجام شد. ساخت cDNA از روی RNAی استخراج شده، به‫وسیله کیت دومرحله‌ای RT-PCR (vivantis,RTPL12) انجام گرفت. برای استخراج RNA از بذر، برداشت بذور نارس از گیاهان PCR مثبت، 20 روز پس از گل‫دهی انجام شد. قابل ذکر است که زمان مناسب برای فعالیت پیشبرنده Napin، حدود 20 روز پس از گل‫دهی است (10) به‫همین دلیل این زمان برای نمونه‌برداری انتخاب شده است. همچنین برگ‌های مناسب نیز از گیاهان PCR مثبت انتخاب شدند. برای انجام واکنش RT-PCR از آغازگرهای مرحله قبل استفاده شد.

ﺑﺮرﺳﻲ ﻣﻮﻟﻜﻮﻟﻲ ﮔﻴﺎﻫﺎن ﺗﺮارﻳﺨﺘﻪ در ﺳﻄﺢ پروتئین: آزمون هیستوشیمیایی جهت تایید بیان ژن GUS، بر روی برگ و بذور گیاهان شاهد و تراریخت توتون، با روش جفرسون و همکاران (11) صورت گرفت. سوبسترای مورد استفاده برای این آنزیم X-gluc (شرکت (Fermentas بود. برای از بین بردن رنگ کلروفیل برگ‫ها از اتانول استفاده شد. در مورد نمونه‫های بذری، ابتدا بذور با استفاده از ازت مایع خرد و سپس آزمون هیستوشیمیایی انجام شد. ﺑﺮای ﺑﺮرﺳﻲ ﺑﻴﺎن ژن در ﺳﻄﺢ پروتئین، ابتدا استخراج پروتئین کل از بذرهای گیاهان تراریخت و شاهد (غیر تراریخت) انجام گرفت و سپس از تکنیک SDS-PAGE به‫روش Laemmli (12) اﺳﺘﻔﺎده ﺷﺪ.

 

 

نتایج

تهیه قطعات -GUS، SAR و -GUS-SAR و کلونینگ در پلاسمیدها

محصول اولین واکنش PCR، قطعه‌ای به‫طول 1895 جفت باز است که این قطعه شامل قطعه‌ی Ω (bp 63(، ژن GUS ( bp1812) و 20 نوکلئوتید ابتدایی قطعه‌ی SAR می‌باشد (شکل A1). تعبیه‌کردن 20 نوکلئوتید ابتدایی SAR در سمت '5 آغازگر شماره 2 منجر به قرار‌گرفتن این 20 نوکلئوتید در انتهای ژن GUS می‌شود. هدف از این کار ایجاد همپوشانی لازم (به‫طول41

 

نوکلئوتید) بین محصولات PCR اول و دوم بود که در واکنش SOEing PCR از قسمت همپوشان به‫هم وصل شوند. محصول واکنش دوم PCR به‌طول bp334 است، که به‫ترتیب از سمت '5 شامل 21 نوکلئوتید انتهایی ژن GUS و قطعه‌ی SAR به طول bp306 (شکل B1). در زمان طراحی آغازگرها، 21 نوکلئوتید انتهایی ژن GUS در ابتدای آغازگر شماره 3 قرار گرفت تا بدین ترتیب همپوشانی لازم بین محصولات PCR اول و دوم در هنگام SOEingPCR برقرار شود. با توجه به وجود توالیهای همپوشان درانتهای '3

 

قطعه‌ی Ω-GUS و انتهای '5 قطعه SAR، این دو قطعه در دمای اتصال مناسب از ناحیه همپوشان به‫هم وصل شده و هریک به‫عنوان آغازگر برای رشته‌ی دیگر عمل کرده و بدین ترتیب ضمن وصل شدن دو قطعه‌ی مورد نظر، یک قطعه کامل دو رشته‌ای (-GUS-SARΩ(نیز تولید شد. در مرحله‌ی بعدی واکنش و پس از افزودن آغازگرهای 1و4، قطعه‌ی مورد نظر به‫عنوان الگوی این آغازگرها قرار گرفت و بدین ترتیب قطعه نهایی با طول 2188 جفت‌باز، در حجم بالا تکثیر شد (شکل C1).

