بررسی اثر بیسفنولA بر قابلیت حیات، تغییرات مورفولوژیک و القای آپوپتوزیس در سلول‌های بنیادی مزانشیم مغز استخوان رت بالغ

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشگاه اراک، دانشکده علوم پایه، گروه زیست شناسی،کدپستی 8349 -38156، اراک، ایران

2 کارشناس ارشد زیست شناسی جانوری، سلولی-تکوینی، دانشگاه اراک، دانشکده علوم پایه، گروه زیست شناسی، اراک، ایران

-

چکیده

هدف: هدف از این پژوهش، بررسی اثر بیسفنول Aبر قابلیت حیات، تغییرات مورفولوژیک و القای آپوپتوزیس در سلول‌های بنیادی مزانشیم مغز استخوان رت بالغ بود. مواد و روش‌ها: سلول‌های بنیادی مزانشیم مغز استخوان با استفاده از روش فلشینگ استخراج شدند. سلول‌های پاساژ سوم به 11 گروه کنترل و آزمایشی تقسیم شدند. سلول‌های گروه‌های آزمایشی با دوزهای مختلف بیسفنولA (1، 5، 10، 50، 100، 250، 500، 1000، 2000 و 4000 نانومولار) طی چهار دوره 5، 10، 15 و 21 روزه، در محیط استئوژنیک حاوی 10 درصد سرم جنین گاوی، جهت تعیین دوز موثر تیمار شدند. سپس قابلیت حیات، میزان آسیب DNA، تغییر در الگوی بیان ژن‌ها و همچنین تغییرات مورفولوژیک سلول‌ها، طی روند تمایز استئوژنیک بررسی شد. داده‌ها با روش آماری آنالیز واریانس یک‏طرفه و همچنین آنالیز  t-testمورد تجزیه و تحلیل قرار گرفت  و تفاوت میانگین‌ها در سطح 05/0p< معنی‌دار در نظر گرفته شد. نتایج: کاهش معنی‌داری در قابلیت حیات سلول‌ها، قطر هسته و سطح بیان ژن آنتی‌آپوپتیک Bcl-2 در سلول‌های تیمار شده با بیسفنولA نسبت به گروه کنترل مشاهده شد )05/0p<). افزایش معنی‌داری نیز در میزان آسیب و شکستگی DNA و سطح بیان ژن آپوپتوتیک Bax در سلول‌های تیمار شده با بیسفنولA نسبت به گروه کنترل،  مشاهده شد (05/0p<). نتیجه‌گیری: نتایج حاصل از این پژوهش پیشنهاد می‌کند که بیسفنولA در رفتاری وابسته به دوز، باعث کاهش قابلیت حیات و القای آپوپتوزیس در سلول‌های بنیادی مزانشیم مشتق از مغز استخوان می‌شود.  

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

امروزه هزاران ماده شیمیایی و صنعتی متفاوت ناخواسته وارد محیط زیست می‌شود که مخرب و بر هم ‌زننده‌ی تعادل سیستم اندوکرینی انسان و دیگر جانوران می‌باشند، که از آن گروه می‌توان به بیسفنولA (BPA) اشاره کرد (1). بیسفنولA یا 2-2، بیس هیدروکسی فنل پروپان (BPA)، یک الیل ‌فنول است که به‏عنوان یک زنواستروژن محیطی شناخته می‌شود و به‏دلیل داشتن اثرات استروژنی روی سیستم تولیدمثل، جزء مخرب‌های اندوکرینی (EDC) نیز طبقه‌بندی می‏شود (2). بیسفنولA به‏طور وسیع در تولید انواع مواد و وسایل پزشکی از جمله لنزهای چشمی و کامپوزیت‌های دندانپزشکی و همچنین ظروف یک‌بارمصرف، پوشش داخلی قوطی‌های کنسرو، بطری‌های آب معدنی، شیشه‌های تغذیه اطفال، پلاستیک‌هایPVC ، پلی‌کربنات‌ها و غیره استفاده می‌شود (3 و 4). این آلاینده زیست ‌محیطی می‌تواند از طریق آب، هوا (1) و غذا وارد زنجیره غذایی انسان ‌شود (8-5).

تحقیقات نشان داده است که  بیسفنولA با تغییر در الگوی بیان ژن‌ها در سلول‌های اعصاب مرکزی (9) و همچنین تولید گونه اکسیژن واکنش‌گر  (Reactive oxygen species) ROSدر سلول‌های اندوتلیال رده MSS31 (10) باعث کاهش قابلیت حیات و مرگ سلول‌ها می‌شود.

