اثر عصاره گیاه شیرین‌بیان بر بیان ژن ODC1 و تکثیر سلولی در سلول‌های سرطان سینه انسانی

نوع مقاله: علمی - پژوهشی

نویسندگان

گروه زیست‌شناسی، واحد نیشابور، دانشگاه آزاد اسلامی، نیشابور، ایران

چکیده

هدف: محصول ژن اورنیتین دکربوکسیلاز-1 ((ODC1 آنزیم کلیدی دخیل در سنتز پلی‌آمین‌ها است که در انواع سرطان میزان آن‌ها افزایش می‌یابد. در این پژوهش اثر عصاره ریشه گیاه شیرین‌بیان بر بیان ژن ODC1 و درصد زنده‌مانی در دو رده سلولی سرطانی (MCF-7, MDA-MB-231) و رده نرمال (MCF-10A) سلول‌های پستانی انسان بررسی می‌شود.
مواد و روش‌ها: رده‌های سلولی تحت تاثیر غلظت‌های افزایشی عصاره از صفر تا 200 میکروگرم در میلی‌لیتر قرار گرفتند. فعالیت سایتوتوکسیک عصاره با استفاده از سنجش MTT بررسی شد. بررسی کمی بیان ژن ODC1 با استفاده از تکنیک Real-time PCR انجام شد.
نتایج: با افزایش غلظت عصاره میزان مرگ‌ و میر سلول‌ها به‌ویژه در دو رده سرطانی به‌طور معنی‌داری افزایش یافت. همچنین با افزایش غلظت عصاره بیان ژنODC1  در رده‌های سرطانی کاهش قابل ‌توجهی پیدا کرد و در مقایسه دو رده سرطانی رده MDA-MB-231 بیشتر تحت تاثیر عصاره گیاه شیرین‌ بیان قرار گرفت.
نتیجه‌گیری: نتایج این تحقیق حاکی از اثر بالقوه عصاره گیاه شیرین‌بیان بر بیان ژن ODC1 در سلول‌های سرطانی پستان انسان و ارتباط آن با مهار رشد سلول‌های سرطانی است.

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

سرطان یکی از شایع‌ترین دلایل مرگ در جهان است. اکثر مرگ ‌و میر ناشی از سرطان در زنان مربوط به سرطان پستان است (1 و 2). سرطان سینه دومین عامل مرگ بعد از سرطان ریه است. این سرطان 32 درصد کل سرطان‌های زنان را شامل می‌شود و احتمال ابتلای یک خانم در طول 90 سال زندگی 1 به 8 است (3). بنابراین تحقیقات گسترده‌ای جهت شناسایی ژن‌های دخیل در سرطان پستان انجام‌شده است که یکی از مهم‌ترین آن‌ها ژن Ornithine Decarboxylase (ODC) است. محصول آنزیمی این ژن در کاتالیز اورنیتین به پوترسین نقش دارد که از واکنش‌های دخیل در سنتز پلی‌آمین‌ها است (4). پلی‌آمین‌ها برای پایدار نگه‌داشتن ساختار DNAو ترمیم شکستگی‌ها در آن ضروری می‌باشند (5). بنابراین این آنزیم برای رشد سلول، پایداری DNA تازه سنتز شده لازم است و نقص یا عدم وجود این آنزیم باعث القای آسیب DNA و تولید سلول سرطانی می‌شود. از طرف دیگر افزایش بیان ODC نیز باعث افزایش میزان سرطان‌زایی می‌شود چون ODC هدف آنکوژن myc  است به‌طوری‌که در انواع سرطان میزان بیان آن افزایش می‌یابد (6). آزمایش‌های گوناگونی نشان داده است که میزان بیان این ژن در سلول‌های سرطانی نسبت به سلول‌های عادی پستانی افزایش چشمگیری داشته است (7-9). ازاین‌رو استفاده از روشی که منجر به کاهش بیان ژن ODC و فعالیت آنزیمی آن بشود می‌تواند راه‌حل موثری در درمان سرطان پستان باشد.

استفاده از عصاره‌های گیاهی به‌عنوان داروی ضد سرطان به‏دلیل عدم وجود عوارض جانبی، در پیشگیری و درمان این بیماری موثر است (10, 11). گیاه شیرین‌بیان با نام علمی Glycyrrhiza glabra دارای ریشه‌ای با خواص دارویی است. ریشه‌ این گیاه حاوی ترکیباتی چون گلیسیریزین، فلاونوئید، ایزوفلاونوئید و فیتواستروژن است. برخی از ترکیبات این گیاه اثرات ضد سرطانی و برخی اثرات مهار آنزیم‌ها را بر عهده‌ دارند (12). وجود ترکیبات کاهش‌دهنده چربی و فلاونوئیدها با فعالیت آنتی‌اکسیدانت قوی در این گیاه گزارش‌شده است (10). همچنین اثرات سمیت سلولی عصاره گیاه شیرین‌بیان بررسی‌شده و نتایج نشان داده است که در مقایسه با داروهای استروئیدی و غیراستروئیدی، عصاره این گیاه سمیت سلولی کمتری دارد (13). بنابراین در این مطالعه ضمن بررسی اثر سمیت سلولی عصاره ریشه گیاه شیرین‌بیان بر دو رده سلولی سرطانی (MCF-7, MDA-MB-231) و رده نرمال (MCF-10A) سلول‌های پستانی انسان، سطح بیان ژن ODC نیز ارزیابی می‌شود.