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 1: تکثیر قطعات Ω-GUS (A) ، SAR (B) و Ω-GUS-SAR (C) با PCR.  A) 2،1 و 3: قطعه Ω-GUS تکثیریافته 4: نشانگر kb1. B) 1: نشانگرbp 100،  3،2 و 4 : قطعات تکثیریافته SAR 5: کنترل منفی (C 1: نشانگر bp 100، 3،2 و 4 : قطعات تکثیریافته 

 

بعد از تهیه -GUS-SARΩ، واکنش اتصال این قطعه با ناقل pTZ57R/T انجام و محصول واکنش اتصال به سلول‫های مستعد باکتری E.coli منتقل شد. کلونی PCR بر روی کلونی‌های سفید انجام شد. کلونی‌هایی که محصول PCR آنها قطعه‌ای به اندازه 2188 جفت‌باز بود (شکلA2)،

 

 

به‫عنوان کلونی‌های حاوی قطعه‌ی موردنظر انتخاب شدند و واکنش هضم آنزیمی با استفاده از آنزیم‌های XbaI و SacI انجام شد. با خروج قطعه‌ای به‫طول 2188 جفت‌باز، صحت انجام کلونینگ مورد تایید نهایی قرار گرفت (شکلB2) و نتیجه‌ی توالی‌یابی، صحت توالی قطعه‌ی موردنظر را تایید کرد.

 

 

 

 

 

 

 

 

 

 

 

شکل 2: محصول کلونی  PCR(A) و هضم آنزیمی (B) با ناقل نوترکیب pTZ57R/T-Ω-GUS-SAR. A) 1: نشانگر kb1  2، 3 و 4 : قطعه تکثیر شده Ω-GUS-SAR با کلونی PCR B) 1 و 2: قطعه bp 2188 حاصل از هضم آنزیمی ناقل نوترکیب pTZ57R/T-Ω-GUS-SAR  3: نشانگر kb1

 

 

 

برای ساب کلونینگ قطعه -GUS-SARΩ در ناقل pBI121، واکنش‫های هضم آنزیمی، اتصال و انتقال به سلول‫های باکتری مجددا انجام شد. کلونی PCR با استفاده از آغازگرهای اختصاصی 1 و 4 بر روی کلونی‌های رشد کرده در محیط تتراسایکلین و کانامایسین، قطعاتی به طول 2188 جفت‌باز تولید شد که تاییدکننده‌ی کلون‌شدن قطعه‌ی مورد نظر در کلونی‌های به‫دست آمده بود. به‫منظور تایید نهایی سازه‌ی مورد نظر، هضم آنزیمی توسط آنزیم‌های برشی XbaI و SacI

 

به‫طور هم‫زمان بر روی ناقل‫های نوترکیب pTZ57R/T-Ω-GUS-SAR  و pBI121-N-Ω-GUS-SAR و ناقل pBI121 اولیه (حاوی ژن GUS بدون توالیهای Ω و SAR) انجام شد. با آزادشدن قطعه‌ی 1812جفت‌باز از ناقل pBI121 اولیه و قطعه‌ی 2188جفت‌باز از ناقل‌های نوترکیبpTZ57R/T-Ω-GUS-SAR  و pBI121-N-Ω-GUS-SAR، سازه‌ی ساخته شده مورد تایید نهایی قرار گرفت (شکل 3).