سلول‌ بنیادی مزانشیم، سلولی پیش‌ساز با توانایی‌های متعدد است که در برخی از بافت‌های بالغ نظیر مغز استخوان و بافت چربی یافت می‌شود و قادر به خود نوزایی با ظرفیت تکثیری بالا می‏باشد (11).  طبق مطالعات صورت گرفته توانائی سلول‌های بنیادی مزانشیم برای تشکیل استخوان، چربی و غضروف در هردو شرایط In Vivo و In Vitro  به اثبات رسیده است (12). اگرچه اثر سیتوتوکسیسیتی بیسفنولA بر سلول‌های بنیادی جنینی انسان بررسی شده است (13) ، ولی با وجود اهمیت سلول‌های بنیادی مزانشیم مغز استخوان به‏عنوان یک ذخیره با ارزش در جایگزینی سلول‌های استخوانی به هنگام صدمات بافتی، تاکنون اثر این آلاینده صنعتی بر این سلول‌ها در محیط استئوژنیک، گزارش نشده است.

بنابراین با توجه به حضور بیسفنولA  در محیط زیست، ورود گسترده آن به زنجیره غذائی طی 30 سال اخیر و همچنین تهدید سلامت انسان، و از سوی دیگر پتانسیل بالای سلول‌های بنیادی مزانشیم مغز استخوان در تمایز به استئوبلاست و کاربرد گسترده آن‏ها در ترمیم ضایعات استخوانی، لذا بر آن شدیم تا اثر سیتوتوکسیسیتی بیسفنولA را بر میزان تکثیر سلولی، تغییرات مورفولوژیک و القای آپوپتوزیس در سلول‌های بنیادی مزانشیم مغز استخوان رت بالغ طی روند تمایز به استئوبلاست، به‏عنوان یک مدل آزمایشگاهی مورد مطالعه و تحقیق قرار دهیم.

مواد و روش‏ها

جداسازیوکشتسلول‌هایمغزاستخوان: در این مطالعه تجربی از رت‌های نژاد  Wistar با سن 50 روز و وزن 20± 140 گرم استفاده شد. حیوان مورد استفاده در این پژوهش پس از خریداری از انستیتو پاستور در خانه حیوانات دانشگاه اراک در شرایط استاندارد دمای 3±27 درجه سانتی گراد و با دسترسی آزاد به غذا و آب در قفس‏های پلی اتیلین نگه‏داری شد. با رعایت اصول اخلاقی، رت­ها به‏کمک دی اتیلن اتر بی‏هوش شده، استخوان‌های ران و ساق پای آن‌ها جدا و سپس بافت‌های پیوندی اطراف استخوان‌ها به‏طور کامل پاک گردید. استخوان‌ها در محیط کشت DMEM  (Dulbecco’s Modified Eagles Medium ، Gibco، Germany) حاوی 15 % سرم FBS  (Fetal Bovine Serum، Gibco، Germany) و پنی‌سیلین- استرپتومایسین (تهیه شده از شرکت Gibco، Germany) در دمای 4 درجه سانتی‌گراد قرار گرفته، به زیر هود لامینار منتقل شد. دو سر استخوان با قیچی استریل قطع و مغز استخوان با عمل فلاشینگ خارج و به‏داخل لوله فالکون حاوی محیط کشت کامل هدایت و سپس به‏مدت 5 دقیقه در   rpm1200 سانترفیوژ شد. محیط رویی خارج و رسوب سلولی در یک میلی‌­لیتر محیط کشت تازه معلق گردید و در فلاسک کشت T25 و در انکوباتور CO2‌دار (دمای 37 درجه سانتی‏گراد و 5 درصد CO2) انکوبه گردید. پس از 24 ساعت محیط رویی که حاوی سلول‌های غیرچسبنده بود، خارج و شستشوی سلول‌ها با PBS انجام گردید. سپس به‏مدت دو هفته، هر سه روز یکبار محیط کشت سلول‌ها تعویض شد. زمانی که کف فلاسک به تراکم بالایی از سلول رسید، سلول‌ها با کمک 1x Trypsin/EDTA 25/0 درصد (تهیه شده از شرکت Sigma-Aldrich) از کف فلاسک جدا و به فلاسک‏های جدید منتقل شدند. برای به‏دست آوردن خلوص بالایی از این سلول‌ها سه مرحله پاساژ تکرار شد.

