بررسی اثر دو فاکتور Nurr1 و GDNF بر حفاظت نورونهای دوپامین ساز SH-SY5Y در مقابل التهاب عصبی و مسمومیت ناشی از 6-OHDA

نوع مقاله: علمی - پژوهشی

نویسندگان

1 کارشناس ارشد زیست شناسی گرایش سلولی- مولکولی، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، تهران، ایران

2 پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، ژنتیک مولکولی، پژوهشکده پزشکی،گروه سلول‏های بنیادی و پزشکی ترمیمی، تهران، ایران

3 پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، پژوهشکده پزشکی، گروه پزشکی مولکولی، تهران، ایران

چکیده

هدف: در این تحقیق از بیش­بیان فاکتورهایNurr1 و GDNF، به‏دلیل پتانسیل ضدالتهابی و ترمیمی آن‏ها و نیز نقش  Nurr1در تنظیم بیان ژن گیرنده GDNF(Ret)، با هدف حفاظت سلول‏های دوپامین­سازSH-SY5Y در مقابل التهاب عصبی و نیز مسمومیت 6-OHDA  استفاده شد.
مواد و روش­ها: ابتدا لنتی­ویروس‏های نوترکیب حامل ژن‏هایNurr1 وGDNF تهیه و به‏ترتیب به سلول‏های SH-SY5Y و آستروسیتوما ترانسداکت شدند. همچنین برای تولید بهینه فاکتور GDNF، سلول‏های HEK-293T با ناقل پلاسمیدی مربوطه ترانسفکت و محیط مشروط آن‏ها و نیزسلول‏های آستروسیتوما، حاوی فاکتور GDNF، جمع­آوری شد. بیش­بیان ژن‏های مزبور با RT-PCR به اثبات رسید. از سوی دیگرسلول‏های میکروگلیا از مغز نوزاد رت جداسازی و متعاقبا با لیپوپلی ساکارید (LPS) فعال و نهایتا بیان فاکتورهایTNF-α و iNOS در آن‏ها با تستگریسوRT-PCR اثبات شد؛ محیط مشروط میکروگلیا جمع­آوری و به‏همراه محیط مشروط سلول‏های آستروسیتوما/HEK-293T  به سلول‏های  SH-SY5Yافزوده شد. رده­یSH-SY5Y به‏صورت جداگانه نیز با محیط مشروط آستروسیتوما / HEK- 293T و توکسین 6-OHDA تیمار شد.
نتایج: آنالیز MTT نشان داد سلول‏های SH-SY5Y با بیان فزاینده­Nurr1  و یا در حضور GDNF، مقاومت بیشتری در برابر التهاب عصبی و توکسین6-OHDA نشان می‏دهند. همچنین GDNF و Nurr1 با هم اثر سینرژیک داشته و مقاومت بیشتری را به سلول‏های دوپامین­ساز عطا می‏کنند.
نتیجه­گیری: فاکتورهایNurr1  و GDNF به تنهایی و نیز به‏صورت توام و سینرژیک، اثر حفاظتی بر نورون‏های دوپامین­ساز در مقابل عوامل التهابی و توکسین 6-OHDA دارند.

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

پارکینسون دومین بیماری مخرب عصبی شایع در جهان است که در 1درصد از افراد بالای60 سال و 4 درصد از افراد بالای 85 سال شیوع دارد (1). یکی از شاخص‏­های اصلی این بیماری مرگ نورون‏های دوپامین­ساز مغز میانی است(2). این سلول‏ها با تولید دوپامین، که یک انتقال دهنده عصبی است (3)، یکی از مهم‏ترین مسیرهای انتقال دوپامین در مغز میانی یعنی مسیر نیگرو- استریاتال را راه اندازی و نقش اصلی را در کنترل و اجرای حرکات بدن ایفا می­کنند (4 و 5). با مرگ این سلول‏ها و عدم تولید دوپامین، علایم پاتولوژیکی این بیماری از جمله: سفت شدن عضلات و انقباض طولانی مدت آن‏ها، کند شدن حرکات و ناتوانی در شروع و طراحی آن‏ها، انقباض و انبساط ریتمیک عضلات و عدم تعادل بدن، در فرد بیمار بروز می­کند (6 و 7).

بیماری پارکینسون به‏عنوان یک بیماری چندعاملی که هم عوامل ژنتیکی و هم عوامل محیطی در آن دخیل هستند، شناخته می­شود. عوامل محیطی بیشترین نقش را در ایجاد این بیماری ایفا می­کنند که از مهم‏ترین آن‏ها می‏توان به فاکتورهای محیطی ایجاد کننده استرس اکسیداتیو و التهاب عصبی اشاره کرد. نورون‏های دوپامین‌ساز ناحیه­ی سابستنشیا نیگرا (SN) بسیار مستعد رویارویی با پدیده­ی استرس اکسیداتیو هستند. زیرا هم مصرف اکسیژن بالایی دارند و هم سطح آنزیم­های آنتی‏اکسیدانت در این سلول‏ها پایین است (8). التهاب مزمن ایجاد شده در مغز التهاب عصبی نامیده می­شود. در اکثر بیماری‌های مخرب عصبی از جمله پارکینسون هم التهاب مزمن موضعی ناشی از سلول‏های ایمنی ساکن در مغز، میکروگلیاها، و هم التهاب ناشی از نفوذ لوکوسیت­ها از دیواره­ی رگ­ها به داخل بافت مغزی دیده شده است (9 و 10). انتقال ژن‏های کدکننده­ی فاکتورهای ضد استرس و ضد التهاب از روش‏های جدید و رو به جلو در تحقیقات روی بیماریهای مخرب عصبی هم‏چون پارکینسون است و بدین منظور انتقال از طریق وکتورهای لنتی ویروسی از پرکاربردترین و مطلوب ترین روش‏ها می‏باشد.

هدف از مطالعه حاضر، بررسی پتانسیل فاکتور Nurr1(Nuclear receptor related protein 1) که قبلا خاصیت ضدالتهابی آن در سلول‏های میکروگلیا و آستروگلیا از طریق سرکوب بیان آن به اثبات رسیده(11) و نیز فاکتورGDNF (Glial cell line derived neurotrophic factor)، که اثر ترمیمی آن بر نورون‏های دوپامین­ساز در بیماری پارکینسون اثبات شده است (12-15)، به صورت توام بر حفاظت نورون‏های دوپامین ساز می­باشد. وجود ارتباط بین دو فاکتور Nurr1 و GDNF (تنظیم بیان ژن گیرنده­ی GDNF (رسپتورRet) توسط  Nurr1) (16 و 17)، عدم بررسی اثر بیش­بیان فاکتور Nurr1 بر نورون‏های دوپامین ساز و نیز عدم کاربرد توام این دو فاکتور برای بررسی التهاب عصبی در نورون‏های دوپامین­ساز، اهمیت و ضرورت تحقیق حاضر را مشخص می‏سازد. به این منظور فاکتورهای مزبور از طریق وکتورهای لنتی ویروسی، به‏ترتیب در سلول‏های نورونی دوپامین‌ساز و سلول‏های آستروسیتوما بیش بیان شدند و از طرف‌دیگر سلول‏های میکروگلیا جداسازی و به‏عنوان منبع فاکتورهای پیش‌التهابی مورد استفاده قرار گرفتند. همچنین از توکسین6-OHDA(6-hydroxydopamine) به‏عنوان منبع استرس اکسیداتیو استفاده شد. این توکسین که آنالوگ دوپامین می‏باشد از طریق رسپتور DAT(dopamine transferase) جذب سلول نورونی شده و سپس با تبدیل شدن به رادیکال‏های آزاد و نیز تداخل در زنجیره تنفسی میتوکندری منجر به نارسایی آن و ایجاد استرس اکسیداتیو در سلول می‏شود (18-20). نتایج ما نشان داد که دو فاکتورNurr1و GDNF هم به تنهایی و هم به‏صورت توأم با اثر هم افزایی، سلول‏های دوپامین‌ساز را در مقابل فاکتورهای التهابی و نیز استرس اکسیداتیو به‏میزان قابل ملاحظه‌ای، در مقایسه با سلول‏های شاهد، محافظت می‏کنند.

 

مواد و روش‏ها

محلول 2X HBS(HEPES Buffered Saline) برای ترانسفکشن:این محلول طبق روشمذکور در گزارش قبلی گروه ما (21) تهیه و پس از استریل کردن با فیلتر 2/0 میکرومتر برای ماندگاری بیشتر در دمای 20- درجه سانتی‏گرادنگه‏داری شد.

محلول :(3-(4, 5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide) MTTاین محلول در غلظت 5 میلی‏گرم بر میکرولیتربا حل کردن پودر MTT (ساخت شرکت سیگما آلمان) در PBS و سپس استریل کردن با فیلتر 2/0 میکرومتر، تهیه و برای ماندگاری طولانی مدت در دمای 20-درجه سانتی‏گرادنگه‏داری شد.

محلول گریس (Griess): شامل دو محلول A و B می‌باشد. محلول A : مقدار 5/0 گرم از پودر سولفانیل­آمید (sulfonyl amide) در50 میلی‏لیتر اسیدفسفریک 5 درصد حل و برای ماندگاری طولانی مدت در یخچال نگه‏داری شد.محلول B: مقدار 50 میلی گرم از پودر NED (N-1-naphthylethylenediamine dihydrochloride)  در 50 میلی‏لیتر آب تزریقی حل و برای ماندگاری طولانی مدت در یخچال نگه‏داری شد.

 :(Lipopolysaccaride) LPSپودر لیپوپلی­ساکارید (L8274) (ساخت شرکت سیگما آلمان)، غلظت اولیه 1 میلی‏گرم بر میلی‏لیتر­ از آن در بافر نمکی فسفات (PBS) تهیه و از طریق فیلتراسیون با فیلتر 2/0 میکرلیتر استریل و برای نگه‏داری طولانی­مدت در 20- درجه سانتی‏گرادنگه­داری شد.