مواد و روش‌ها

مواد و وسایل مورد استفاده: مواد شیمیایی مورداستفاده از شرکت‌های Sigma (USA) وMerk (Germany)  تهیه شد. مواد و آنزیم‌های کاربردی در بیولوژی مولکولی از سینا ژن (ایران) و ABI (USA)، همچنین کیت‌ها و مواد مورداستفاده در RT-PCR از شرکت فرمنتاز (Fermentas) تهیه شد.

تهیه عصاره گیاهی: جهت تهیه عصاره آبی از ریشه گیاه شیرین‌بیان استفاده شد که از شهر نیشابور واقع در استان خراسان رضوی جمع‌آوری‌شد. گونه گیاهی شیرین بیان توسط آقای طاهری شناسایی و کد هرباریومی (1035) در هرباریوم دانشگاه آزاد اسلامی واحد نیشابور به آن اطلاق شد. بدین‏منظور 50 گرم از ریشه درون پارچه تنظیف و در محفظه دستگاه سوکسله قرار داده شد. عصاره گیری به‏مدت 4 ساعت ادامه یافت به‌طوری‌که رنگ عصاره به قهوه‌ای تیره تغییر یافت. سپس حذف آب عصاره‌ها به‌وسیله دستگاه روتاری تا حد ممکن انجام شد. عصاره‌های غلیظ در درون ظروف درباز در محیط آزمایشگاه جهت تبخیر آب باقی‌مانده قرار داده شدند. در پایان عصاره‌های خشک جمع‌آوری و جهت تهیه غلظت‌های موردنظر به فریزر20- درجه سانتی‏گراد منتقل شدند.

در این پژوهش از غلظت‌های صفر، 100، 50،20، 10و 200 میکروگرم در میلی‌لیتر عصاره‌ها استفاده شد. جهت تهیه این غلظت‌ها ابتدا یک استوک 100 میلی‌گرم در میلی‌لیتر از عصاره خشک تهیه و برای ساخت سایر غلظت‌ها استفاده شد. برای غلظت صفر از آب مقطر دیونیزه استفاده شد.

رده‌های سلولی و محیط کشت: در این تحقیق از رده‌های سلولی سرطان پستانMCF-7 و MDA-MB-231  و رده سلولی نرمالMCF-10A  استفاده شد. سلول‌های MCF-7 از آزمایشگاه کشت سلول دانشکده علوم دانشگاه فردوسی تهیه شد و دو رده دیگر از بانک سلولی انستیتو پاستور ایران (تهران) خریداری شدند. سلول‌ها در فلاکس 25 سانتی‌متر مربع به‏همراه 10 درصد FBS (سرم جنینی گاوی)، در دمای37 درجه سانتی‌گراد با 5 درصد CO2 و 95 درصد رطوبت کشت داده شدند. محیط کشت روزانه تعویض شده و هر 3 تا 4 روز پاساژ داده شدند.

سنجش سمیت سلولی: فعالیت سایتوتوکسیسیتی عصاره با استفاده از سنجش MTT bromide) (2,3,5diphenil tetrazolium  مورد بررسی قرار گرفت. در این روش MTT  به نمونه‌ها اضافه‌ شده و توسط یک آنزیم میتوکندریایی شکسته می‌شود و تولید فورمازون نامحلول کرده که قابل‌اندازه‌گیری است و به این شیوه می‌توان تعداد سلول زنده در نمونه را تعیین کرد. بدین منظور نمونه‌هایی با تراکم3000 سلول در پلیت 96 خانه‌ای کشت داده شد و به‏مدت 24  ساعت در دمای 37 درجه سانتی‌گراد  انکوبه شد. سپس غلظت‌های مختلف عصاره به سلول‌ها اضافه و به‏مدت 48،24 و72 ساعت انکوبه گردید. بعد از این مدت مقدار 2 میلی مولار محلول MTT به هر خانه اضافه‌شده و به‏مدت 4 ساعت انکوبه شد. سپس100 میلی‌لیتر  DMSO (dimethyl sulfoxide) اضافه و به‏مدت 10 دقیقه هم زده شد. نهایتا جذب در طول‌ موج 540 نانومتر با استفاده از دستگاه (Awareness, Palm City, FL, USA) ELISA microplate reader اندازه‌گیری شد. این تست برای هر غلظت سه بار تکرار شد. همچنین جهت تایید صحت سنجش MTT رنگ آمیزی با تریپان بلو انجام شد.