کشت سلول‌ها در دوزهای مختلف بیسفنولA و بررسی قابلیت حیات آن‌ها: سلول‌های پاساژ سوم به تعداد 103×5 سلول در هر خانه ی پلیت 24 خانه ای به‏مدت 24 ساعت کشت و پس از چسبیدن این سلول‌ها به کف در حضور گروه‌ کنترل (محیط استئوژنیک: محیط DMEM حاوی 10 درصد سرم گاوی، 10میلی‏مولار بتاگلیسرول فسفات،10 نانومولار دگزامتازون و 50 میکروگرم در میلی‌لیتر آسکوربیک 3-فسفات) و دوزهای 1، 5، 10، 50، 100، 250، 500، 1000، 2000 و 4000 نانومولار بیسفنولA (تهیه شده از شرکت Sigma-Aldrich) در محیط استئوژنیک کشت شد (14). پس از  دوره‌های 5، 10، 15 و 21 روز قابلیت حیات سلول‌ها ارزیابی شد و بدین منظور، 30 میکرولیتر محلول 01/0 مولار MTT به هر چاهک اضافه شد و به‏مدت 4 ساعت انکوبه گردید. پس از اینکه کریستال‌های فورمازون تشکیل شد. این بلورها در حلال دی متیل سولفوکسید (DMSO) (تهیه شده از شرکت Sigma-Aldrich) حل و میزان جذب محلول حاصل در طول موج 450 نانومتر توسط دستگاه (SCO diagnostic, Germany) ELAISA-reader اندازه‏گیری شد و با استفاده از منحنی استاندارد MTT تعداد سلول‌های زنده در گروه‏های مختلف تعیین شد (14).

انتخاب دوز موثر: با توجه به نتایج به‏دست آمده از تست MTT، 250 نانومولار بیسفنولA به‏عنوان دوز موثر انتخاب گردید و مطالعه با دو گروه کنترل و تیمار با بیسفنولA  (250 نانومولار) ادامه یافت.

آزمون کامت: تست کامت روش بسیار حساسی با عنوان "Single-cell alkaline gel electrophoresis"یا       "Comet assay" می‌باشد که از آن جهت بررسی سلامت DNA هسته سلول‏های تیمار شده با  بیسفنولA در مقایسه با گروه کنترل استفاده شد. این تست بر اساس حرکت DNA در میدان الکتریکی انجام می شود . اگر DNA در اثر عوامل محیطی مختلف دچار شکست و قطعه قطعه شدن شده باشد به‏دلیل اختلاف سرعت حرکت قطعات DNA با طول مختلف در میدان الکتریکی، اطراف هسته سلول‌ها هاله یا دنباله ای دیده می‏شود و هرچه این تخریب شدیدتر باشد، هاله بزرگ‏تر و کشیده تری حول هسته تشکیل خواهد شد. برای انجام این تست ابتدا مخلوط سوسپانسیون سلولی گروه کنترل و گروه سلول‌های تیمار شده با 250 نانومولار بیسفنولA، با تراکم 200 هزار سلول در هر میلی‏لیتر محلول 1 درصد آگارز با دمای ذوب پایین تهیه شد. این سوسپانسیون بر روی اسلایدهای میکروسکوپی مفروش شده با آگارز 1 درصد گذاشته شد و پس از لامل گذار ی / آگارز نرمال 5، اسلایدها به‏مدت 20 دقیقه در دمای 4 درجه سانتی‌گراد انکوبه شدند. سپس لامل از روی اسلایدها به آرام ی برداشته شد و اسلاید میکروسکوپی در بافر لیز حاوی 0.15 M ,EDTA Nacl 2.5 M، NaSLS 1%، Tris-base 10 Mm، 0.1 Mm با pH= 10 به‏مدت 60 دقیقه قرار داده شد. پس از آن اسلایدها در بافر الکتروفورز حاوی NaOH 300 mM, EDTA 1Mm، با pH=13 با جریان 300 آمپر به‏مدت 20 دقیقه، الکتروفروز شد. در نهایت نمونه در بافر خنثی کننده حاوی Tris base0.4M که با HCl به pH=7.5 رسیده بود، شستشو داده شده و پس از رنگ‌آمیزی با اتیدیوم بروماید به کمک میکروسکوپ Olympus مشاهده و عکس‌برداری صورت گرفت (14).

استخراج RNA و آنالیز RT-PCR : جهت مطالعه دقیق‌تر و تایید تست کامت و همچنین تشخیص نوع مرگ سلولی القا شده در سلول‌های تیمار شده با بیسفنول‌A، از آنالیز RT-PCR استفاده شد.

کشت سلولی و جداسازی RNA: در این مرحله سلول‌ها به تعداد 103×5 در فلاسک‌های T شکل 25 سانتی‏متر مکعب کشت و به‏مدت 21 روز با محیط استئوژنیک و دوز 250 نانومولار بیسفنولA کشت و تیمار شدند و سپس با کمک اسکراپر، سلول‌ها از کف فلاسک تراشیده و به اپندورف منتقل شدند. سلول‌ها در ازت مایع به فریزر 80- درجه سانتی‏گراد انتقال یافتند. جهت جداسازی RNA از این سلول‌ها از کیت RNeasy mini kit (Qiagen)  و برطبق دستوالعمل کارخانه سازنده استفاده شد و به‏منظور سنجش میزان RNA استخراج شده از دستگاه اسپکتروفتومتر استفاده شد و همچنین خلوصRNA  با استفاده از نسبت جذب در طول موج 260 به280 تعیین شد. تمامی مراحل در زیر هود لامینار صورت گرفت.