روش‏های سلولی و مولکولی

تهیه­ی سلول‏های مخلوط گلیال و جداسازی سلول‏های میکروگلیا:این کار عینا مطابق گزارش قبلی ما انجام شد (22). به‏طور خلاصه مغز نوزادان رت 1 تا 3 روزه جداسازی و پس از برداشتن پرده­ مننژ و خرد کردن بافت مغز، در محیطDMEMDolbeco Modified Eagle Medium)) حاوی 10 درصد FBS(Fetal Bovine Serum) و 1 درصد آنتی­بیوتیک Pen/Strep(Penicillin/Streptomycin)، هر سه ساخت شرکت GIBCOآمریکا، در انکوباتور 37 درجه سانتی‏گراد وCO2،5 درصد کشت داده شدند.پس از 10 الی 13 روزسلول‏های معلق یا نیمه­چسبیده، میکروگلیا، با شیک دستی فلاسک­ها از دیگر سلول‏های گلیال جدا و پس از شمارش به تعداد 104×8 سلول در هر چاهک از پلیت 24 خانه­ای جدید کشت داده شدند.

فعال­سازی سلول‏های میکروگلیا: سلول‏های میکروگلیا 24 ساعت پس از جداسازی از سلول‏های مخلوط گلیال، در معرض غلظتهای نهایی 1 و 10 میکروگرم بر میلی‏لیتر از LPS قرار گرفته و به‏مدت 48 ساعت با آن انکوبه شدند. سپس محیط مشروط این سلول‏ها جمع­آوری و با هدف ذخیره­سازی طولانی­مدت در  20-درجه سانتی‏گرادنگه­داری شد.

تست گریس: برای تایید فعال­سازی سلول‏های میکروگلیا، میزان NO (Nitric Oxide) تولیدی با استفاده از تست رنگ‏سنجی گریس مورد سنجش قرار گرفت. 50 میکرولیتر از محیط مشروط سلول‏های میکروگلیا جدا و به‏صورت سه بار تکراربه میکروپلیت 96­ خانه­ای منتقل شد، سپس محلول­های A و B مخصوص تست گریس به حجم 50 میکرولیتر به آن اضافه و در آخر میزان NO موجود در این محیط، با سنجش میزان جذب آن در طول موج 540 نانومتربا دستگاه ELISA reader تعیین شد.

ترانسفورماسیون باکتریهای مستعد با ناقل­های پلاسمیدی و استخراج پلاسمید در سطح انبوه:باکتری E.coli سویه­ی DH5α  مستعد، به‏عنوان باکتری میزبان جهت تکثیر ناقل‏های پلاسمیدی استفاده شد. باکتری‏های مزبور با استفاده از روش شوک حرارتی، با پلاسمیدهای ترانسفر (pLV-EGFP ، pLV-hNurr1-EGFP ، pLV-mGDNF-Jred) و پلاسمید پوشش ویروسی (pLTR-G) و نیز پلاسمید بسته بندی (pCDNL-BHDDD) به‏طور جداگانه ترانسفورم شدند.پس از اطمینان از صحت انجام ترانسفورماسیون، پلاسمیدهای مزبور به‏روش استخراج پلاسمید در مقیاس انبوه ( (Maxi prep با استفاده از کیتکیاژنطبق دستورالعمل سازنده استخراج و برای نگه‏داری طولانی مدت در دمای 20- درجه سانتی‏گراد حفظ شدند(21).

کشت رده های سلولی:رده­­ی سلول‏های نورونی دوپامین­ساز SH-SY5Y (ATCC CRL-2266)، رده­ی سلولی آستروسیتوما (1321N1 Human Astrocytoma cell line.European collection of cell culture) و رده­ی سلولی (ATCC CRL-11268) HEK-293T از بانک سلولی انستیتو پاستور ایران خریداری و طبق شرایط مذکور در کشت سلول‏های مخلوط گلیال، کشت داده شدند.

ترانسفکشن سلول‏های HEK-293T با پلاسمیدهای مربوطه با هدف تولید لنتی­ویروس‏های نوترکیب: این مرحله مشابه روش مذکور در گزارشات قبلی ما انجام شد (23 و 24). به‏طور خلاصه 16 میکروگرم از هر یک از ناقلین ترانسفر، به‏طور جداگانه، با  12 میکروگرم  ناقل بسته­بندی و 10 میکروگرم ناقل غشایی ترکیب و سپس 50 میکرو لیتر از 5/2 مولCaCL2 به آن‏ها اضافه و در نهایت تا حجم نهایی 500 میکرولیتر به آن‏ها آب تزریقی اضافه و با ورتکس و اسپین کاملا با هم مخلوط شدند. سپس500 میکرولیتراز محلول 2X HBS به آن اضافه و پس از 20 الی30 دقیقه انکوبه شدن در دمای اتاق، به سلول‏های HEK-293Tبه‏صورت قطره قطره اضافه شد. پس از 12 الی 15 ساعت محیط سلول‏ها تعویض ودر نهایت24، 48 و 72 ساعت پس از آن، عکس­برداری فلوئورسنت از سلول‏ها انجام و محیط آن‏ها به‏عنوان محیط حاوی ذرات لنتی‏ویروسی نوترکیب جمع­آوری و در دمای4 درجه سانتی‏گراد نگه­داری شد.

تغلیظ لنتی­ویروس­های نوترکیب:محیط حاوی لنتی‌ویروس­های نوترکیب، در ابتدا به‏منظور ته نشین شدن بقایای سلولی مرده، در دمای 4 درجه سانتی‏گراد به‏مدت 10 دقیقه با دور rpm2000سانتریفیوژ و سپس از فیلتر 45/0 میکرومتر عبور داده شد و در آخر به ستون‏های  تغلیظ پروتئین آمیکون (ساخت شرکت Millipor، آلمان) با سایز منافذ  KD100منتقل و در آن به‏مدت 15 الی 20 دقیقه با دور  rpm3500 در دمای 4 درجه سانتی‏گراد سانتریفیوژ شد تا زمانی‏که محیط اولیه به‏میزان 50 الی 60 برابر تغلیظ شد.

تعیین تیتر لنتی­ویروس­های نوترکیب:سلول‏هایHEK-293T به‏دلیل دارا بودن قابلیت بالا برای آلوده شدن به ذرات ویروسی، به‏منظور تعیین واحد ترانسداکسیون در میلی­لیتر (TU/ml) استفاده شدند. به‏طور خلاصه سلول‏های مزبور به تعداد 105 3 در چاهک از پلیت 6 خانه­ای کشت و پس از 24 ساعت، استوک­ تغلیظ شده­ لنتی­ویروس­ نوترکیب pLV-EGFP با نسبت­های رقیق شده 2، 4 ، 10، 20 و 40 برابر در  DMEMو با حجم 100 میکرولیتر، به محیط آن‏ها اضافه و به‏مدت 24 ساعت با آن انکوبه شدند. پس از گذشت 48 ساعت، عکس­برداری فلوئورسنت از سلول‏ها صورت گرفت و در آخر میزان فلوئورسنت حاصل از بیان ترانس­ژن EGFP در نمونه­ها، با فلوسایتومتری سنجش و با استفاده از فرمول روبرو میزان TU/ml محاسبه شد:  TU/ml = (F N D 1000)/V کهF درصد سلول‏های GFP+،  Nتعداد سلول‏ها در لحظه­ ترانسداکسیون، D ضریب رقت ویروس و V حجم ویروس اضافه شده به هر نمونه می‏باشد(25 و 26). در آخر به‏منظور ترانسداکسیون سلول‏های هدف، از معیار MOI(Multiplicity of infection)که معادل است با تعداد ذرات ویروسی و تعداد سلول‏ها استفاده شد.

ترانسداکسیون سلول‏های هدف با ناقل­های لنتی‌ویروسی نوترکیب:رده­ی سلولی  SH-SY5Y 24 ساعت قبل از ترانسداکسیون به تعداد 105 2 در چاهک در پلیت 6 خانه­ای کشت داده شد. سلول‏های کنترل به‏صورت دست نخورده، اما چاهک‏های سلولی­ دیگر به‏صورت دوبار تکرار به ترتیب با لنتی­ویروس­های نوترکیب pLV-EGFP (به‏عنوان کنترل منفی) و  pLV-hNurr1-EGFP (به‏منظور افزایش بیان ژن Nurr1) با نسبتMOI = 120ترانسداکت شدند. سلول‏های آستروسیتوما نیز به‏همین روش تهیه و به‏ترتیب با لنتی­ویروس­های نوترکیب pLV-EGFP (به‏عنوان کنترل منفی) و  pLV-mGDNF-Jred  (به‏منظور افزایش بیان فاکتور GDNF) با نسبتMOI = 120 آلوده­ شدند. 24 ساعت پس از ترانسداکسیون محیط سلول‏ها تعویض و به‏دنبال آن، 48 و 72 ساعت پس از ترانسداکسیون بیان ترانس­ژن‏های EGFP و Jred با میکروسکوپ فلوئورسنت مورد بررسی قرار گرفت. همچنین 72 ساعت پس از ترانسداکسیون، محیط مشروط سلول‏های آستروسیتوما به‏عنوان محیط حاوی فاکتور GDNF جمع­آوری و در دمای  20- درجه سانتی‏گراد نگه­داری شد.

ترانسفکشن سلول‏های HEK-293T با هدف افزایش بیان :GDNFبه‏منظور تولید مقادیر انبوهی از فاکتورGDNF، علاوه برترانسدوکسیون سلول‏های آستروسیتوما، از ترانسفکشن سلول‏های HEK-293Tنیز استفاده شد. 24 ساعت قبل از ترانسفکشن، سلول‏های مزبور به تعداد 106×5/2 در سه پلیت­ 10 سانتی‏مترتهیه و سپس به‏ترتیب به‏صورت دست نخورده به‏عنوان کنترل، ترانسفکت با 25 میکروگرم از ناقل pLV-EGFP (به‏عنوان کنترل منفی) و ترانسفکت با 25 میکروگرم از ناقل  pLV-mGDNF-Jred (به‏منظور افزایش بیان GDNF) تیمار شدند. 24، 48 و 72 ساعت پس از ترانسفکشن عکس­برداری فلوئورسنت انجام و در نهایت محیط مشروط سلول‏ها در روزهای دوم و سوم پس از ترانسفکشن به‏عنوان محیط حاوی GDNF جمع­آوری و در دمای 20- درجه سانتی‏گراد نگه­داری شد.