به‌منظور تعیین درصد سلول‌های زنده در هر غلظت عصاره، میانگین جذب‌های نوری سلول‌های تیمار شده با غلظت مورد نظر از عصاره بر میانگین جذب‌های نوری محلول معادل DMSO تقسیم و در نهایت عدد حاصل در 100 ضرب شد. غلظت موثر عصاره دارای سمیت سلولی، با کمیتی به‏نامIC50  گزارش شد که نشان‌دهنده غلظتی است که در آن نیمی از سلول‌ها زنده می‌باشند  به‌منظور محاسبه IC50  عصاره‌ها از نرم‌افزارPrism 5.0 استفاده شد.

اندازه‌گیری بیان نسبی ODC1: بررسی کمی بیان ژن ODC1 با استفاده از تکنیک Real-time PCR انجام شد. بدین‏منظور ابتدا هر سه رده سلولی کشت داده شد و در مرحله بعد غلظت‌های مختلف عصاره به آن‌ها اضافه شد و سلول‌ها به‏مدت 48 ساعت انکوبه و سپس جهت استخراج RNA  استفاده شدند. همه تیمارها در سه تکرار انجام شد.

جهت طراحی آغازگرهای ویژه ژن اورنیتین دکربوکسیلاز (ODC1) از توالی مربوط به mRNA این ژن که در پایگاه اطلاعاتی  NCBI  با شماره دسترسی NM_002539.2  موجود است، استفاده شد. طراحی آغازگر با در نظر گرفتن نکات استاندارد در طراحی آغازگر از جمله طول آغازگر، دمای اتصال، G+C% ، ایجاد دایمر، تولید لوپ یا حلقه در درون هر یک از آغازگرها وΔG  مناسب با استفاده از نرم‌افزار Oligo (Naltional Biosciences Inc., Ver. 7.5)  انجام شد. سنتز آغازگرهای طراحی‌شده به‌واسطه شرکت ندای فن راه در شانگهای چین انجام شد (جدول 1).

 

 

 

 

جدول 1: خصوصیات پرایمرهای طراحی شده برای ژن‏های ODC1 و ACTB

طول قطعه تکثیر شده

GC%

دمای ذوب

(Tm)

طول نوکلئوتید

توالی

5´ - 3´

نام آغازگر

108

50

83/59

22

GTGGGTGATTGGATGCTCTTTG

ODC1-FW

50

03/59

22

ACCAGGCTAACTACTCGCTCAA

ODC1-RV

154

45

87/56

20

TCCATCATGAAGTGTGACGT

ACT-FW

36/36

32/54

22

GAGCAATGATCTTGATCTTCAT

ACT-RV

 

 

 

در این پژوهشReal-time PCR  با استفاده از روش SYBR Green و با به‌کارگیری دستگاه ABL step-one(Applied Biosystems) انجام شد. cDNA ساخته‌شده از RNA استخراج  ‌شده از نمونه‌ها به‌عنوان الگو برای واکنش‌های qRT – PCR با پرایمرهای اختصاصی طراحی‌شده برای ژن‌ها در نظر گرفته شد و ژن بتا اکتین هم به‌عنوان کنترل داخلی استفاده شد. اجزای مختلف 20 میکرو لیتر مخلوط واکنش  qRT – PCR شامل 10میکرولیتر SYBER Green PCR Master Mix(ABI) ، 4/0 میکرولیتر Forward primer، 4/0 میکرولیتر Reverse primer، 2/6 میکرولیترH2O و 3 میکرولیتر cDNA است. شرایط چرخه دمایی و زمانی شامل، دمای واسرشتگی اولیه 95 درجه سانتی‌گراد به‏مدت 10 دقیقه سپس برای 40 چرخه، دمای واسرشتگی 95 درجه سانتی‌گراد به‏مدت 15 ثانیه  و نهایتا اتصال پرایمر و طویل شدن دمای 60 درجه سانتی‌گراد به‏مدت 60 ثانیه بود. کنترل منفی برای هر پروسه نیز انجام شد. داده‌های حاصل از Real-time PCR با استفاده از روش ΔΔCt آنالیز گردید (با استفاده از ژن کنترل بتا اکتین).

آنالیز آماری

برای تجزیه واریانس داده‌های مربوط به اثرات سمیت سلولی از نرم‌افزار SAS استفاده شد.Ct  های مربوط به واکنش qRT – PCR  از نرم‌افزار دستگاه Real-time PCR استخراج  و پس از محاسبه پارامترهای مربوطه آنالیزهای آماری توسط نرم‌افزار SAS  انجام شد. برای مقایسه میانگین‌ها از آزمون LSD استفاده شد. رسم نمودارها توسط نرم‌افزار Excelانجام شد.