سنتز (reverse transcription reaction) c-DNA:         برای سنتز c-DNA از c-DNA synthesis kit (frementas) استفاده شد و بدین منظور 2 میکرولیتر RNA کل (Total) (5/0 میکروگرم بر میکرولیتر)،  1 میکرولیتر پرایمر oligo (dT)18  و تا حجم 12 میکرولیتر آب فاقد نوکلئاز (Nuclease free water) در داخل میکروتیوب 1.5 میلی لیتری استریل که بر روی یخ قرار داده شده، ریخته شد. سپس به منظور حذف ساختارهای ثانویه احتمالی تشکیل شده در RNA، نمونه‌ها به‏مدت 5 دقیقه در 70 درجه سانتی‌گراد انکوبه و پس از آن بر روی یخ قرار داده شدند. در ادامه 4 میکرولیتر 5x reaction buffer، 1 میکرولیتر مهار‌کننده RNase  (20u/μl) ، 2 میکرولیتر از مخلوط dNTP (dTTP, dATP, dGTP, dCTP) (10mM) و 1 میکرولیتر آنزیم ترانس کریپتاز معکوس M-MulV (200 u/µl) به نمونه ها اضافه شد، به آرامی مخلوط و سپس سانتریفوژ شدند.

برای شروع واکنش نمونه ها به مدت 60 دقیقه در دمای 37 درجه سانتی‌گراد قرار داده شدند و در پایان با گرم کردن نمونه ها در دمای 70 درجه سانتی گراد به مدت 5 دقیقه واکنش متوقف گردید و محصول c-DNA حاصل برای واکنش های PCR مورد استفاده قرار گرفت.

واکنش زنجیره پلی‌مراز (pcr) : واکنش PCR با استفاده از پرایمرهای اختصاصی Bax (Forward: 5´CTTTTTGTTACAGGGTTTCATCCAG3´ و Reverse: 5´CTCTGCAGCTCCATATTATTGTCC3´) و Bcl-2 (Forward: 5´GCTGGGATGCTTTGTGGAA3´ و Reverse: 5´CTCACTTGTGGCCCAGGTA3´) در حجم 25 میکرولیتر و با دمای آنیلینگ 58 درجه سانتی‌گراد، در 35 سیکل صورت گرفت و از ژن β-Actine (Forward: 5´CGTGCGTGACATTAAAGAGAA3´ و Reverse: 5´CGCTCATTGCCGATAGTGAT3´) به‏عنوان کنترل داخلی استفاده شد.

بررسی تغییرات مورفولوژیکی در نمونه های استئوژنیک با استفاده از رنگ‌آمیزی فلورسنت: به‏دنبال تیمار سلول‌ها در یک محیط استئوژنیک برای مدت 21 روز، بررسی تغییرات مورفولوژیک هسته سلول‌ها با استفاده از رنگ هوخست-H33342 و پروپیدیوم آیوداید پس از 5 دقیقه انکوبه کردن در دمای اتاق انجام شد. همچنین قطر هسته سلول‌ها به‏وسیله نرم‌افزار تصویری موتیک company version 1.2) (Micro optical group اندازه‌گیری شد. Hoechst 3342 رنگ فلورسنتی است که از طریق غشای پلاسمایی در سلول نفوذ کرده، DNA را رنگ می‌کند، که با استفاده از آن تغییرات هسته از قبیل تراکم کروماتین و قطعه قطعه شدن آن را می‏توان بررسی کرد. مورفولوژی سیتوپلاسم سلول‌ها به وسیله‌ی رنگ آکریدین اورنژ، بررسی شد. سلول‌ها بعد از رنگ‌آمیزی 2 بار با PBS- شسته شدند و بررسی انجام شد و بلافاصله توسط میکروسکوپ فلورسنس (Olympus, IX70) عکس‏برداری شد (15).

آنالیز آماری

داده های به دست آمده با استفاده از آزمون آماری One-Way ANOVA ، تست Tukey و همچنین T-Test، تجزیه و تحلیل و تفاوت میانگین‌ها در سطح 05/0p<  معنی‌دار در نظر گرفته شد.