تعیین دوز کشنده­ی محیط مشروط میکروگلیا و توکسین 6-OHDA:به‏منظور تعیین میزانLD50 (Lethal Dose 50 )محیط مشروط میکروگلیا و توکسین 6-OHDA، سلول‏های SH-SY5Y به تعداد 103×4 در هر چاهکمیکروپلیت 96 خانه­ای کشت و پس از 24 ساعت با مقادیر حجمی10، 20، 40، 60، 80 و 100 میکرولیتر از محیط مشروط میکروگلیا و نیز به‏طور جداگانه با غلظت­های 25/0، 375/0، 5/0، 75/0 و 1میلی مولار از توکسین6-OHDA تیمار و به‏مدت 48 ساعت با این محیط انکوبه شدند. میزان بقای سلول‏ها با استفاده از تست MTT مورد سنجش قرار گرفت. در این تست،MTT که یک نمک تترازولیوم و محلول در آب است در اثر احیا شدن در میتوکندری فعال یک سلول زنده به کریستال­های نامحلول فورمازان تبدیل شده و سپس این کریستال­ها در یک حلال غیر قطبی مانند DMSO(Dimethyl sulfoxide) حل و تولید یک محلول بنفش رنگ می­کنند. هر چه سلول‏های زنده­ی بیشتری موجود باشد مقدار بیشتری از  MTT احیا و کریستال‏های فورمازان بیشتری تولید و به‏دنبال آن شدت رنگ بنفش حاصل از حل شدن این کریستال­ها نیز بیشتر خواهد بود. میزان غلظت رنگ مزبور با استفاده از دستگاه ELISA reader در طول مو­ج‏های 580 و 620 نانومتر نعیین می‏شود.

تیمار سلول‏های SH-SY5Y با محیط مشروط سلول‏های  HEK-293Tو محیط مشروط میکروگلیا:سلول‏های SH-SY5Y کنترل، آلوده شده با لنتی­ویروس EGFP و آلوده­ شده با لنتی­ویروس Nurr1، به تعداد 103×4 در چاهک در میکروپلیت­ 96 خانه­ای کشت و پس از 24 ساعت با 100 میکرولیتراز محیط مشروط سلول‏های  HEK-293Tترانسفکت نشده، ترانسفکت شده با ناقل پلاسمیدی pLV-EGFP و ترانسفکت شده با ناقل پلاسمیدی pLV-mGDNF-Jred (حاوی فاکتور GDNF) تیمار و 24 ساعت با آن انکوبه و در آخر با دوز کشنده­ی محیط مشروط میکروگلیا تیمار و به‏مدت 48 ساعت دیگر با آن انکوبه شدند. در آخر میزان بقای سلولی با استفاده از تست MTT سنجیده شد.

تیمار سلول‏های SH-SY5Y با محیط مشروط سلول‏های  HEK-293Tو توکسین 6-OHDA:این تیمار نیز عینا مطابق روشمذکور در بخش قبل روی سلول‏های SH-SY5Y انجام شد.با این تفاوت که اینجا سلول‏ها به‏جای محیط مشروط میکروگلیا، با دوز کشنده­ی توکسین 6-OHDA به‏مدت 24 ساعت تیمار شدند.

استخراج RNA وRT-PCR : از تمامی سلول‏های آلوده­ شده با لنتی­ویروس­های مزبور، سلول‏های ترانسفکت شده با هدف تولید فاکتور GDNF و سلول‏های میکروگلیا پس از انجام تیمارهای موردنظر، استخراج RNA با استفاده از کیتRNX-Plus  (ساخت شرکت سیناژن) طبق دستورالعمل سازنده انجام گرفت. پس از سنجش غلظت نمونه­های  RNAبا دستگاه نانودراپ، مقدار 2 میکروگرم از هر یک از آن‏ها به‏منظور تهیه­cDNA، با استفاده از کیتRevertAidTM First  Strand cDNA Synthesis  (ساخت شرکت فرمنتاز) طبق دستورالعمل سازنده استفاده شد. در آخر پرایمرهای اختصاصی برای ژن­های  GAPDH(Glycer Aldehyde Phosphate Dehydrogenase) به‏عنوان کنترل، (Tumor Necrosis Factor-α) TNF-α، iNOS (inducible Nitric Oxide Synthase )، Nurr1 ،GDNF، (Gluthatione peroxidase 1) GPX1،SOD1 (SuperOxide Dismutase1) ، p53 و BCL2 به‏منظور بررسی سطح بیان ژن‏های مزبور در سلول‏های مربوطه، به‏شرح زیر مورد استفاده قرار گرفت:

GAPDH:

Forward:5'-CCCCCAATGTATCCGTTGTG-3'

Reverse:5'-TAGCCCAGGATGCCCTTTAGT-3'

TNF-α:

Forward: 5'-GCTCCCTCTCATCAGTTCCA-3'

Reverse:5'-TTGGTGGTTTGCTACGACC-3'

iNOS:

Forward:5'-GACATCGACCAGAAGCTGTC-3'

Reverse:5'-GGGCTCTGTTGAGGTCTAAAG-3'

Nurr1:

Forward: 5'-CGACATTTCTGCCTTCTCCT-3'

Reverse:5'-GAAAGGTAAGGTGTCCAGGA-3'

GDNF:

Forward: 5' -CACCAGATAAACAAATGGCAGTGC-3'

Reverse: 5'-CGACAGGTCATCATCAAAGGCG-3'

GPX1:

Forward: 5'-CTTATCGAGAATGTGGCGTCCC -3'

Reverse: 5'-GCCCACCAGGAACTTCTCAAAG -3'

SOD1:

Forward: 5'- AGGGCATCATCAATTTCGAG -3'

Reverse: 5'- TGCCTCTCTTCATCCTTTGG -3'

P53:

Forward: 5'- CCCCTCCTGGCCCCTGTCATCTTC -3'

Reverse: 5'- GCAGCGCCTCACAACCTCCGTCAT -3'

BCL2:

Forward: 5'- CTGCACCTGACGCCCTTCACC -3'

Reverse: 5'- CACATGACCCCACCGAACTCAAAGA -3

آنالیز آماری:

داده‏های به‏دست آمده نتیجه سه آزمایش مجزا است که هر کدام به‏صورت تریپلیکیت انجام شدند. آنالیز آماری داده­ها با استفاده از نرم­افزار SPSS version 16 انجام گرفت و برای آنالیز تفاوت بین گروه­های مختلف سلولی، از آنالیز یک سویه­ی واریانس (One-way analysis of variance, ANOVA) و تست دانکن (post-hoc Duncan Multiple-comparisons Test)استفاده شد. ارزش 05/0p< به‏صورت معنی­دار و ارزش­01/0p< به‏صورت بسیار معنی­دار تفسیر شد.

 

نتایج

جداسازی و کشت موفقیت­آمیز سلول‏های مخلوط گلیال

پس از گذشت 11 روز از کشت سلول‏های مخلوط گلیال و عکس­برداری متوالی از آن‏ها، نتایج حاصله در شکل 1 گزارش شده است.بیش از 80 درصد این کشت مخلوط را سلول‏های آستروسیت به‏خود اختصاص می‏دهند که ظاهری مکعبی شکل دارند  و بیشترین بخش زمینه عکس را به‏خود اختصاص داده اند. سلول‏های الیگودندروسیت ظاهری ستاره ای شکل دارند و سلول‏های میکروگلیا به‏صورت سلول‏های گرد و شفاف با اتصالات سست در سطحی­ترین بخش کشت و روی لایه­های آستروسیت قرار گرفته اندکه با شیک دستی فلاسک‏ها قابل جداسازی هستند.

 

 

شکل 1: سلول‏های مخلوط گلیال روز اول (A)، روز پنجم (B) و روز یازدهم (C) پس از جداسازی از مغز.بزرگنمایی : 100X

 

فعال­سازی وتغییر مورفولوژیک در سلول‏های میکروگلیا با تیمار LPS

سلول‏های میکروگلیا 24 ساعت پس از جداسازی با استفاده از میکروسکوپ فاز کنتراست مورد تصویربرداری قرار گرفتند. این تصاویر ظاهر دوکی شامل سلول‏های فوق را نشان می‏دهد (شکل 2، A,C). همچنین تصویر سلول‏های مزبور بعد از تیمار با LPS به مدت 48 ساعت جمع آوری شد که در این فرایند تغییر مورفولوژیک آن‏ها از فرم دوکی  به‏فرم آمیبی شکل (ameboid) نمایان می‏باشد.

(شکل 2، B,D). گرم بر میلی‏لیتر لیپوپلی ساکارید (LPS)  نشان می‏دهد (B,D). سلول‏های میکروگلیا در حالت غیرفعال ظاهری دوکی شکل و منشعب دارند اما زمانی که فعال می‏شوند، مثل سلول ماکروفاژی فعال شده به‏روش کلاسیک که توانایی تولید سیتوکین‏های التهابی و ایجاد انفجار تنفسی را دارد، فرمی متورم و تخم مرغی شکل می‏گیرند که این پدیده در شکل 2 نیز کاملا مشهود است و فعال شدن سلول‏های میکروگلیا را پس از تیمار  با لیپوپلی ساکارید LPS)) تایید می‏کند.

 

 

 

شکل2: سلول‏های میکروگلیا قبل (A) و بعد از تیمار(B) با 1 میکروگرم بر میلی‏لیتر لیپوپلی ساکارید ( ( LPS. قبل (C) و بعد از تیمار(D) با 10 میکروگرم بر میلی‏لیتر LPS به‏مدت 48 ساعت. بزرگنمایی: × 200

 

تولید نیتریک اکسید(NO) توسط میکروگلیای تیمار شده باLPS

تست گریس طبق دستورالعمل ارائه شده در بخش مواد و روش­ها انجام شد که نتیجه­ی آن در شکل 3 ارائه شده است. علامت­*** اختلاف بسیار معنی­دار (01/0p<) نمونه­های تیمار شده با لیپوپلی ساکارید (LPS) را در مقایسه با نمونه­ کنترل نشان می‏دهد، درحالی‏که اختلاف بسیار معنی­دار (01/0p<) نمونه تیمار شده با لیپوپلی ساکارید (LPS) 10µg/ml در مقایسه با نمونه تیمار شده با لیپوپلی ساکارید (LPS) 1µg/ml، با علامت ## نشان داده شده است. همان‏طور که از نمودار پیداست میزان نیتریک اکسید (NO) تولیدی از نمونه­های تیمار شده با LPS، بسیار بیشتر از نمونه­ی کنترل (تیمار نشده) است که تاییدی بر القای بیان ژن iNOS در سطح پروتئین، در نمونه­های تیمار شده میباشد. همچنین میزان NO تولیدی از نمونه­ی تیمار شده با 10µg/ml LPS، بیشتر از نمونه­ی تیمار شده با LPS 1µg/ml است. پس این تست نیز فعال شدن سلول‏های میکروگلیا را پس از تیمار با LPS اثبات می‏کند.