نتایج

بررسی سمیت سلولی عصاره آبی گیاه شیرین‌بیان

نتایج حاصل از اثر غلظت‌های مختلف عصاره آبی گیاه شیرین‌بیان بر درصد زنده ماندن سلول‌ها نشان داد که با افزایش غلظت و زمان، تاثیر عصاره بر سلول‌ها به‌طور معنی‌داری بیشتر شده و افزایش قابل‌توجهی در مرگ ‌و میر سلول‌ها دیده می‌شود. به‌طوری‌که از غلظت 50 میکروگرم در میلی‌لیتر به بعد اثرات سمیت سلولی عصاره محسوس‌تر است. با مقایسه اثرات عصاره این گیاه بر رده‌های سلولی مورد مطالعه مشخص شد که اثرات سمیت این عصاره بر سلول‌های سرطانی نسبت به سلول‌های نرمال به‌طور معنی‌داری بیشتر است، به‌گونه‌ای که به‌جز غلظت صفر عصاره در بقیه غلظت‌ها درصد زنده‌مانی سلول‌های نرمال (MCF-10A)  از دو رده سرطانی (MCF-7, MBA-MD-231)  به‌صورت معنی‌داری بیشتر است. همچنین در مقایسه بین دو رده سرطانی، رده MCF-7  تحت تأثیر بیشتری قرارگرفته است و درصد زنده‌مانی این رده سلولی به‌طور معنی‌داری کمتر از رده دیگر است (شکل 1). عصاره این گیاه دارای اثر سمیت سلولی مؤثر بر سلول‌های سرطانی بوده و باعث کاهش بیش از 50 درصد میزان بقای سلول‌ها (IC50)  می‌شود  که مقادیر آن در جدول 2 آورده شده است.

 

 

 

شکل1: منحنی تغییرات اثر غلظت‌های مختلف عصاره گیاه شیرین‌بیان بر درصد زنده‌مانی سه رده سلولی پستان. داده‏ها میانگین 3 بار تکرار درصد زنده ماندن سلول‌ها در هر غلظت به همراه انحراف معیار می باشد.

جدول2: مقادیر IC50  (میکروگرم در میلی‌لیتر) برای رده‌های سلولی در زمان‏های متفاوت

رده سلولی

زمان

24 h

48 h

72 h

MCF-10A

>300

6/256

1/214

MBA-MD-231

150

99/66

72/46

MCF-7

1/112

38/49

35/32

 

 

اثر عصاره گیاه شیرین‌بیان بر میزان نسبی بیان ژن ODC1

واکنش qRT- PCR به‏روش Real – time SYBER Green PCR توسط دستگاه ABI Step-One Applied Biosystem)) انجام شد. در این روش همه داده‌های مربوط به ژن ODC1 با ژن ACTB به‏عنوان کنترل داخلی نرمالایز شد و سپس میزان تغییرات بیان ژن در غلظت‌های مختلف عصاره و رده‌های مختلف سلولی بررسی شد. نتایج این واکنش به‏صورت نمودارهای منحنی ذوب و تکثیر ژن‌ها  که توسط دستگاه ترسیم شد (شکل‌های2 و3). در نمودارهای منحنی ذوب وجود یک پیک و عدم حضور پیک‌های اضافی نشان دهنده تکثیر اختصاصی قطعات مورد نظر و راندمان مناسب واکنش PCR می‌باشد. نمودارهای تکثیر قطعات نیز حاکی از افزایش موازی فلورسانس تمام نمونه‌ها طی مرحله لگاریتمی رسیدن به ثبات نسبی تا چرخه 40 است.

 

 

شکل 2: منحنی ذوب محصولات Real-Time PCR برای ژن‌هایODC1  (سمت راست) وACTB  (سمت چپ).  نقطه ذوب تمامی نمونه‌ها برای ژن‌های ACTB  و ODC1 حدود 79 درجه سانتی‏گراد می‌باشد که نشان دهنده تکثیر اختصاصی ژن‏های مورد نظر است.

 

شکل 3: منحنی فلورسانس نمونه‌های cDNA ژن‌های ، ODC1 (سمت راست) و ACTB (سمت چپ). از هر نمونه 3 تکرار گذاشته شد تا میانگین نتیجه آن‏ها مورد تجزیه و تحلیل قرار گیرد. فلورسانس تمام نمونه‌ها به‏طور موازی طی مرحله لگاریتمی افزایش می‏یابد و تا چرخه 40 به ثبات نسبی می‏رسند.

 

مقایسه میانگین تغییرات بیان ژن ODC1 در سه رده سلولی تیمار شده با غلظت‌های مختلف عصاره گیاه شیرین‌بیان نشانگر کاهش بیان ژن با افزایش غلظت عصاره‌ها نسبت به شاهد است. به‌طوری‌که در غلظت 100 میکروگرم در میلی‌لیتر عصاره میزان نسبی بیان این ژن در سه رده نرمال، MDA-MB-231 و MCF-7 به‏ترتیب 5/1، 5/2 و 3/3 برابر کاهش‌یافته است. همچنین در مقایسه بیان این ژن در سه رده سلولی تحت تاثیر غلظت‌های مختلف می‌توان چنین اظهار داشت که در هر غلظت عصاره کمترین بیان مربوط به رده سلولی MDA-MB-231 است، اگرچه در غلظت‌های 20، 50 و 200 تفاوت معنی‏داری بین این رده و رده MCF-7 مشاهده نمی‌شود (شکل 4). بنابراین به‌طورکلی می‌توان گفت که بیان ژن ODC1 در رده MDA-MB-231 بیشتر تحت تأثیر عصاره گیاه شیرین‌بیان قرارگرفته است.