نتایج

بررسی قابلیت حیات و انتخاب دوز موثر

از مقایسه میزان قابلیت حیات در سلول‌های بنیادی مزانشیم مغز استخوان تیمار شده با دوزهای مختلف بیسفنولA و به‏صورت وابسته به دوز، نسبت به گروه کنترل، کاهش معنی‌داری مشاهده شد (05/0p<) (جدول1 و شکل1).

با توجه به نتایج حاصل از تست  MTT و رنگ‌آمیزی پروپیدیوم آیوداید، دوز 250 نانومولار بیسفنولA در مدت 21 روز، به‏عنوان دوز موثر انتخاب گردید و مطالعه با دو گروه کنترل و تیمار با بیسفنولA (250 نانومولار) ادامه یافت.

 

 

 

 

 

 

 

 

 

 

جدول1. مقایسه میانگین قابلیت حیات سلول‌های بنیادی مزانشیم مغز استخوان رت بالغ تیمار شده با دوزهای مختلف بیسفنولA در مقایسه با گروه کنترل. مقادیر به‏صورت means±sd می‏باشد.میانگین‏ها با کدحرف‌های متفاوت دارای تفاوت معنی‌دار هستند (one way ANOVA tukey,s test,p<0.05).

 

Dose (nM)

Number of viable cells (×1000)

 

Time (day)

 

5                                   10                                   15                                     21

 

0

10

50

100

250

500

1000

2000

4000

 

10854.2 a ±157

10333.3 ab ±308

9916.7 abc ±344

9645.8 bc ±157

9020.8 cd ±425

8229.2 d ±485

7500 ef ±472

6687.5 f ±438

5270.8 g ±538

 

11750 a ±826

10833 abc ±219

10333 bcd ±95

9895.8 cd ±190

9166.7 d ±252

7583.3 e ±191

6270.8 f ±191

4562 g ±225

3875 g ±62

 

15479.2 a ±314

14208 ab ±320

11125 bc ±312

10750 cd ±62

10104 d ±95

9291.7 e ±320

6562.5 f ±125

5979.2 f ±190

5187.5 g ±62

 

17854.2 a ±538

14250 ab ±286

11854 bc ±260

10979.2 c ±157

7708.3 d ±219

6770.8 de ±314

6333.3 de ±130

5895.8 e ±200

1625 f ±1488

 

 

 

 

 

 

شکل1: رنگ‌آمیزی سلول‌های بنیادی مزانشیم مغز استخوان رت با رنگ فلورسنت پروپیدیوم آیوداید (بزرگنمایی x200).  A) گروه سلول‌های کنترل. B) گروه سلول‌های تیمار شده با 250 نانومولار بیسفنولA. (در رنگ آمیزی سلول‌ها با رنگ پروپیدیوم آیوداید هسته‌های صورتی رنگ، سلول‌های مرده را نشان می‌دهد).

 

 

آزمون کامت

در بررسی اثر بیسفنول‌A بر سلامت هسته سلول‌های بنیادی مزانشیم توسط تکنیک کامت، مشخص شد که در گروه کنترل، هسته سلول‏ها به‏صورت یکنواخت با اتیدیوم برماید رنگ‌آمیزی شده و بدون هاله بود که بیانگر سلامت DNA می‏باشد. درحالی‏که در گروه تیمار با بیسفنول‌A، DNA شکسته شده تحت تاثیر میدان الکتریکی به‏صورت دنباله یا کامت به‏همراه باقی مانده هسته‏ها دیده شد و این خود نشانه تخریب DNA و مرگ سلولی، به‏دنبال تیمار سلول‌ها با 250 نانومولار بیسفنول‌A بود (شکل2). همچنین طبق بررسی­های صورت گرفته و مطالعات کمی نتایج حاصل از آزمون کامت، درجات مختلفی از طول دنباله­ی کامت در تصاویر مشاهده شد و بر این اساس داده‌ها به پنج درجه متفاوت تقسیم شد (شکل3). به‏طور کلی داده‌های حاصل، حاکی از افزایش معنی دار میزان آسیب DNA و همچنین افزایش میزان حرکت قطعات شکسته شده DNA در میدان الکتریکی در سلول‌های بنیادی مزانشیم تیمار شده با بیسفنول‌A، در مقایسه با گروه کنترل بود (نمودار1).

 

 

         

نمودار 1: مقایسه اثر بیسفنولA بر میانگین طول دنباله کامت (میکرومتر) و میزان آسیب DNA (درصد) در سلول‌های بنیادی مزانشیم مغز استخوان رت با گروه کنترل، 21 روز پس از تیمار با بیسفنولA (250 نانومولار) ، ( T-Test ، **p<0.01 و ***p<0.001).