 

 

 

 

شکل 3: سازه نهایی تهیه شده در ناقل pBI121. از چپ به راست به ترتیب پیشبرنده NOS (پیشبرنده عمومی)، ژن nptII، پیشبرنده Napin (اختصاصی بذر)، توالی

 

 

تراریزش ریزنمونه‌ها و باززایی گیاهان تراریخت

با توجه به نتایج تحقیقات قبلی از سویه LBA4404 اگروباکتریوم و همچنین مدت زمان هم کشتی 48 ساعت و تاریکی برای تلقیح ریزنمونه‫های توتون استفاده شد. حداقل زمان لازم برای فعالیت پروتئین‫های Vir و انتقال  T-DNA به ژنوم سلول‫های گیاهی، ۱۶ ساعت می باشد ، زمان‫های کمتر از ۴۸ ساعت باعث کاهش کارایی تراریختی می‫شود و

 

افزایش زمان، باعث افزایش آلودگی باکتریایی می‫شود که آلودگی زیاد موجب انهدام ریزنمونه‫ها می‫شود. مرحله هم کشتی در دمای 26 درجه سانتی‫گراد و تاریکی انجام شد. دمای کمتر موجب کاهش فعالیت اگروباکتریوم و موجب اختلال در روند انتقال T-DNA می‌شود. دمای بالاتر در حدود ۲۸ تا 30 درجه سانتی‫گراد که دمای بهینه رشد اگروباکتریوم است به‫علت رشد بیش از اندازه اگروباکتریوم

 

موجب مرگ ریز نمونه‫ها می‫شود. حضور نور فعالیت سلول‫ها را درجهت تمایز هدایت می کند و تاریکی موجب افزایش تقسیم سلولی و تشکیل کالوس می‫شود (13) لذا هم‫کشتی در شرایط تاریکی انجام شد.در خصوص مصرف کانامایسین به‫عنوان عامل انتخابگر نوساقه‫ها باید توجه داشت که برای توتون محدوده بین mg/lit 100 -25 مناسب است و افزایش این مقدار حتی ممکن است موجب حذف گیاهان تراریخت نیز شود.گیاهچه‌های سبز و رشد‌یافته در محیط انتخابی به‫منظور طویل‌شدن ساقه و ریشه‌زایی به محیط طویل شدن ساقه و ریشه‌زایی انتقال یافتند. ریزنمونه‌هایی که تراریخت نشدند در محیط انتخابی به رنگ سفید در آمدند همچنین ریز نمونه‌هایی که باززایی نشدند پس از مدتی نکروزه شدند (شکل 4).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل4: گیاهان باززائی شده در مراحل مختلف رشد. A: پیدایش و رشد جوانه‌های اولیه از ریزنمونه‌های برگی : B نکروزه شدن ریز نمونه‫های تراریخت نشده 2 تا 3 هفته بعد از تلقیح  C: انتقال نوساقه به محیط طویل شدن ساقه D: گل‫دهی گیاهان منتقل شده به پرلایت و خاک.

 

 

بررسی مولکولی گیاهان تراریخت

به‫منظور بررسی مولکولی گیاهان، DNA ژنومی گیاهان نسل اول (T0) و شاهد، به‫عنوان الگو و آغازگرهای اختصاصی ژن nptII و ژن GUS در واکنش PCR استفاده شد و قطعه bp 795 مربوط به ژن nptII و قطعه bp 1512 مربوط به ژن GUS در گیاهان تراریخت مشاهده شد در حالی‫که در گیاهان شاهد باندی مشاهده نشد (شکل5). لازم به ذکر است که اندازه ژن GUS برابر bp 1812 می‌باشد ولی چون دو

 

 

 

 

آغازگر فوق در داخل ژن طراحی شده بود اندازه قطعه تکثیر شده کوچک‫تر و برابر bp 1512 می‌باشد. گیاهانی که نتیجه PCR آن‌ها مثبت بود برای استخراج RNA از برگ و بذر انتخاب شدند. نتایج RT-PCR نشان داد که بیان ژن nptII به‫علت وجود پیشبرنده عمومی Nos در بذر و برگ صورت می‌گیرد (شکل 6)، ولی بیان ژن GUS به‫علت وجود پیشبرنده اختصاصی بذری Napin تنها در بذر گیاهان تراریخت مشاهده شد و در برگ گیاهان تراریخت مشاهده نشد (شکل7).