 

 

شکل3: تست گریس. تیمار سلول‏های میکروگلیا با لیپوپلی ساکارید  0µg/m l( LPS)(کنترل- ستون چپ)، LPS1µg/ml (ستون وسط) و لیپوپلی ساکارید ((LPS10µg/ml (ستون راست) و سنجش میزان NO تولیدی توسط سلول‏های مزبور. علامت­*** اختلاف بسیار معنی­دار (01/0p<) نمونه‏های تیمار شده با لیپوپلی ساکارید LPS)) رادر مقایسه با نمونه­ کنترل نشان می‏دهد، درحالی‏که اختلاف بسیار معنی­دار (01/0p<) نمونه تیمار شده با لیپوپلی ساکارید ((LPS10µg/ml در مقایسه با نمونه تیمار شده با LPS1µg/ml، با علامت ##  نشان داده شده است.

 

بیان ژن­های التهابی توسط سلول‏های میکروگلیای فعال­ شده

در روند فعال شدن میکروگلیا، فاکتورهای التهابی بیان می‏شوند که با استفاده از تکنیکRT-PCR، بیان ژنGAPDH (به‏‏عنوان کنترل) و ژن­های التهابیiNOS و TNF-α ردیابی شد که نتیجه آن در شکل 4 قابل مشاهده است.سنجش کمی شدت باندهای مربوطه با نرم­افزار GelAnalyzer 2010a نشان داد که میزان بیان ژن TNF-α در نمونه­های تیمار شده با مقادیر1 و 10 میکروگرم بر میلی‏لیترازLPS نسبت به این میزان در نمونه­ی کنترل، به‏ترتیب 97 و 105 برابر می­باشد. همچنین میزان بیان ژن iNOS در نمونه­های تیمار شده با 1 و10 میکروگرم بر میلی‏لیتر از LPS نسبت به این میزان در نمونه­ی کنترل، به‏ترتیب 25 و 200 برابر می‏باشد. نتایج مربوطه در شکل 5 آمده است. علامت‏های ** و *** اختلاف بسیار معنی­دار (01/0p<) میزان بیان ژن iNOS را در گروه­های دوم و سوم نسبت به گروه­ کنترل نشان می­دهد، در حالی‏که علامت ##  اختلاف بسیار معنی­دار (01/0p<) میزان بیان ژن TNF-a را در گروه­های دوم و سوم نسبت به گروه کنترل نشان می­دهد. (این شکل بنا به درخواست داور اول اضافه شد و به این ترتیب به شماره عکسهای پس از آن یک واحد اضافه شد).

 

 

 

 

شکل 4. محصولات PCR  ژن­های GAPDH ،TNF-α  و iNOS با پرایمرهای اختصاصی. در هر کدام به ترتیب از چپ به راست: میکروگلیای شاهد (تیمار نشده)، میکروگلیای تیمار شده باLPS1µg/ml و میکروگلیای تیمار شده با LPS10µg/ml

 

 

شکل 5. آنالیز کمی میزان بیان ژن­های GAPDH،TNF-  و  iNOSدر نمونه کنترل (گروه اول- سمت چپ)، نمونه تیمار شده با  1  ازلیپوپلی ساکارید ( LPS) (گروه دوم- وسط) و نمونه تیمار شده با   10 ازLPS (گروه سوم- سمت راست).علامت­های ** و *** اختلاف بسیار معنی­دار (P<0.01) میزان بیان ژن iNOS را در گروه­های سوم و دوم نسبت به گروه­ کنترل نشان می­دهد، در حالی‏که علامت ##  اختلاف بسیار معنی­دار (P<0.01) میزان بیان ژن TNF-a را در گروه­های دوم و سوم نسبت به گروه کنترل نشان می­دهد

 

 

 

 

شکل 6: پلاسمیدهای استخراج شده در مقیاس بالا

1-   مارکر یک کیلو بازی(GeneRuler)

2-   پلاسمید بسته بندی(pCDNL-BHDDD)- 9.6 kb

3-   پلاسمید پوشش ویروسی(pLTR-G)-6.8 kb

4-   پلاسمید ترانسفر pLV-EGFP10.5 kb

5-   پلاسمید ترانسفر pLV-hNurr1-EGFP12.9 kb

6-   پلاسمید ترانسفر  pLV-mGDNF-Jred - 10.7 kb

 

میزان LD50 محیط مشروط میکروگلیا و توکسین 6-OHDA

نتایج حاصل از این تست به‏ترتیب 100 میکروگرم بر میلی‏لیتر برای محیط مشروط میکروگلیای تیمار شده با 10 میکروگرم بر میلی‏لیتر LPS  و غلظت نهایی 5/0 میلی‏مول برای توکسین 6-OHDAبه‏دست آمد.

 

تهیه و انبوه سازی ناقل های پلاسمیدی به‏صورت خالص

ناقل‏های پلاسمیدی موردنیاز برای ترانسفکشن و تهیه وکتورهای لنتی ویروسی نوترکیب، تخلیص و انبوه سازی شدند که نتایج آن‏ پس از الکتروفورز نمونه ها روی ژل آگاروز 7/0 درصد، در شکل 6 قابل مشاهده است.

 

 

تولید  لنتی ویروس­های نوترکیب در سلول‏های HEK-293T

شکل­های 7 و 8  بیان ژن گزارش‏گر EGFP را به‏ترتیب توسط ناقل لنتی­ویروسی pLV-EGFP و pLV-hNurr1-EGFP در سلول‏های HEK-293T، 24 و 48 ساعت پس از ترانسفکشن نشان می‏دهند. همچنین شکل 9 نمایانگر بیان ژن گزارش‏گر Jred توسط ناقل لنتی­ویروسی pLV-mGDNF-Jred در 24 و 48 ساعت پس از ترانسفکشن است. با توجه به این‏که ژن گزارش‏گر به‏وسیله توالی IRES در کنار ترانسژن مربوطه در فرودست آن قرار دارد، پس تایید بیان بالای آن توسط میکروسکوپ فلوئورسنس (که در تصاویر B و D از شکلهای 7 الی 9 کاملا مشهود است) یقینا نشان از بیان مطلوب ترانسژن و نیز تولید ذرات لنتی ویروسی نوترکیب با کارایی بالا، در سلول‏های مولد ویروس دارد.

 

 

شکل 7: تصاویر فاز کنتراست و فلوئورسنت از سلول­های HEK-293T کوترانسفکت شده با پلاسمید ترانسفر pLV-EGFP و پلاسمیدهای بسته‌بندی و پوشش ویروسی: 24ساعت (A,B) و 48 ساعت (C,D) پس از ترانسفکشن. بیان بالای ژن گزارشگرEGFP کاملا در تصاویرB و D مشهود است. بزرگنمایی: ×100.

 

 

 

 

شکل 8: تصاویر فاز کنتراست و فلوئورسنت از سلول­های HEK-293T کوترانسفکت شده با پلاسمید ترانسفر pLV-hNurr1-EGFP و پلاسمیدهای بسته بندی و پوشش ویروسی: : 24ساعت (A,B) و 48 ساعت (C,D) پس از ترانسفکشن. بیان بالای ژن گزارشگرEGFP کاملا در تصاویرB و D مشهود است بزرگنمایی: ×100.

 

 

شکل 9: تصاویر فاز کنتراست و فلوئورسنت از سلول­های HEK-293T کوترانسفکت شده با پلاسمید ترانسفر pLV-mGDNF-Jred و پلاسمیدهای بسته بندی و پوشش ویروسی : 24ساعت (A,B) و 48 ساعت (C,D) پس از ترانسفکشن. . بیان ژن گزارشگر Jredکاملا در تصاویرB و D مشهود است بزرگنمایی: ×100

 

 

تیتراسیون لنتی ویروس‏های نوترکیب

لنتی­ویروس‏های نوترکیب طبق روش مذکور در بخش مواد و روشها تعیین غلظت شدند که مقدار میانگین آن،184×106 TU/ml برای لنتی ­ویروس نوترکیب pLV-EGFP به‏دست آمد. با توجه به یکسان بودن شرایط  

 

 

آزمایش در تولید هر سه نوع لنتی­ویروس نوترکیب، مقدار مذکور برای لنتی­ ویروس­های دیگر نیز مورد استفاده قرار گرفت. نتایج حاصل از فلوسایتومتری در شکل 10 قابل مشاهده است.

 

 

 

 

شکل 10 : سنجش میزان فلوئورسنت به روش فلوسایتومتری. به‏ترتیب از چپ به راست: سلول­های  HEK-293Tترانسدوکت شده با نسبت­های 2، 4، 10، 20 و 40 برابر رقت از استوک لنتی ویروسنوترکیب pLV-EGFP

 

 

 

ترانسداکسیون سلول‏های HEK-293T و سلول‏های هدف با لنتی ویروس‏های نوترکیب

بیان ترانسژن‏های گزارش‏گر در سلول‏های ترانسداکت شده، نشان از صحت تولید ویروس‏ها و قابلیت آلوده کنندگی آن‏ها دارد. بدین منظور در بدو امر سلول‏های HEK-293T به‏عنوان سلول‏های کنترل (به‏دلیل قابلیت بالای آن‏ها در آلوده شدن به‏وسیله ویروس‏ها) با لنتی‌‌ویروس‏های نوترکیب آلوده شدند که نتایج آن همان‏طور که در تصاویر B وD و Fاز شکل 11 مشهود است، کاملا نشان از صحت تولید لنتی ویروس‏های نوترکیب و قابلیت آن‏ها در آلوده­سازی سلولهای HEK-293T دارد. پس از اطمینان از صحت تولید لنتی ویروس‏های نوترکیب، اینبار سلول‏های SH-SY5Y و سلول‏های آستروسیتوما با لنتی ویروس­های مربوطه آلوده شدند که نتایج آن به‏ترتیب در شکل‏های 12، 13 و 14 آمده است. همان‏طور که از شکل‏های 12 و 13 پیداست سلول‏های SH-SY5Y در حد مطلوبی توسط ویروس‏های مربوطه آلوده شده­اند، در حالی‏که سلول‏های آستروسیتوما پاسخ‏دهی مناسبی به ویروس نداشته­اند و سطح ترانسداکسیون در آن‏ها بسیار پایین بوده است (شکل 14). به‏همین دلیل پس از آن، از ترانسفکشن مستقیم سلول‏های HEK-293T به منظور تولید انبوه فاکتور GDNF استفاده شد.