 

 

شکل 4: مقایسه تغییرات بیان ژن  ODC1 در سه رده سلولی تیمار شده با غلظت‌های مختلف عصاره گیاه شیرین‌بیان.  داده‏ها میانگین 3 بار تکرار در هر غلظت به‏همراه انحراف معیار می‏باشد.

 

بحث

گیاه شیرین‌بیان یک گیاه دارویی با ترکیبات شیمیایی و موثره مفید  و متنوعی است و به‏همین دلیل در صنایع غذایی و دارویی از اهمیت زیادی برخوردار است. از این گیاه یک گلیکوزید تری ترپن بنام گلیسریزین به‏دست می‌آید که شیرین بوده و در بعضی کشورها مانند ژاپن جایگزین قند استفاده می‌شود (11). اما گروه دیگری از ترکیبات که در ریشه ‌این گیاه حضور دارند، ترکیبات فنلی - فلاونوئیدی هستند که مطالعات متعددی در زمینه خواص ضدالتهابی، ضد میکروبی، آنتی‌اکسیدانتی، سمیت سلولی و ضد سرطانی آن‌ها انجام‌شده است. به‌طور مثال در مطالعه Khazraei  و همکاران (14) نشان داده شده است که  عصاره گیاه شیرین‌بیان بر رده‌های سلولی سرطان‌های معده‌ای روده‌ای تاثیر معنی‏داری داشته و از طریق القای آپوپتوزیس، موجب از بین رفتن  سلول‌های سرطانی شده درحالی‌که بر سلول‌های نرمال هیچ‌گونه تاثیر معنی‏دار و منفی ندارد. همچنین در مطالعه Fu و همکاران (10) فلاونوئید استروژنی Licochalcone استخراج‌ شده از ریشه گیاه شیرین‌بیان فعالیت ضد توموری بر سلول‌های سرطانی پروستات (PC3) نشان داد. نتایج این تحقیق مشخص کرد که این ترکیب فلاونوئیدی از طریق مهار سایکلین B1 و cdc2 سبب توقف چرخه سلولی در مرحله G2/M شده است. به‏علاوه در پژوهشی دیگر اثر فلاونوئید Glabridin بر سلول‌های رده MDA-MB-231 وMCF-7 مطالعه شد و مشخص شد که تا غلظت 10 میکرومولار این ترکیب رشد سلول‌های MCF-7  را تحریک کرده  ولی  بر روند رشد رده سلولی MDA-MB231  تأثیری نداشته است اما در غلظت‌های بالا رشد هر دو رده سلولی را مهار می‌کند (15). همچنین عصاره اتانولی ریشه گیاه شیرین‌بیان در حضور ماده تتراکلرو دنیترودیوکسین (TCDD)  که تحریک‌کننده رشد سلول‌های سرطانی MCF-7 است، سبب کاهش درصد زنده‌مانی سلول‌ها در غلظت 200 میکروگرم در میلی‌لیتر شد و مشخص شد که عمل کاهش رشد از طریق متوقف کردن چرخه سلولی در مرحله G2/M رخ می‌دهد (16).

نتایج ما در این مطالعه مشخص کرد که عصاره گیاه شیرین‌بیان بر رده‌های سلولی موردمطالعه دارای اثر سمیت سلولی به‏روش وابسته به دوز و زمان است. به‌طوری‌که باگذشت زمان IC50 عصاره شیرین‌بیان در هر سه رده سلولی کاهش نشان داد (جدول 1). البته باید خاطر نشان کرد که رده سلولی نرمال (MCF-10A) کمترین تاثیرپذیری را از عصاره گیاهی داشته است و می‌توان گفت که عصاره‌ها دارای سمیت انتخابی بر سلول‌های سرطانی MCF-7 و MDA-MB-231 بوده و در نتیجه خاصیت ضد سرطانی دارند. بر اساس نتایج، سمیت سلولی عصاره گیاه شیرین‌بیان بر رده سلولی با گیرنده استروژن (استروژن مثبت) MCF-7 بیشتر از رده سلولی MDA-MB-231 (استروژن منفی) است که این موضوع می‌تواند به دلیل فقدان محرک استروژن در عصاره آبی این گیاه باشد.