 

 

 

 

 

 

 

شکل5: بررسی حضور ژن GUS (A) و nptII (B) در گیاهان باززائی شده با PCR . W: گیاه شاهد T3, T2,T1 : قطعات تکثیر شده (گیاهان تراریخت متفاوت) L: نشانگر kb1.

 

 

 

 

 

 

 

شکل 6: تایید سنتز mRNA ژن  nptIIبا واکنش  RT-PCRدر برگ (A) و در بذر (B) گیاهان توتون تراریخت. –C: کنترل منفی  W: گیاهان شاهد T1 ، T2 و T3 : ژن تکثیر شده nptII (گیاهان تراریخت متفاوت).

 

 

 

 

 

        

 

شکل 7: بررسی نسخه برداری از ژن GUS در بذر (A) و در برگ (B) گیاهان باززائی شده با RT-PCR.  T1 و T2: cDNA گیاهان باززایی شده –C: کنترل منفی C+: کنترل مثبت W: گیاهان شاهد.

 

بررسیگیاهانتراریختدرسطح پروتئین

نمونه پروتئین‌های استخراج‌شده از بذر گیاهان تراریخت و گیاه شاهد، تعیین غلظت و از نظر غلظت همتراز شده و برای آنالیز پروتئین مورد استفاده قرار گرفت. نتیجه SDS-PAGE با پروتئین‌های استخراج شده از گیاهان تراریخت وجود یک قطعه اضافی مشخص با وزن kDa 60  در مقایسه با گیاهان شاهد را نشان داد. آزمون هیستوشیمیایی GUS مربوط به بذر، بر روی نمونه‌های بذری شاهد و تراریخت صورت گرفت و بعد از

 

 

24 ساعت نتایج مورد بررسی قرار گرفت. بذور تراریخت رنگ آبی را از خود نشان دادند ولی در بذور شاهد هیچ گونه تغییر رنگی مشاهده نشد (شکل8). نتیجه این آزمون نشان داد که آنزیم بتا گلوکلورونیداز تولید شده بر سوبسترا اثر کرده و فعالیت لازم را دارد. در نمونه‫های برگی هیچ گونه تغییر رنگی مشاهده نشد و این تایید دیگری بر بیان نشدن ژن GUS در برگ می‫باشد.

 

 

 

 

 

 

 

 

شکل 8: آزمون هیستوشیمیایی GUS. 1: بذور گیاه شاهد 2 و3:  بذر گیاه تراریخت 4: برگ گیاه تراریخت

 

 

 

 