 

 

شکل 11: تصاویر فاز کنتراست و فلوئورسنت از سلولهایHEK-293Tترانسدوکت شده با لنتی ویروس‏های نوترکیب pLV-EGFP (A,B) ، pLV-hNurr1-EGFP (C,D) و pLV-mGDNF-Jred (E,F) 48 ساعت پس از ترانسدوکسیون. بیان بالای ژنهای گزارشگر در سلول‏های ترانسدوکت شده کاملا در تصاویر B وDو Fمشهود است که نشان از صحت تولید لنتی ویروس‏های نوترکیب و قابلیت آنها در آلوده­سازی سلولهای HEK-293T دارد.بزرگنمایی : ×100.

 

 

 

 

شکل 12:  تصاویر فاز کنتراست و فلوئورسنت از سلول­های SH-SY5Y ترانسدوکت شده با لنتی ویروس نوترکیب pLV-EGFP . 48 ( A,B) و 72 ساعت (C,D) پس از ترانسدوکسیون. . بیان مطلوب ژن گزارش‏گر EGFP در سلو‏‏ل‏های ترانسدوکت شده کاملا در تصاویر B وDمشهود است. بزرگنمایی: ×100.

 

شکل 13: تصاویر فاز کنتراست و فلوئورسنت از سلول­های SH-SY5Y ترانسدوکت شده با لنتی­ویروس نوترکیب pLV-hNurr1-EGFP . 48ساعت(A,B) و 72 ساعت (C,D) پس از ترانسدوکسیون. . بیان ژن گزارش‏گر EGFP در سلولهای ترانسدوکت شده، در تصاویر B وDکاملا قابل مشاهده است که نشان از بیان مطلوب ترانسژن hNurr1 دارد. بزرگنمایی: ×100.

 

 

شکل 14: تصاویر فاز کنتراست و فلوئورسنت از سلول­های آستروسیتومای ترانسدوکت شده با لنتی­ویروس نوترکیب pLV-mGDNF-Jred . 48ساعت (A,B) و 72 ساعت (C,D) پس از ترانسدوکسیون. بیان کم ژن گزارشگر  Jredدر تصاویر B وD، نشان از بیان کم و نامطلوب ترانسژنmGDNFدر سلولهای ترانسدوکت شده دارد.  بزرگنمایی: ×100.

 

بیش بیان ژن‏های مورد نظر در سلول‏های ترانسدوکت شده و ترانسفکت شده

بیش­بیان ژنهای Nurr1 و GDNF در سطح mRNA در سلول‏های ترانسدوکت شده، با استفاده از تکنیک RT-PCR بررسی شد که نتایج آن در شکل‏های 15 و 16 آمده است. بیش­بیان ژن‏های مزبور در سلول‏های ترانسدوکت شده با لنتی ویروس‏های حامل این ژن‏ها، در مقایسه با نمونه های کنترل کاملا مشهود است. همچنین بیش بیان ژن GDNF در سلول‏های HEK-293T ترانسفکت شده با ناقل ژن مزبور، با RT-PCR اثبات شد که نتیجه آن در شکل 17 آمده است.از مقایسه شکل‏های 16 و 17چنین نتیجه­گیری می‏شود که میزان بیش بیان ژن GDNF در روش ترانسفکشن سلول‏های HEK-293T بیشتر از بیش­ بیان آن در روش ترانسدوکسیون سلول‏های آستروسیتوما با ناقل لنتی­ویروسی مربوطه است. از این رو در تیمارهای مدنظر از محیط مشروط سلول‏های HEK-293T ترانسفکت شده با ناقل پلاسمیدی حامل ژن GDNF، به‏عنوان محیط حاوی فاکتور GDNF استفاده شد.

شکل 15: محصولات PCR  ژن­های  GAPDH(به‏عنوان کنترل) و Nurr1  با پرایمرهای اختصاصی. در هر گروه به‏ترتیب از چپ به راست: سلول SH-SY5Yکنترل، سلول ترانسدوکت شده با لنتی­ویروس pLV-EGFP و  سلول ترانسدوکت شده با لنتی­ویروس pLV-hNurr1-EGFP. (به توضیحات متن مراجعه شود)                                                  

 

 

 

شکل 16: محصولات PCR  ژن­های GAPDH (به عنوان کنترل)و GDNF   با پرایمرهای اختصاصی. در هر گروه به‏ترتیب از چپ به راست: سلول آستروسیتومای کنترل، سلول ترانسدوکت شده با لنتی­ویروس pLV-EGFP و سلول ترانسدوکت شده با لنتی­ویروس .pLV-mGDNF-Jred(به توضیحات متن مراجعه شود)                                                        

 

 

شکل 17: محصولات PCR  ژن­های GAPDH و GDNF با پرایمرهای اختصاصی. در هر کدام به‏ترتیب از چپ به راست: سلول HEK-293T کنترل، سلول ترانسفکت شده با پلاسمید pLV-EGFP و سلول ترانسفکت شده با پلاسمید pLV-mGDNF-Jred. بیان بالای ژن mGDNF در نمونه ترانسفکت شده با پلاسمید حامل ژن mGDNF در مقایسه با نمونه های کنترل، کاملا مشهود است.

 

حفاظت نورونی  توسط  فاکتورهای Nurr1 و GDNF

نتایج حاصل از تست  MTT، بیانگر تاثیر مثبت بیش ­بیان دو فاکتور Nurr1 و GDNF بر حفاظت سلول‏های SH-SY5Y است که در شکل‏های 18 و 19 قابل مشاهده است. علامت­ **  اختلاف معنی­دار بین نمونه­های موجود در هر گروه را نشان می­دهد. در حالی‏که علامت ## اختلاف معنی­دار هر گروه با گروه قبلی را نشان می­دهد. همچنین اختلاف معنی­دار گروه چهارم با گروه دوم با علامت† نشان داده می­شود. اختلاف معنی دار به‏صورت 05/0p< تعریف شده است. همان‏طور که از نمودارها پیداست، دو فاکتور Nurr1 و GDNF هر کدام به‏تنهایی در حفاظت سلول‏های SH-SY5Y در مقابل فاکتورهای التهابی میکروگلیا و نیز توکسین 6-OHDA نقش دارند. همچنین این دو فاکتور در حالت توام، به‏صورت سینرژیک عمل کرده و اثر حفاظتی بیشتری را بر این سلول‏ها اعمال می­کنند.

 

 

شکل 18: تیمار سلول­های SH-SY5Y شاهد(CTL)، آلوده شده با ویروس pLV-EGFP و آلوده شده با ویروس pLV-hNurr1-EGFP ، با دو فاکتور GDNF (GDNF-CM) و محیط مشروط میکروگلیای فعال شده با LPS (MCM-LPS). علامت­ **  اختلاف معنی­دار بین نمونه­های موجود در هر گروه را نشان می­دهد. در حالی‏که علامت ## اختلاف معنی­دار هر گروه با گروه قبلی را نشان می­دهد. همچنین اختلاف معنی­دار گروه چهارم با گروه دوم با علامت نشان داده می­شود. اختلاف معنی دار به‏صورت p<0.05 تعریف شده است. همانطور که از نمودار مشهود است، دو فاکتور Nurr1 و GDNF هر کدام به تنهایی و نیز به‏صورت توأم در حفاظت سلول‏های SH-SY5Y در مقابل فاکتورهای التهابی میکروگلیا نقش دارند.

 

 

 

 

شکل 19: تیمار سلول­های SH-SY5Y شاهد (CTL)، آلوده شده با ویروس pLV-EGFP و آلوده شده با ویروس pLV-hNurr1-EGFP، با دو فاکتور GDNF (GDNF CM) و توکسین 6-OHDA. علامت­ **  اختلاف معنی­دار بین نمونه­های داخل هر گروه را نشان می­دهد. در حالیکه علامت ## اختلاف معنی­دار هر گروه با گروه قبلی را نشان می­دهد. همچنین اختلاف معنی­دار گروه چهارم با گروه دوم با علامت نشان داده شده است. اختلاف معنی دار به صورت p<0.05 تعریف شده است. همان‏طور که از نمودار مشهود است، دو فاکتور Nurr1 و GDNF هر کدام به‏تنهایی و نیز به‏صورت توأم در حفاظت سلول‏های SH-SY5Y در مقابل توکسین 6-OHDA  نقش دارند.

 

بررسی تغییرات بیان ژنی برای تشخیص مسیرهای سیگنالینگ حفاظتی مربوطه

به‏منظور تشخیص مسیرهای سیگنالینگ احتمالی که در اثر بیش بیان فاکتورهای Nurr1 و GDNF، دست‏خوش تغییر شده و منجر به حفاظت سلول‏های نورونی SH-SY5Y در مقابل فاکتورهای التهابی و استرس اکسیداتیو ناشی از توکسین 6-OHDA می‏شوند، RT-PCR برای دو ژن‏ ضد استرس اکسیداتیو شامل GPX1 وSOD1 و نیز دو ژن کنترل کننده آپوپتوزیس شامل P53 و BCL2 انجام شد که نتایج آن به‏ترتیب در شکل‏های 20 و 21  قابل مشاهده است. همان‏طور که از شکل‏ها پیداست، تغییر محسوسی در بیان این ژن‏ها در مقایسه با سلول‏های کنترل مشاهده نمیشود. با توجه به غیرکمی بودن  RT-PCR معمولی، این تکنیک روش مناسبی برای سنجش میزان تغییرات بیان ژن‏ها نیست و باید از تکنیک quantitative real time-PCR استفاده شود.