اورنیتین دکربوکسیلاز (ODC) از آنزیم‌های مهم در سنتز پلی‌آمین‌ها است و تجمع پلی‌آمین‌ها در انواع متعددی از سلول‌های سرطانی دیده‌شده است (3). در نتیجه  میزان فعالیت آنزیم ODC می‌تواند به‌عنوان شاخص زیستی در تخمین رشد و پیشرفت تومور در نظر گرفته شود. لذا کاهش میزان بیان ژن ODC1 و یا مهار فعالیت آنزیم اورنیتین دکربوکسیلاز راه‏کاری مناسب برای  جلوگیری از رشد و تکثیر سلول‌های سرطانی است (9, 17). در دهه اخیر استفاده از ترکیبات با منشا گیاهی یا عصاره‌های گیاهی در تحقیقات ضد سرطان و به‌ویژه در راستای کاهش پلی آمین‌ها و اورنیتین دکربوکسیلاز رو به فزونی گذاشته است که می‌توان به تیمار خوراکی موش‌های مبتلا به سرطان پوست با ماده گلیسریزین استخراج ‌شده از ریشه گیاه شیرین‌بیان اشاره کرد که سبب کاهش رشد تومورها و همچنین باعث کاهش فعالیت آنزیم ODC در تومورها شد (18). همچنین در پژوهشی دیگر میزان mRNA  ژن ODC1 در بافت‌های سرطانی و غیر سرطانی ریه انسان  مقایسه شد و مشخص شد میزان mRNA  این ژن در بافت‌های سرطانی به‌طور قابل‌توجهی بیشتر از بافت‌های غیر سرطانی است (19). در مطالعه Wang و همکاران (20) مشخص شد که هیدروکسی دی بنزوئیل متان و دی بنزوئیل متان از فلاونوئیدهای ریشه گیاه شیرین‌بیان اثر ضد سرطانی بر سلول‌های سرطانی پوست ‌دارند. این ترکیبات از طریق تولید رادیکال‌های آزاد اکسیژن و تخریب غشای داخلی میتوکندری سبب القای آپوپتوزیس می‌شوند. همین‌طور با فعال‌سازی آنزیم‌هایی مانند کوئینون اکسیدو ردوکتاز سبب تخریب پروتئین ODC می‌شوند.

نتایج این تحقیق حاکی از کاهش معنی‌دار بیان ژن ODC1 در دو رده سلولی سرطانی تحت تیمار عصاره پس از 48 ساعت بود. در خصوص مکانیسم کاهش بیان این ژن توسط عصاره گیاه شیرین‌بیان اطلاعی در دست نیست اما به‏دلیل وجود عناصر تنظیمی در ناحیه پروموتری این ژن، تنظیم در سطح رونویسی از طریق این عناصر می‌تواند یکی از عوامل باشد. مهار بیان ژن ODC1 و متعاقبا کاهش میزان آنزیم اورنیتین دکربوکسیلاز منجر به پایین آمدن سطح پلی‌آمین‌ها در سلول‌های سرطانی می‌شود. کمبود پلی‌آمین‌ها به‌عنوان جاروب کننده رادیکال‌های آزاد سبب تجمع  این رادیکال‌ها و وقوع آپوپتوزیس می‌شود. در مقایسه بین دو رده سرطانی میزان کاهش بیان ژن ODC1 در رده MDA-MB-231 نسبت به رده MCF7 به‏ویژه در غلظت 100 میکروگرم در میلی‌لیتر بیشتر بود در حالی که سمیت عصاره در رده MCF7 بیشتر بود. پاسخ متفاوت این دو رده سلولی، می‏تواند به تفاوت‌های ژنتیکی این دو رده مربوط باشد به‏طوری‏که رده MCF7 واجد گیرنده استروژن و پروژسترون و فاقد گیرنده HER2 است (−ER+/PR+/HER2). در حالی‏که رده MDA-MB-231 فاقد هر سه گیرنده استروژن، پروژسترون و HER2 است (21).

نتیجه‌گیری

نتایج این پژوهش بیانگر سمیت انتخابی عصاره ریشه گیاه شیرین بیان بر سلولهای سرطانی رده MCF7 است. در رابطه با مکانیسم احتمالی اثر این عصاره گیاهی، اگرچه در مطالعات مختلف دلایل زیادی همچون مهار چرخه سلولی، وقوع آپوپتوزیس برای توجیه اثر سمیت سلولی عصاره‌های گیاهی ذکر شده است اما با توجه به نتایج تحقیق حاضر می‌توان احتمال داد که عصاره گیاه شیرین‌بیان با کاهش بیان ژن ODC1 که نقش اساسی در شکل‌گیری سرطان و تداوم آن دارد، سبب سمیت سلولی می‌‏شود.

تشکر و قدردانی

کلیه اعتبار مالی پژوهش حاضرتوسط معاونت پژوهش و فناوری دانشگاه آزاد اسلامی واحد نیشابور تامین شده است، که به این وسیله تشکر و قدردانی می شود.

منابع

1. Siegel RL, Miller  KD , Jemal A. Cancer statistics. CA: a cancer journal for clinicians. 2016; 66(1): 7-30.

2. Parsa N. Molecular and Cellular Basis of Human Cancer. Journal of Cell & Tissue. 2012; 2(4): 365-376.

3. Deng W, Jiang  X, Mei  Y, Sun  J, et al. Role of ornithine decarboxylase in breast cancer. Acta biochimica et biophysica Sinica. 2008; 40(3): 235-43.

4. Arisan ED, Akkoc Y, Akyuz  KG, Kerman  EM, et al. Polyamines modulate the roscovitine-induced cell death switch decision autophagy vs. apoptosis in MCF-7 and MDA-MB-231 breast cancer cells. Molecular medicine reports. 2015; 11(6): 4532-40.