بحث

مزیت عمده استفاده از Soeing PCR برای اتصال چند قطعه DNA این است که نیاز به استفاده مکرر از آنزیم‌های برشی و جایگاه‌های برش وجود ندارد. همچنین این روش نسبت به سنتز مصنوعی توالی‌ها نیز از نظر صرفه‌‌جویی در هزینه‌ها برتری دارد. بنابراینSoeing PCR یک تکنیک مناسب برای ساختن سازه‌های شیمری است. استفاده از پیشبرنده‌های اختصاصی بافت موجب جلوگیری از فرار ژن از طریق گرده، کاهش آلرژی و مقبولیت بیشتر گیاهان تراریخته می‌شود. همچنین احتمال نوترکیبی بین DNA گیاه میزبان و DNA ویروسی (اغلب پیشبرنده‌های عمومی که در انتقال ژن به گیاهان استفاده می‌شود، منشا ویروسی دارند) نیز وجود نخواهد داشت. ضمن این‫که پیشبرنده‌های اختصاصی مثل پیشبرنده‌های عمومی رشد طبیعی گیاه میزبان را تحت تاثیر قرار نمی‌د‌هند (14). بنا به‫دلایل ذکر شده، در این تحقیق به‫منظور بیان ژن GUS در بذر گیاه، پیشبرنده Napin به‫جای پیشبرنده عمومی CaMV 35S جایگزین شد. این پیشبرنده علاوه بر اینکه بیان بالایی (20 تا 30 درصد از پروتئین کل بذر) دارد، نتایج تحقیقات قبلی نیز نشان ‌می‌دهد که از این پیشبرنده می‌توان برای بیان پروتئین‌های نوترکیب در بذر گیاه استفاده کرد (15). نتایج این تحقیق نیز نشان داد که این پیشبرنده موجب بیان ژن تحت کنترل خود در بذر توتون می‌شود. در مورد اهمیت توالی Ω به این نکته اشاره شود که در وکتورهای Gateway که به‌صورت تجاری به فروش می‌رسند، توالی Ω در بالادست ژن کدشونده تعبیه شده و ترجمه‌ی موثر ناحیه کد‌شونده را تضمین می‌کند (16). همچنین از توالی SAR جهت جلوگیری از خاموشی ژن استفاده شد. نقش توالی‫های SAR در جلوگیری از خاموشی تراژن و همچنین افزایش بیان آن در مطالعات متعدد مورد بررسی و در برخی موارد تاثیر آن تا 77 برابر افزایش در بیان تراژن گزارش شده است (6). نتایج حاصل از بررسی SDS-PAGE نشانگر بیان موفقیت‌آمیز پروتئین GUS در بذر گیاهان تراریخت بود ولی گیاهان مختلف از نظر میزان بیان ژن متفاوت بودند. میزان بیان پروتئین یک ژن خارجی در گیاهان تراریخت بستگی کامل به تعداد  نسخه‌های ژن منتقل شده و جایگاه قرارگیری آن در ژنوم هسته‌ای دارد. در سلول گیاهی، این ژن درون ژنوم گیاه قرار گرفته و پس از تراریختی، امکان تکثیر ژن (افزایش تعداد نسخه‌ها) وجود ندارد، مگر اینکه در ابتدای تراریختی تعداد نسخه‌های کافی در جایگاه مناسب در درون کروموزوم قرار گیرند (17). لذا تفاوت در میزان بیان پروتئین GUS می‌تواند ناشی از تفاوت در جایگاه قرارگیری این ژن در ژنوم گیاه و یا تعداد متفاوت نسخه‌های ژن منتقل شده باشد. در مورد برخی از گیاهان تراریخت علی‫رغم اینکه نتایج PCR نشان‌دهنده تراریخت بودن آن‌ها بود ولی در نتایج SDS-PAGE تفاوتی با گیاه شاهد غیرتراریخت مشاهده نشد. این مسئله می‌تواند دلایل متعددی از جمله بیان بسیار پایین پروتئین GUS در گیاهان مذکور باشد به نحوی که توسط تکنیک‌ SDS-PAGE قابل شناسایی نباشد  و یا اینکه فقدان بیان ژن ناشی از نوترکیبی ممکن در ناحیه T-DNA باشد که منجر به تغییر ساختار ژن GUS شده باشد (18). با استفاده از آزمون هیستوشیمیایی GUS می‌توان به تجزیه و تحلیل فعالیت پروموتر و همچنین فعالیت پروتئین تولید شده ‌پرداخت (11). تغییر رنگ محلول حاوی بذور تراریخت و سوبسترا، نشان‌دهنده بیان ژن و فعالیت پروتئین مربوط به ژن GUS می‌باشد.

مجموعه آزمون‫های انجام شده و نتایج نشان داد که سازه ژنی طراحی شده، مناسب بوده چرا که پیشبرنده Napin به‫خوبی موجب بیان اختصاصی ژن تحت کنترل خود در بذر شده  و توالی امگا نیز در افزایش بیان تراژن موثر بوده است. در ادامه کار می‌توان این سازه را با جایگزینی ژن‌های ارزشمند با ژن  GUS برای تولید پروتئین‫های نوترکیب استفاده نمود و امکان تولید انبوه و ارزان یک پروتئین نوترکیب باارزش را فراهم کرد .