 

 

شکل 20: محصولات PCR  ژن­های  GPX1 و SOD1  با پرایمرهای اختصاصی. در هر گروه به‏ترتیب از چپ به راست: سلول SH-SY5Y کنترل، ترانسدوکت شده با لنتی­ویروس pLV-EGFP و ترانسدوکت شده با لنتی­ویروس pLV-hNurr1-EGFP. تغییر محسوسی در بیان ژنهای مزبور در سلول‏های SH-SY5Yترانسدوکت شده با لنتی ویروس pLV-hNurr1-EGFP، در مقایسه با سلول‏های کنترل مشاهده نمی‏شود.

 

 

 

 

شکل 21: محصولات PCR  ژن­های P53 و BCL2با پرایمرهای اختصاصی. در هر گروه به‏ترتیب از چپ به راست: سلولSH-SY5Y کنترل، ترانسدوکت شده با لنتی­ویروس pLV-EGFP و ترانسدوکت شده با لنتی­ویروس pLV-hNurr1-EGFP. تغییر محسوسی در بیان ژن‏های مزبور در سلو‏‏ل‏های SH-SY5Yترانسدوکت شده با لنتی ویروس pLV-hNurr1-EGFP، در مقایسه با سلول‏های کنترل مشاهده نمی‏شود.

 

بحث

حفاظت نورون‏ها در برابر سیگنال­های مرگ یکی از استراتژی­های مهم برای مقابله با بروز و پیشرفت بیماری‌های نورودژنراتیو از جمله پارکینسون به‏شمار می‌رود(27). منابع ایجاد سیگنال­های مرگ را می­توان در دو گروه التهاب عصبی و استرس اکسیداتیو دسته‌بندی کرد. سلول‏های میکروگلیا، ماکروفاژهایCNS، علاوه بر حفاظت عصبی در تکامل عصبی نیز نقش دارند(28). این سلول‏ها در شرایط نرمال مسئول حفاظت و نظارت بر عمل‏کرد نورون‏ها، در حالی‏که در شرایط التهابیمرتبط با بیماری­های مخرب عصبی هستند (29). به‏منظور شبیه‌سازی شرایط التهاب نورونی در محیط in vitro، غالبا از سلول‏های مخلوط گلیال که از مغز نوزادان موش یا رت تهیه شده و غنی از سلول‏های میکروگلیا می‏باشند استفاده می‏شود. در این تحقیق به‏منظور حفاظت نورون‏های دوپامین­ساز SH-SY5Y در مقابل التهاب عصبی حاصل از میکروگلیای فعال و نیز مسمومیت ناشی از 6-OHDA، از بیش بیان دو فاکتور Nurr1 و GDNF بهرهگرفته شد. زیرا اگرچه به ترتیب پتانسیل ضدالتهابی و ترمیمی آن‏ها قبلاً اثبات شده بود، اما در زمان انجام این تحقیق هنوز هیچ مطالعه‌ای در زمینه تاثیر بیش­بیان فاکتور Nurr1 بر حفاظت نورون‏های دوپامین ساز و نیز تاثیر هم‏زمان این دو فاکتور روی این نورون‏ها منتشر نشده بود. نتایج تحقیق ما نشان داد که سلول‏های SH-SY5Yبا بیان فزاینده­ فاکتورNurr1  و یا در حضور فاکتور GDNF، مقاومت قابل ملاحظه ای را در برابر فاکتورهای التهابی میکروگلیا و نیز مسمومیت ناشی از 6-OHDA نشان می‏دهند. همچنین دو فاکتور GDNF و Nurr1 با هم به صورت سینرژیکعمل کرده و مقاومت بیشتری را به سلول‏های نورونی عطا می‏کنند. طبق گزارش‏هایقبلی، سرکوب بیان فاکتورNurr1 در سلول‏های گلیال منجر به ایجاد التهاب می‏شود که بیانگر نقش ضدالتهابی فاکتور است(11). بیان Nurr1نه تنها برای القای تمایزنورون‏های دوپامین­ساز در مغز میانی، بلکه برای حفظ بقای آن‏ها نیز ضروری است(30-34). طبق نتایج ما افزایش بیان این فاکتور در سلول‏های دوپامین­ساز SH-SY5Y، نه تنها اثر منفی ندارد بلکه منجر به حفاظت آن‏ها در مقابل فاکتورهای التهابی و نیز مسمومیت ناشی از توکسین 6-OHDA می‏‏شود. توکسین 6-OHDAبا ایجاد نارسایی میتوکندریایی و استرس اکسیداتیو به مرگ سلولی دامن می‏زند(35) در حالی‏که فاکتور Nurr1 از طریق تنظیم بیان دسته­ای از پروتئین‏های میتوکندریایی کد شونده توسط هسته، همچون­ آنزیمSOD1، به حفظ فسفریلاسیون اکسیداتیو در میتوکندری کمک می‏کند (36). احتمالا افزایش بیان Nurr1 در سلول‏های نورونی منجر به افزایش بیان آنزیم­ مزبور و در نتیجه مقابله با اثرمهاری توکسین 6-OHDAمی‏شود. به علاوهNurr1 در مسیر سیگنالینگ ضداسترس اکسیداتیو وابسته به CREB نیز شرکت دارد(37). احتمالا اثر حفاظتیNurr1 در مقابل6-OHDA، از طریق تحریک هر چه بیشتر این مسیر باشد. بدین منظور میزان بیان دو ژن آنتی اکسیدانتSOD1 و GPX1در سلول‏های نورونی با کمک تکنیکRT-PCR ارزیابی شد اما با توجه به غیر کمی بودن این تکنیک، تغییر محسوسی در بیان ژن‏های مزبور در مقایسه با سلول‏های کنترل مشاهده نشد (شکل 20).

از طرف دیگر نتایج RT-PCR و تست گریس روی سلول‏های میکروگلیا، تولید سطح بالاتری از فاکتورهای التهابی ( iNOS و TNF-α) را در میکروگلیای تیمار شده با 10 میکروگرم بر میلی‏لیترLPS ، نسبت به انواع تیمار شده با 1 میکروگرم بر میلی‏لیترLPS  نشان داد. با توجه به میزان LD50 (100 میکروگرم بر میلی‏لیتراز محیط مشروط میکروگلیای تیمار شده با10 میکروگرم بر میلی‏لیترLPS )، رابطه­ مستقیم سطح فاکتورهای ­التهابی با سطح التهاب عصبی قابل مشاهده است. میکروگلیای فعال انواعی از فاکتورهای التهابی شامل TNF-α، IL-1β، متابولیت­های اسید چرب و رادیکال­های آزاد NO و سوپر اکسید (O2-) را تولید می‏کند (38 و 39). NO که توسط آنزیم iNOS تولید می‏شود، با مهار سیتوکروم اکسیداز تنفس میتوکندریایی را مختل، و نیز در اثر واکنش با O2-  گونه رادیکالی پروکسی نیتریت را تولید می‏کند که به‏شدت به مرگ سلولی ناشی از استرس اکسیداتیو دامن می‏زند (40 و 41). احتمالاً اثر حفاظتی Nurr1 در برابر 6-OHDA ، اینجا نیز در مقابله با NO تولیدی از میکروگلیا به‏کار رفته و در سلول‏های SH-SY5Y مقاومت ایجاد می‏کند.  TNF-αنیز با اثر روی رسپتورش (TNFR1) می‏تواند آپوپتوزیس خارجی را در سلول‏های نورونی القا کند که احتمالا Nurr1 با پتانسیل ضدآپوپتوزیس خود می‏تواند مسیر مزبور را مهار کند. بدین‏منظور میزان بیان دو ژن مرتبط با فرآیند آپوپتوزیس، P53 و BCL2، با استفاده از RT-PCR در سلول‏های مزبور ارزیابی شد (شکل21) . با توجه به غیرکمی بودن این روش تغییر قابل ملاحظه ای در میزان بیان آن‏ها در سلول‏های تیمار شده در مقایسه با سلول‏های کنترل مشاهده نشد. در این راستا پیشنهاد می‏شود از روش کمی quantitative real time-PCR به‏منظور بررسی دقیق تغییرات بیان ژن‏های مزبور استفاده شود.

فاکتور دیگر استفاده شده در تحقیق جاری به‏منظور ایجاد حفاظت نورونی، GDNF بود. در ابتدا هدف ما استفاده از سلول‏های آستروسیتوما به‏عنوان سلول‏های مولد فاکتور GDNF به‏صورت انبوه بود، زیرا این سلول‏ها در حالت نرمال نیز GDNF را ترشح می‏کنند و نیز با این کار فضای in vivo به‏شکل بهتری بازسازی می‏شد. اما همان‏طور که از شکل‏های 14 و 16 پیداست، GDNF در سلول‏های آستروسیتوما بیان قابل ملاحظه­ای نداشت و نیز تیمار سلول‏های SH-SY5Y با محیط مشروط سلول‏های آستروسیتوما حفاظت قابل توجهی را اعمال نکرد. پس از آستروسیتوما، سلول‏های HEK-293T بهترین کاندید برای تولید انبوه فاکتور GDNF هستند زیرا آن‏ها نیز در حالت نرمال فاکتور مزبور را تولید می‏کنند و از طرف دیگر با داشتن قابلیت ترانسفکشن بالا، توانستند GDNF را حتی به مقدار بیشتری نسبت به سلول‏های آستروسیتوما تولید کنند. بنابراین در تیمارهای بعدی، فقط محیط مشروط سلول‏های HEK-293T به‏عنوان منبع GDNF مورد استفاده قرار گرفت. نتایج ما نشان داد که اثر حفاظتی GDNF بر نورون‏های دوپامین­ساز هم در مقابل فاکتورهای التهابی میکروگلیا و هم در مقابل توکسین 6-OHDA، تقریبا با اثر حفاظتی Nurr1  قابل مقایسه است. GDNF با اتصال به کمپلکس رسپتوری GFR  و Ret روی سلول‏های هدفش، مسیرهای سیگنالینگی همچون Ras/ERK1/2 و PI3K را فعال کرده و در نتیجه منجر به رشد و حفاظت سلولی می‏شود (42 و 43). احتمالا اثر حفاظتی  GDNF در مقابل فاکتورهای التهابی میکروگلیا، از طریق تحریک بیشتر مسیرهای رشد و غلبه­ آن‏ها بر مسیرهای مرگ باشد. تحقیق جاری و نیز گزارش‏های پیشین نشان از اثر حفاظتی فاکتور GDNF روی سلول‏های نورونی، در مقابل توکسین 6-OHDA دارند (44). همچنین نتایج ما نشان داد که حضور هم‏زمان دو فاکتور Nurr1  و GDNF، حفاظت بیشتری را نسبت به حالت تنها به سلول‏های دوپامین­ساز عطا می‏کند. فاکتور Nurr1 در تنظیم بیان رسپتور GDNF (Ret) نقش دارد (17).. احتمالا افزایش بیان فاکتور Nurr1 منجر به افزایش بیان رسپتور Ret شده و از طرف دیگر حضور GDNF در محیط، منجر به تحریک بیشتر مسیر سیگنالینگ  GDNF و به‏دنبال آن تحریک بیشتر مسیرهای رشد و ترمیم سلولی شده و در نهایت حفاظت سلولی بیشتری را در مقابل فاکتورهای التهابی میکروگلیا و توکسین 6-OHDA به سلول‏های نورونی عطا می‏کند. موضوعی که لازم است در سطح مولکولی به‏دقت بررسی شود.