 

شکل 2: تست کامت در سلول‌های بنیادی مزانشیم تمایز یافته به استئوبلاست، 21 روز پس از تیمار با بیسفنول‌A (بزرگنمایی x200). A)گروه کنترل،  B) گروه سلول‌های تیمار شده با بیسفنول‌ A (250 نانومولار).

 

 

شکل3: درجه بندی سلول‌ها بر اساس طول واندازه کامت A. درجه صفر (بدون کامت)، B.درجه یک،  C. درجه دو،  D. درجه سه،   E. درجه چهار.

 

 

آنالیز کیفی سطح بیان ژن‌های Bax و Bcl-2

بررسی میزان سطح بیان ژن‌ آپوپتوتیک Bax و ژن آنتی‌آپوپتوتیک Bcl-2 توسط آنالیز RT-PCR در گروه سلول‌های تیمار شده با بیسفنول‌A نسبت به گروه کنترل، به‌ترتیب افزایش و کاهش قابل توجهی را در میزان بیان ژن‌های مذکور، نشان داد (شکل4).

 

 

شکل4: آنالیز کیفی سطح بیان ژن‌‍‌های Bax و Bcl-2 در سلول‌های بنیادی مزانشیم مغز استخوان رت، 21 روز پس از تیمار با بیسفنول‌A

A) گروه کنترل. B) گروه سلول‌های تیمار شده با بیسفنول‌A (250 نانومولار). ژن β-actin  به‌عنوان کنترل داخلی در نظر گرفته شده است.

 

 

بررسی تغییرات مورفولوژیک سلول‌ها

قطر هسته سلول‌های بنیادی مزانشیم تیمار شده با بیسفنولA نسبت به گروه کنترل، کاهش معنی‌داری (05/0(p< را نشان داد (شکل5،  AوB و نمودار2).

رنگ‌آمیزی سیتوپلاسم سلول‌ها با رنگ آکریدین‌اورنژ، سیتوپلاسم چندوجهی با زوائد قابل تشخیص را در سلول‌های گروه کنترل نشان داد و این در حالی بود که سیتوپلاسم سلول‌ها در گروه‌ تیمار شده با بیسفنولA، در مقایسه با گروه کنترل، در برخی قسمت‌ها منقبض و در برخی قسمت‌ها از حالت چندوجهی خارج شده بود. هسته نیز در برخی بخش‌ها از موقعیت مرکزی خود خارج و به حاشیه سیتوپلاسمی سلول کشیده شده بود (شکل5، C وD).

 

 

 

نمودار 2: مقایسه اثر بیسفنولA بر میانگین قطر هسته­ها در سلول‌های بنیادی مزانشیم مغز استخوان رت با گروه کنترل، 21 روز پس از تیمار با بیسفنولA (250 نانومولار) ، ( T-Test ، *p<0.05 ).

 

 

شکل5: رنگ‌آمیزی هوخست (A وB) و آکریدین اورنژ (C و D) (بزرگنمایی x400) در سلول‌های بنیادی مزانشیم تمایز یافته به استئوبلاست، 21 روز پس از تیمار با بیسفنولA در محیط استئوژنیک.A ,C ) گروه کنترل. B ,D )سلول‌های تیمار شده با 250 نانومولار بیسفنولA. (پیکان‌ها در شکل B، فشردگی کروماتین را در هسته سلول‌های تیمار شده و در شکل D، چروکیدگی و انقباض سیتوپلاسم و کوچک شدن یا گرد شدن سلول‌ها به‌همراه خارج شدن هسته از موقعیت مرکزی خود را نشان می‌دهد).

 

بحث

در مطالعه حاضر بیسفنول‌A، در رفتاری وابسته به دوز، باعث کاهش قابلیت حیات و افزایش میزان آسیب و شکستگی DNA، در سلول‌های بنیادی مزانشیم مغز استخوان رت بالغ شد، این یافته در راستای نتایج حاصل از مطالعه Hwang و همکاران (16) بر روی سلول‌های رده MC3T3-E1 موش در سال 2013 می‌باشد.

Bredhult (17) و همچنین Tiwaria و همکاران (18) نیز به‏ترتیب در سال‌های 2009 و 2012، اثر بیسفنول‌A را بر سلول‌های اندوتلیال اندومتریوم انسان (HEECs) و سلول‌های رده MCF 7 مورد بررسی قرار دادند و مشاهده کردند که بیسفنول‌A در رفتاری وابسته به دوز و زمان، باعث کاهش قدرت تکثیر و قابلیت حیات، افزایش سطح استرس اکسیداتیو و پراکسیداسیون لیپیدی و همچنین آسیب DNA در سلول‌ها می‏شود.