 

 

نتیجه گیری

مجموعه آزمون‫های انجام شده و نتایج نشان داد که سازه ژنی طراحی شده، مناسب بوده چرا که پیشبرنده Napin به‫خوبی موجب بیان اختصاصی ژن تحت کنترل خود در بذر شده  و توالی امگا نیز در افزایش بیان تراژن موثر بوده است. در ادامه کار می‌توان این سازه را با جایگزینی ژن‌های ارزشمند با ژن  GUS برای تولید پروتئین‫های نوترکیب استفاده نمود و امکان تولید انبوه و ارزان یک پروتئین نوترکیب باارزش را فراهم کرد

1. Droogenbroeck BV, Cao J, Stadlmann J, Altmann F, et al. Aberrant localization and under glycosylation of high accumulating single-chain Fv-Fc antibodies in transgenic Arabidopsis seeds. In: Proceedings of the National Academy of Sciences of the United States of America. 2007; 104(4): 1430-1435.

2. Gallie DR, Walbot V. Identification of  the motifs within the tobacco Mosaic virus 5' –leader responsible for enhancing translation. Nucleic Acids Res. 1992; 20(17): 4631-4638.

3. Allen GC, Spiker S, Thompson WF. Use of matrix attachment regions (MARs) to minimize transgene silencing. Plant Mol. Biol. 2000; 43(2-3): 361-376.

4. Thompson WF, Spiker S, Allen GC. Matrix attachment regions and transcriptional gene silencing, In: Grasser KD, Regulation of transcription in plants. Aalborg: Blackwell Publishing Ltd; 2006; 136-161.

5. Nowak W, Gawlowska M, Jarmolowski A, Augustyniak J. Effect of nuclear matrix attachment regions on transgene expression in tobacco plants. Acta Biochimica Polonica. 2001; 48(3): 637–646.

6. Verma D, Verma M, Dey M, Jain RK, Wu R. Molecular dissection of the tobacco Rb7 matrix attachment region (MAR): effect of 5' half on gene expression in rice. Plant Science. 2005; 169(4): 704–711.

7. Dellaporta SL, Wood J, Hicks JD. A plant DNA mini preparation.Version II. Plant Mol. Biol. Report. 1983; 1(4):19-21.

8. Sambrook J,  Russell, DW. Molecular Cloning, A laboratory manual. 3rd edition. New York: Cold Spring Harbor Laboratory Press; 2001.

9. Horsch RB, Fry JE,  Hoffmann NL, Eichholtz D, et al. A simple and general method for transferring genes into plants. Science. 1985; 227: 1229-1231.

10. De Lisle AJ, Crouch ML.  Seed storage protein transcription and mRNA levels in brassica napus during development and in response to exogenous abscisic acid. Plant Physiol. 1989; 91, 617-623.

11. Jefferson RA, Kavanagh TA, Bevan, MW. GUS fusions: ß-glucuronidase as a sensitive and versatile gene marker in higher plants. The EMBO Journal. 1987; 6(13): 3901-3907.

12. Laemmli, UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T3. Nature. 1970;  227: 680-685.

13. Zupan JR, Zambryski PC. Transfer of T-DNA from Agrobacterium to plant cell. Plant Physiol. 1995; 107(4): 1041-1047.

14. Potenza C,  Aleman L,  Sengupta-Gopalan CH. Targeting transgene expression in research, agricultural, and environmental applications: promoters used in plant transformation. In Vitro Cell. Dev. Biol.- Plant. 2004; 40(1): 1–22.

15. Bagheri  Kh, Jalali javaran  M, Mahboudi F, Moeini A, et al. Designing and development of gamma interferon construct and expression of this protein in brassica napus seeds. Iran J.  Biol. 1389; 2: 151-160.

16. Karimi, M, Inze D, Depicker A. Gateway vectors for Agrobacterium mediated plant transformation. Trends Plant Sci. 2002; 7(5): 193-195.

17. Radke SE, Turner JC, Facciotti C. Transformation and regeneration of Brassica rapa using Agrobacterium tumefaciens. Plant Cell Rep. 1992; 11(10): 499-505. 

18. Prasad V, Satyavathi VV, Sanjaya VKM, Abha K, et al. Expression of biologically active Hemagglutinin-neuraminidase protein of Peste des petits ruminants virus in transgenic pigeonpea [Cajanus cajan (L.) Millsp]. Plant Sci. 2003; 35: 102-107.