 

نتیجه‌گیری

نتایج تحقیق ما نشان داد که بیش­بیان فاکتور Nurr1 در سلول‏های نورونی دوپامین ساز SH-SY5Y و یا تیمار سلول‏های SH-SY5Y با محیط مشروط حاوی فاکتور GDNF به‏طور جداگانه، نورون‏های مزبور را در برابر فاکتورهای التهابی و استرس اکسیداتیو حفاظت می‏کند. همچنین حضور سطوح بالا و توام این دو فاکتور در سلول‏هایSH-SY5Y، اثر سینرژیک داشته و حفاظت بسیار بیشتری را به این سلول‏ها عطا می‏کند.

 

تشکر و قدردانی

کلیه حقوق و مزایای این تحقیق متعلق به پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری می‏باشد و هزینه آن در قالب پروپوزال دانشجویی و توسط این سازمان تامین شده است.

 

 

منابع

 

1. Lau de, Breteler M.M. Epidemiology of Parkinson's disease. Lancet Neurol. 2006; 5(6): 525-35. A.

2. Anglade P, Vyas F, Javoy-Agid MT, Herrero PP, et al. Apoptosis and autophagy in nigral neurons of patients with Parkinson's disease. Histology and Histopathology. 1997; 12(1): 25-31.

3. Carlsson A, Lindqvist M, Magnusson T. 3, 4-Dihydroxyphenylalanine and 5-hydroxytryptophan as reserpine antagonists. Nature. 1957; 180(4596): 1200.

4. Stocco A, Lebiere C, Anderson JR. Conditional routing of information to the cortex: A model of the basal ganglia's role in cognitive coordination. Psychological review. 2010; 117(2): 541.

5. Chakravarthy VS, Joseph D, Bapi RS. What do the basal ganglia do? A modeling perspective. Biological cybernetics. 2010; 103(3): 237-253.

6. Jankovic J, Stacy M. Medical management of levodopa-associated motor complications in patients with Parkinson's disease. CNS drugs. 2007; 21(8): 677-692.

7. Smeyne RJ, Jackson-Lewis dV. The MPTP model of Parkinson's disease. Molecular brain research. 2005; 134(1): 57-66.

8. Floyd RA. Antioxidants, oxidative stress, and degenerative neurological disorders. Experimental Biology and Medicine.1999; 222(3): 236-245.

9.Kurkowska-Jastrzebska I, Wronska A, Kohutnicka M, Czlonkowski A. Wrońska A

More

Kohutnicka M

More

MHC class II positive microglia and lymphocytic infiltration are present in the substantia nigra and striatum in mouse model of Parkinson's disease. Acta neurobiologiae experimentalis. 1998;59(1):1-8.

Członkowski A

More

Członkowska A

More

10. McGeer P,Akiyama S, Itagaki EG. Immune system response in Alzheimer's disease. The Canadian journal of neurological sciences. Le journal canadien des sciences neurologiques. 1989; 16(4 Suppl): 516-527.

11. Saijo K,Winner B, Carson CT, Collier JG, et al. A Nurr1/CoREST pathway in microglia and astrocytes protects dopaminergic neurons from inflammation-induced death. Cell. 2009; 137(1): 47-59.

12. Kordower JH, Emborg ME, Bloch J, Ma SY,et al. Neurodegeneration prevented by lentiviral vector delivery of GDNF in primate models of Parkinson's disease. Science. 2000; 290(5492): 767-773.

13. Eslamboli A. Assessment of GDNF in primate models of Parkinson's disease: comparison with human studies. Reviews in the Neurosciences. 2005; 16(4): 303-310.

14. Gill SS,Patel NK, Hotton GR
, O'Sullivan K, et al. Direct brain infusion of glial cell line–derived neurotrophic factor in Parkinson disease. Nature medicine. 2003; 9(5): 589-595.

15. Sherer TB,Fiske BK, Svendsen CN, Lang AE, et al. Crossroads in GDNF therapy for Parkinson's disease. Movement disorders. 2006; 21(2): 136-141.

16. Wallen SA, Castro DS, Zetterström RH, Karlén M, et al. Orphan nuclear receptor Nurr1 is essential for Ret expression in midbrain dopamine neurons and in the brain stem. Molecular and Cellular Neuroscience. 2001; 18(6): 649-663.

17. Galleguillos D, Fuentealba JA, Gómez LM, Saver M, et al. Nurr1 regulates RET expression in dopamine neurons of adult rat midbrain. Journal of neurochemistry. 2010; 114(4): 1158-1167.

18. Barnum CJ, Tansey MG. Modeling neuroinflammatory pathogenesis of Parkinson’s disease. Progress in brain research. 2010; 184: 113-132.

19. Mazzio EA, Reams RR, Soliman KF. The role of oxidative stress, impaired glycolysis and mitochondrial respiratory redox failure in the cytotoxic effects of 6-hydroxydopamine in vitro. Brain research. 2004; 1004(1): 29-44.

20. Glinka Y, Gassen M, Youdim M. Mechanism of 6-hydroxydopamine neurotoxicity, in Advances in Research on Neurodegeneration. 1997; Springer. 55-66.

21. Rahimi  A, Gardaneh M,Alipanah M, Gharib A, et al. Transfectability and Transducibility of chicken liver cell line LMH compared to human cell line HEK-293T. Journal of Cell & Tissue. 2011; 1(2): 47-56.

22. Rasoolnezhad M, Gardaneh M. Sabouni Induction of neuro-inflammation by activating microglial cells and its impact on survival of dopaminergic neurons. Journal of Cell & Tissue. 2016; 6(4): 481-490.

23. Gardaneh M, Gholami M, Maghsoudi N. Synergy between glutathione peroxidase-1 and astrocytic growth factors suppresses free radical generation and protects dopaminergic neurons against 6-hydroxydopamine. Rejuvenation research. 2011; 14(2): 195-204.

24. Rahimi A, Gardaneh M, Alipakah M, Panahi  Y. Recombinant lentivirus-mediated gene transfer into chicken cell line LMH. Modares Biological  Science and Technology. 2010; (1): 54-60.

25. Reiser J. Production and concentration of pseudotyped HIV-1-based gene transfer vectors. Gene therapy. 2000; 7(11): 910-913.

26. Zhang XY, Russa La, Reiser J. Transduction of bone-marrow-derived mesenchymal stem cells by using lentivirus vectors pseudotyped with modified RD114 envelope glycoproteins. Journal of virology. 2004; 78(3): 1219-1229.

27. Kitamura Y, Kosaka T, Kakimura JI, Matsuoka Y, et al. Protective effects of the antiparkinsonian drugs talipexole and pramipexole against 1-methyl-4-phenylpyridinium-induced apoptotic death in human neuroblastoma SH-SY5Y cells. Molecular pharmacology. 1998; 54(6): p. 1046-1054.

28. Kofler J, Wiley CA. Microglia Key Innate Immune Cells of the Brain. Toxicologic pathology. 2011; 39(1): 103-114.

29. Lynch MA. The multifaceted profile of activated microglia. Molecular neurobiology. 2009; 40(2): 139-156.

30. Zetterstrom RH,Jansson L, Hoffer BJ, Olson L, et al. Dopamine neuron agenesis in Nurr1-deficient mice. Science. 1997; 276(5310): 248-250.

31. Jiang C,Wan X, He Y, Pan T,  et al. Age-dependent dopaminergic dysfunction in Nurr1 knockout mice. Experimental neurology. 2005; 191(1): 154-162.

32. Smidt MP, Burbach JPH. How to make a mesodiencephalic dopaminergic neuron. Nature Reviews Neuroscience. 2007; 8(1): 21-32.

33. Pan T, Zhu W., Zhao H, et al. Nurr1 deficiency predisposes to lactacystin-induced dopaminergic neuron injuryin vitro and in vivo. Brain research. 2008; 1222: 222-229.

34. Wang H, Chen J, Hollister K, Sowers LC,et al. Structure and function of Nurr1 identifies a class of ligand-independent nuclear receptors. Nature. 2003; 423(6939): 555-560.

35. Blum D, Torch S, Lambeng N, Nissou M, et al. Molecular pathways involved in the neurotoxicity of 6-OHDA, dopamine and MPTP: contribution to the apoptotic theory in Parkinson's disease. Progress in neurobiology. 2001; 65(2): p. 135-172.

36. Kadkhodaei B,  Alvarsson A,  Schintu N, Ramsköld D, et al. Transcription factor Nurr1 maintains fiber integrity and nuclear-encoded mitochondrial gene expression in dopamine neurons. Proceedings of the National Academy of Sciences. 2013; 110(6): 2360-2365.

37. Volakakis N, Kadkhodaei B, Joodmardi E, et al. NR4A orphan nuclear receptors as mediators of CREB-dependent neuroprotection. Proceedings of the National Academy of Sciences. 2010; 107(27): p. 12317-12322.

38. Minghetti L, Levi G. Microglia as effector cells in brain damage and repair: focus on prostanoids and nitric oxide. Progress in neurobiology. 1998; 54(1): 99-125.

39. Banati RB, Gehrmann J,
Schubert P, Kreutzberg GW, et al. Cytotoxicity of microglia. Glia. 1993; 7(1): 111-118.

40. Liu B, Gao HM, Wang JY, Jeohn GH, et al. Role of nitric oxide in inflammation-mediated neurodegeneration. Annals of the New York Academy of Sciences. 2002; 962(1): 318-331.