5. Brown I, Halliday S, Greig H, Heys SD, et al. Genetic polymorphism in ornithine decarboxylase and risk of breast cancer. Familial cancer. 2009; 8(4): 307-11.

6. Love, RR, Astrow, SH, Cheeks, AM , Havighurst, TC. Ornithine decarboxylase (ODC) as a prognostic factor in operable breast cancer. Breast cancer research and treatment. 2003; 79(3): 329-334.

7. Zhu Q, Jin L, Casero  RA, Davidson  NE, et al. Role of ornithine decarboxylase in regulation of estrogen receptor alpha expression and growth in human breast cancer cells. Breast cancer research and treatment. 2012; 136(1): 57-66.

8. Thomas  TJ, Thomas  T, John  S, Hsu  HC, et al. Tamoxifen metabolite endoxifen interferes with the polyamine pathway in breast cancer. Amino acids. 2016; 48(10): 2293-302.

9. Afshar  AS, Nematpour FS, Meshkani  M , Khafi A. Growth inhibition of human breast cancer cells and down-regulation of ODC1 and ADA genes by Nepeta binaloudensis. Revista Brasileira de Farmacognosia. 2017; 27(1): 84-90.

10. Fu  Y, Chen J, Li  YJ, Zheng  YF, et al. Antioxidant and anti-inflammatory activities of six flavonoids separated from licorice. Food chemistry. 2013; 141(2): 1063-1071.

11. Wang  L, Yang R, Yuan  B, Liu Y, et al. The antiviral and antimicrobial activities of licorice, a widely-used Chinese herb. Acta pharmaceutica Sinica. B. 2015; 5(4): 310-5.

12. Yang R, Wang LQ, Yuan BC , Liu, Y. The Pharmacological Activities of Licorice. Planta medica. 2015; 81(18): 1654-69.

13. Kao TC, Wu CH , Yen GC. Bioactivity and potential health benefits of licorice. Journal of agricultural and food chemistry. 2014; 62(3): 542-53.

14. Khazraei-Moradian S, Ganjalikhani-Hakemi M, Andalib A, Yazdani R, et al. The Effect of Licorice Protein Fractions on Proliferation and Apoptosis of Gastrointestinal Cancer Cell Lines. Nutrition and Cancer. 2017; 69(2): 330-339.

15. Hsu YL, Wu LY, Hou MF, Tsai EM, et al. Glabridin, an isoflavan from licorice root, inhibits migration, invasion and angiogenesis of MDA‐MB‐231 human breast adenocarcinoma cells by inhibiting focal adhesion kinase/Rho signaling pathway. Molecular nutrition & food research. 2011; 55(2): 318-327.

16. Chu XT, de la Cruz J, Hwang SG , Hong H. Tumorigenic effects of endocrine-disrupting chemicals are alleviated by licorice (Glycyrrhiza glabra) root extract through suppression of AhR expression in mammalian cells. Asian Pac J Cancer Prev. 2014; 15(12): 4809-4813.

17. Smirnova OA, Isaguliants MG, Hyvonen MT, Keinanen TA, et al. Chemically induced oxidative stress increases polyamine levels by activating the transcription of ornithine

 

decarboxylase and spermidine/spermine-N 1-acetyltransferase in human hepatoma HUH7 cells. Biochimie. 2012; 94(9): 1876-1883.

18. Rahman S , Sultana S. Glycyrrhizin exhibits potential chemopreventive activity on 12-O-tetradecanoyl phorbol-13-acetate-induced cutaneous oxidative stress and tumor promotion in Swiss albino mice. Journal of enzyme inhibition and medicinal chemistry. 2007; 22(3): 363-9.

19. Grimminger PP, Schneider PM, Metzger R, Vallböhmer D, et al. Ornithine decarboxylase mRNA expression in curatively resected non–small-cell lung cancer. Clinical lung cancer. 2010; 11(2): 114-119.

20. Wang MF, Liao YF, Hung YC, Lin CL, et al. Hydroxydibenzoylmethane induces apoptosis through repressing ornithine decarboxylase in human promyelocytic leukemia HL-60 cells. Experimental & molecular medicine. 2011; 43(4): 189-196.

21. Srisawat T, Sukpondma Y, Graidist P, Chimplee S, et al. The dose dependent in vitro responses of MCF-7 and MDA-MB-231 cell lines to extracts of Vatica diospyroides Symington type SS fruit include effects on mode of cell death. ‎Pharmacogn. Mag. 2015;11(Suppl 1), S148.