بیسفنول‌A، یک الیل فنول است که در ساختمان خود دارای دو حلقه فنلی اشباع ­نشده می‌باشد و همین حلقه­های فنلی هم، در بروز سمیت و اثرات آپوپتوتیک این ترکیب صنعتی نقش دارند (19). بیسفنول‌A، پتانسیل کافی برای ایجاد آسیب‌های ژنتیکی را در سلول‌های بنیادی مزانشیم تمایز یافته و القای اثرات ژنوتوکسیک را در سلول‌ها دارد.

این آلاینده صنعتی باعث افزایش بیان ژن کاسپاز 12، انتشار LDH، القای استرس رتیکولوم اندوپلاسمیک (ER stress) و تولید گونه اکسیژن واکنش‌گر (ROS) درون سلولی به‏واسطه‌ی مهار آنزیم‌های آنتی‌اکسیدانتی می‌شود (20 و 21). استرس اکسیداتیو القا شده توسط بیسفنول‌A، باعث بروز پراکسیداسیون لیپیدی و آسیب غشای سلولی و در نتیجه افزایش آسیب DNA و کاهش قابلیت حیات در سلول‌ها می‌گردد. طبق تحقیقات صورت گرفته در سال 2012 (18)، مشاهده شد که بیسفنول‌A، موجب افزایش سطح 8-OHdG که یک مارکر آسیب اکسیداتیوی DNA است، در سلول‌های تیمار شده می‌شود و سطح گلوتاتیون ردکتاز (GSH) را نیز کاهش می‌دهد و بدین طریق باعث افزایش آسیب و قطعه قطعه شدن DNA می‌شود. GSH یک آنتی‌اکسیدانت قوی است که به‏عنوان کوفاکتور برای آنزیم‌ها در جهت کاهش استرس اکسیداتیو عمل می‌کند (18 و 22).

البته افزایش میزان تولید ROS نیز می‌تواند علت افزایش آسیب DNA و کاهش قابلیت حیات ناشی از بیسفنول‌A باشد (23).

بیسفنولA همچنین باعث تغییر در الگوی بیان برخی ژن‌ها، به‌خصوص افزایش سطح بیان ژن آپوپتوتیک Bax و کاهش سطح بیان ژن‌ آنتی‌آپوپتوتیک Bcl-2 می‌شود. افزایش بیان ژن Bax، آبشار ژنی و سیگنال‌های آپوپتوتیک را فعال می‌کند (9) که در نهایت به میتوکندری منتقل شده و باعث افزایش فعالیت کاسپازهای 3 و 8 و 9 می‌شوند. تغییر در میزان بیان و فعالیت کاسپازها که نقش موثری در پیشبرد روند آپوپتوزیس دارند (24)، می‌تواند مکانیسم احتمالی دیگری در آپوپتوزیس القا شده در سلول‌های بنیادی مزانشیم تیمار شده با  بیسفنولA باشد.

در مطالعه­ی ما تغییرات مورفولوژیکی نیز، یکی دیگر از تغییرات مشاهده شده در اثر تیمار با بیسفنولA در سلول‌های بنیادی مزانشیم مغز استخوان بود. این تغییرات شامل چروکیدگی و انقباض سیتوپلاسم و در بعضی بخش‌ها برآمدگی غشا و خارج شدن سلول از حالت چندوجهی خود بود. البته طبق مطالعات کمی صورت گرفته، فشردگی و کاهش قطر هسته‌ها نیز در سلول‌های تیمار شده با بیسفنولA مشاهده شد. تمام تغییرات مورفولوژیکی ذکر شده منطبق با تغییراتی است که در مرگ سلولی از نوع آپوپتوزیس رخ می‌دهد (25 و 26). پلیمریزاسیون و دپلیمریزاسیون پروتئین اکتین، مکانیسم اصلی در کنترل شکل سلول است و از آن‏جا که در طی مرگ سلولی انقباض به‏واسطه میوزین در حلقه غشایی اکتین به‏طور هم‏زمان با تخریب پروتئولیتیک پروتئین‌های سایتواسکلتال تحت تاثیر تیمار سلول‌ها توسط بیسفنولA، اتفاق می‌افتد، و این پروتئین‌ها هم در ارتباط مستقیم با اکتین هستند، بنابراین تغییرات مورفولوژیکی مشاهده شده در سلول‌ها ظاهر می‌شود (27).

بنابراین نتایج ما پیشنهاد می‌کند که بیسفنولA باعث سرکوب بقای سلولی، کاهش قابلیت حیات و قدرت تکثیر سلول‌ها می‌شود و همچنین مرگ سلولی از نوع آپوپتوزیس را در سلول‌های بنیادی مزانشیم مغز استخوان رت بالغ القا می‌کند.