41. Beckman JS. Oxidative damage and tyrosine nitration from peroxynitrite. Chemical research in toxicology. 1996; 9(5): 836-844.

42. Chen B, Zeng WZ, Yuan PX, et al. Increased hippocampal BDNF immunoreactivity in subjects treated with antidepressant medication. Biological psychiatry. 2001; 50(4): 260-265.

43. Chen Z, Chai Y, Cao K, Huang A, et al. Glial cell line-derived neurotrophic factor promotes survival and induces differentiation through the phosphatidylinositol 3-kinase and mitogen-activated protein kinase pathway respectively in PC12 cells. Neuroscience. 2001; 104(2): 593-598.

44. Sandhu JK, Gardaneh M, Iwasiow R, Lanthier P, et al. Astrocyte-secreted GDNF and glutathione antioxidant system protect neurons against 6OHDA cytotoxicity. Neurobiology of disease. 2009; 33(3): 405-414.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1. Lau de, Breteler M.M. Epidemiology of Parkinson's disease. Lancet Neurol. 2006; 5(6): 525-35. A.

2. Anglade P, Vyas F, Javoy-Agid MT, Herrero PP, et al. Apoptosis and autophagy in nigral neurons of patients with Parkinson's disease. Histology and Histopathology. 1997; 12(1): 25-31.

3. Carlsson A, Lindqvist M, Magnusson T. 3, 4-Dihydroxyphenylalanine and 5-hydroxytryptophan as reserpine antagonists. Nature. 1957; 180(4596): 1200.

4. Stocco A, Lebiere C, Anderson JR. Conditional routing of information to the cortex: A model of the basal ganglia's role in cognitive coordination. Psychological review. 2010; 117(2): 541.

5. Chakravarthy VS, Joseph D, Bapi RS. What do the basal ganglia do? A modeling perspective. Biological cybernetics. 2010; 103(3): 237-253.

6. Jankovic J, Stacy M. Medical management of levodopa-associated motor complications in patients with Parkinson's disease. CNS drugs. 2007; 21(8): 677-692.

7. Smeyne RJ, Jackson-Lewis dV. The MPTP model of Parkinson's disease. Molecular brain research. 2005; 134(1): 57-66.

8. Floyd RA. Antioxidants, oxidative stress, and degenerative neurological disorders. Experimental Biology and Medicine.1999; 222(3): 236-245.

9.Kurkowska-Jastrzebska I, Wronska A, Kohutnicka M, Czlonkowski A. Wrońska A

MHC class II positive microglia and lymphocytic infiltration are present in the substantia nigra and striatum in mouse model of Parkinson's disease. Acta neurobiologiae experimentalis. 1998;59(1):1-8.

Członkowski A

10. McGeer P,Akiyama S, Itagaki EG. Immune system response in Alzheimer's disease. The Canadian journal of neurological sciences. Le journal canadien des sciences neurologiques. 1989; 16(4 Suppl): 516-527.

11. Saijo K,Winner B, Carson CT, Collier JG, et al. A Nurr1/CoREST pathway in microglia and astrocytes protects dopaminergic neurons from inflammation-induced death. Cell. 2009; 137(1): 47-59.

12. Kordower JH, Emborg ME, Bloch J, Ma SY,et al. Neurodegeneration prevented by lentiviral vector delivery of GDNF in primate models of Parkinson's disease. Science. 2000; 290(5492): 767-773.

13. Eslamboli A. Assessment of GDNF in primate models of Parkinson's disease: comparison with human studies. Reviews in the Neurosciences. 2005; 16(4): 303-310.

14. Gill SS,Patel NK, Hotton GR
, O'Sullivan K, et al. Direct brain infusion of glial cell line–derived neurotrophic factor in Parkinson disease. Nature medicine. 2003; 9(5): 589-595.

15. Sherer TB,Fiske BK, Svendsen CN, Lang AE, et al. Crossroads in GDNF therapy for Parkinson's disease. Movement disorders. 2006; 21(2): 136-141.

16. Wallen SA, Castro DS, Zetterström RH, Karlén M, et al. Orphan nuclear receptor Nurr1 is essential for Ret expression in midbrain dopamine neurons and in the brain stem. Molecular and Cellular Neuroscience. 2001; 18(6): 649-663.

17. Galleguillos D, Fuentealba JA, Gómez LM, Saver M, et al. Nurr1 regulates RET expression in dopamine neurons of adult rat midbrain. Journal of neurochemistry. 2010; 114(4): 1158-1167.

18. Barnum CJ, Tansey MG. Modeling neuroinflammatory pathogenesis of Parkinson’s disease. Progress in brain research. 2010; 184: 113-132.

19. Mazzio EA, Reams RR, Soliman KF. The role of oxidative stress, impaired glycolysis and mitochondrial respiratory redox failure in the cytotoxic effects of 6-hydroxydopamine in vitro. Brain research. 2004; 1004(1): 29-44.

20. Glinka Y, Gassen M, Youdim M. Mechanism of 6-hydroxydopamine neurotoxicity, in Advances in Research on Neurodegeneration. 1997; Springer. 55-66.

21. Rahimi  A, Gardaneh M,Alipanah M, Gharib A, et al. Transfectability and Transducibility of chicken liver cell line LMH compared to human cell line HEK-293T. Journal of Cell & Tissue. 2011; 1(2): 47-56.

22. Rasoolnezhad M, Gardaneh M. Sabouni Induction of neuro-inflammation by activating microglial cells and its impact on survival of dopaminergic neurons. Journal of Cell & Tissue. 2016; 6(4): 481-490.

23. Gardaneh M, Gholami M, Maghsoudi N. Synergy between glutathione peroxidase-1 and astrocytic growth factors suppresses free radical generation and protects dopaminergic neurons against 6-hydroxydopamine. Rejuvenation research. 2011; 14(2): 195-204.

24. Rahimi A, Gardaneh M, Alipakah M, Panahi  Y. Recombinant lentivirus-mediated gene transfer into chicken cell line LMH. Modares Biological  Science and Technology. 2010; (1): 54-60.

25. Reiser J. Production and concentration of pseudotyped HIV-1-based gene transfer vectors. Gene therapy. 2000; 7(11): 910-913.

26. Zhang XY, Russa La, Reiser J. Transduction of bone-marrow-derived mesenchymal stem cells by using lentivirus vectors pseudotyped with modified RD114 envelope glycoproteins. Journal of virology. 2004; 78(3): 1219-1229.

27. Kitamura Y, Kosaka T, Kakimura JI, Matsuoka Y, et al. Protective effects of the antiparkinsonian drugs talipexole and pramipexole against 1-methyl-4-phenylpyridinium-induced apoptotic death in human neuroblastoma SH-SY5Y cells. Molecular pharmacology. 1998; 54(6): p. 1046-1054.

28. Kofler J, Wiley CA. Microglia Key Innate Immune Cells of the Brain. Toxicologic pathology. 2011; 39(1): 103-114.

29. Lynch MA. The multifaceted profile of activated microglia. Molecular neurobiology. 2009; 40(2): 139-156.

30. Zetterstrom RH,Jansson L, Hoffer BJ, Olson L, et al. Dopamine neuron agenesis in Nurr1-deficient mice. Science. 1997; 276(5310): 248-250.

31. Jiang C,Wan X, He Y, Pan T,  et al. Age-dependent dopaminergic dysfunction in Nurr1 knockout mice. Experimental neurology. 2005; 191(1): 154-162.

32. Smidt MP, Burbach JPH. How to make a mesodiencephalic dopaminergic neuron. Nature Reviews Neuroscience. 2007; 8(1): 21-32.

33. Pan T, Zhu W., Zhao H, et al. Nurr1 deficiency predisposes to lactacystin-induced dopaminergic neuron injuryin vitro and in vivo. Brain research. 2008; 1222: 222-229.

34. Wang H, Chen J, Hollister K, Sowers LC,et al. Structure and function of Nurr1 identifies a class of ligand-independent nuclear receptors. Nature. 2003; 423(6939): 555-560.

35. Blum D, Torch S, Lambeng N, Nissou M, et al. Molecular pathways involved in the neurotoxicity of 6-OHDA, dopamine and MPTP: contribution to the apoptotic theory in Parkinson's disease. Progress in neurobiology. 2001; 65(2): p. 135-172.

36. Kadkhodaei B,  Alvarsson A,  Schintu N, Ramsköld D, et al. Transcription factor Nurr1 maintains fiber integrity and nuclear-encoded mitochondrial gene expression in dopamine neurons. Proceedings of the National Academy of Sciences. 2013; 110(6): 2360-2365.

37. Volakakis N, Kadkhodaei B, Joodmardi E, et al. NR4A orphan nuclear receptors as mediators of CREB-dependent neuroprotection. Proceedings of the National Academy of Sciences. 2010; 107(27): p. 12317-12322.

38. Minghetti L, Levi G. Microglia as effector cells in brain damage and repair: focus on prostanoids and nitric oxide. Progress in neurobiology. 1998; 54(1): 99-125.

39. Banati RB, Gehrmann J,
Schubert P, Kreutzberg GW, et al. Cytotoxicity of microglia. Glia. 1993; 7(1): 111-118.

40. Liu B, Gao HM, Wang JY, Jeohn GH, et al. Role of nitric oxide in inflammation-mediated neurodegeneration. Annals of the New York Academy of Sciences. 2002; 962(1): 318-331.

41. Beckman JS. Oxidative damage and tyrosine nitration from peroxynitrite. Chemical research in toxicology. 1996; 9(5): 836-844.

42. Chen B, Zeng WZ, Yuan PX, et al. Increased hippocampal BDNF immunoreactivity in subjects treated with antidepressant medication. Biological psychiatry. 2001; 50(4): 260-265.

43. Chen Z, Chai Y, Cao K, Huang A, et al. Glial cell line-derived neurotrophic factor promotes survival and induces differentiation through the phosphatidylinositol 3-kinase and mitogen-activated protein kinase pathway respectively in PC12 cells. Neuroscience. 2001; 104(2): 593-598.

44. Sandhu JK, Gardaneh M, Iwasiow R, Lanthier P, et al. Astrocyte-secreted GDNF and glutathione antioxidant system protect neurons against 6OHDA cytotoxicity. Neurobiology of disease. 2009; 33(3): 405-414.