  1. Elmann A, Telerman A, Mordechay S, Erlank H, et al., Antioxidant and astroprotective effects of a Pulicaria incisa infusion. Oxid Med Cell Longev. 2012; 2012: doi:10.1155/2012/157598.
  2. Goldman SA, Windrem MS. Cell replacement therapy in neurological disease. Philos Trans R Soc Lond B Biol Sci. 2006; 361(1473): 1463-1475.
  3. Low CB, Liou YC, Tang BL. Neural differentiation and potential use of stem cells from the human umbilical cord for central nervous system transplantation therapy. J Neuroscience Res. 2008; 86(8): 1670-1679.
  4. Heile AMB, Wallrapp C, Klinge PM, Samii A, et al. Cerebral transplantation of encapsulated mesenchymal stem cells improves cellular pathology after experimental traumatic brain injury. Neurosci Lett 2009; 463(3): 176-181.
  5. Shi Kam NW, Jessop TC, Wender PA, Dai H. Nanotube molecular transporters: internalization of carbon nanotube-protein conjugates into mammalian cells. J Am Chem Soc 2004; 126(22): 6850-6851.
  6. Hess DC, Borlongan CV. Stem cells and neurological diseases. Cell Prolif. 2008; 41(s1): 94-114.
  7. Esmaeili F, Tiraihi T, Movahedin M, Mowla SJ. Selegiline induces neuronal phenotype and neurotrophins expression in embryonic stem cells. Rejuv Res. 2006; 9(4): 475-484.
  8. Dohrmann U, Edgar D, Thoenen H. Distinct neurotrophic factors from skeletal muscle and the central nervous system interact synergistically to support the survival of cultured embryonic spinal motor neurons. Dev Biol. 1987; 124(1): 145-152.
  9. Bakhshalizadeh S, Esmaeili F, Houshmand F, Shirzad H, et al. Effects of selegiline, a monoamine oxidase B inhibitor, on differentiation of P19 embryonal carcinoma stem cells, into neuron-like cells. In Vitro Cell Dev-An. 2011; 47(8): 550-557.
  10. MacPherson PA, McBurney MW. P19 embryonal carcinoma cells: a source of cultured neurons amenable to genetic manipulation. Methods. 1995; 7(3): 238-252.
  11. Zhou C, Kong J, Dai H. Electrical measurements of individual semiconducting single-walled carbon nanotubes of various diameters. Applied Physics Letters. 2000; 76(12): 1597-1599.
  12. Stern CD. The chick: a great model system becomes even greater. Dev cell. 2005; 8(1): 9-17.
  13. Hamburger V, Hamilton HL. A series of normal stages in the development of the chick embryo. J Morphol. 1951; 88(1):49-92.
  14. Narayanan K, Lim VY, Shen J, Tan ZW, et al. Extracellular Matrix-Mediated Differentiation of Human Embryonic Stem Cells: Differentiation to Insulin-Secreting Beta Cells. Tissue Eng Part A. 2014; 20(1-2): 424-433.
  15. Laeremans A, Van de Plas B, Clerens S, Van den Bergh G, et al. Protein expression dynamics during postnatal mouse brain development. J Exp Neurosci. 2013; 7: 61.
  16. Thompson BC, Richardson RT, Moulton SE, Evans AJ, et al. Conducting polymers, dual neurotrophins and pulsed electrical stimulation-dramatic effects on neurite outgrowth. J Control Release. 2010; 141(2): 161-167.
  17. Ghasemi Hamidabadi H, Rezvani Z, Nazm Bojnordi M, Shirinzadeh H, et al. Chitosan-Intercalated Montmorillonite/Poly (vinyl alcohol) Nanofibers as a Platform to Guide Neuronlike Differentiation of Human Dental Pulp Stem Cells. ACS Appl Mater Interfaces. 2017; 9(13): 11392-11404.
  18. Lee JY, Kim E, Choi S-M, Kim D-W, et al. Microvesicles from brain-extract—treated mesenchymal stem cells improve neurological functions in a rat model of ischemic stroke. Sci Rep. 2016; 6:33038, DOI: 10.1038/srep33038.
  19. Hatamnia Z, Esmaeili F, Houshmand F, Dehdehi L. Effect of pancreatic extract on insulin secreting cell differentiation from mouse bone marrow mesenchymal stem cells. J Shahrekord Univ Med Sci. 2014; 16(2): 52-62.
  20. Kim D, Richardson-Burns S, Hendricks JL, Sequera C, et al. Effect of immobilized nerve growth factor on conductive polymers: electrical properties and cellular response. Adv Funct Mater 2007; 17(1): 79-86.
  21. MacPherson PA, Jones S, Pawson PA, Marshall KC, et al. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 1997; 80(2): 487-499.
  22. Sigurjonsson OE, Perreault M-C, Egeland T, Glover JC. Adult human hematopoietic stem cells produce neurons efficiently in the regenerating chicken embryo spinal cord. Natl Acad Sci USA. 2005; 102(14): 5227-5232.
  23. Kulesa PM, Kasemeier-Kulesa JC, Teddy JM, Margaryan NV, et al. Reprogramming metastatic melanoma cells to assume a neural crest cell-like phenotype in an embryonic microenvironment. Proc Natl Acad Sci USA. 2006; 103(10): 3752-3757.
  24. Soundararajan P, Miles GB, Rubin LL, Brownstone RM, et al. Motoneurons derived from embryonic stem cells express transcription factors and develop phenotypes characteristic of medial motor column neurons. J Neurosci. 2006; 26(12): 3256-3268.