نتیجه گیری

بیسفنولA، به‏عنوان یک آلاینده زیست محیطی و همچنین یک مخرب اندوکرینی (EDC)، قادر است از راه‌های مختلف موجب فعال‌سازی مسیرهای آپوپتوتیک شود و قدرت تکثیر و قابلیت حیات سلول‌های بنیادی مزانشیم مغز استخوان را کاهش دهد. بنابراین براساس نتایج حاصل از این مطالعه، پیشنهاد می‌شود که در زمینه ارتباط بین بیماری‌های استخوانی مثل استئوپروزیس و سطوح سرمی بیسفنولA تحقیقات بیشتری در جوامع انسانی صورت گیرد.

تشکروقدردانی

با تشکر از معاونت محترم پژوهشی دانشگاه اراک که با پشتیبانی مالی انجام این پروژه تحقیقاتی را امکانپذیر نمودند.

منابع

1. Flint S, Markle T, Thompson S, Wallace E. Bisphenol A exposure, effects, and policy: A wildlife perspective. Journal of Environmental Management. 2012; 104: 19-34.

2. Wang SW, Kim JM, Hwang KG. Effect of gestational exposure to Bisphenol A on neuronal stem cell differentiation in the neonatal rat hippocampus. Piscataway, NJ, USA. 2011; 18(3): 218-230.

3. Cabado AG, Aldea S, Porro C, Ojea G, et al. Migration of BADGE (bisphenol A diglycidyl-ether) and BFDGE (bisphenol F diglycidyl-ether) in canned sea­food. Food Chem Toxicol. 2008; 46(5): 1674–1680.

4. Cao XL, Dufresne G, Clement G, Belisle S, et al. Levels of bisphenol A diglycidyl ether (BADGE) and bisphenol F diglycidyl ether (BFDGE) in canned liquid infant formula products in Canada and dietary intake estimates. J AOAC Int. 2009; 92(6): 1780–1789.

5. Kuo HW, Ding WH. Trace determination of bisphenol A and phytoestrogens in infant formula powders by gas chromatography-mass spectrometry. J. Chromatogr. 2004; 1027(1-2): 67–74.

6. Munguia-Lopez EM, Gerardo-Lugo S, Peralta E, Bolumen S, et al. Migration of bisphenol A (BPA) from can coatings into a fatty-food stimulant and tuna fish. Food Addit. Contam. 2005; 22(9): 892–898.

7. Thomson BM, Grounds PR. Bisphenol A in canned foods in New Zealand: an exposure assessment. Food Addit. Contam. 2005; 22(1): 65–72.

8. Wolfgang D, Wolfgang V. Human exposure to bisphenol A by biomonitoring: methods, results and assessment of environmental exposures. Toxicol. Appl. Pharmacol. 2008; 228: 114–134.

9. Oka T, Adati N, Shinkai T, Sakuma K, et al. Bisphenol A induces apoptosis in central neural cells during early development of Xenopus laevis. Biochemical and Biophysical Research Communications. 2003; 312(4): 877–882.

10. Noguchi S, Nakatsuka M, Asagiri K, Habara T, et al. Bisphenol A stimulates NO synthesis through a non-genomic estrogen receptor-mediated mechanism in mouse endothelial cells. Toxicology Letters. 2002; 135: 95-101.

11. Bosch P, Pratt S, Stice S. Isolation, characterization, gene modification, and nuclear reprogramming of porcine mesenchymal stem cells. Biol Reprod. 2006; 74(1): 46-57.

12 Minguell J, Erices A, Conget P. Mesenchymal stem cells. Exp Biol Med (Maywood). 2001; 226(6): 507-20.

13. Yang L, Luo L, Ji W, Gong C, et al. Effect of low dose bisphenol A on the early differentiation of human embryonic stem cells into mammary epithelial cells. Toxicol Lett. 2013; 218(3): 187-93.

14. Soleimani Mehranjani M, Mosavi M. Cadmium chloride toxicity suppresses osteogenic potential of rat bone marrow mesenchymal stem cells through reducing cell viability and matrix mineralization. Indian Journal of Medical Research. 2011; 67(4): 157-167.

15. Abnosi MH, Soleimani Mehranjani M, Shariatzadeh MA, Dehdehi L. Para-Nonylphenol Impairs Osteogenic Differentiation of Rat Bone Marrow Mesenchymal Stem Cells by Influencing the Osteoblasts Mineralization.  Iranian Journal of Basic Medical Sciences. 2012; 15(5): 1131-1139.

16. Hwang JK, Min KH, Choi KH, Hwang YC, et al. Bisphenol A reduces differentiation and stimulates apoptosis of osteoclasts and osteoblasts. Life Sciences. 2013; 17; 93(9-11): 367-372.

17. Bredhulta C, Sahlinb L, Olovsson M. Gene expression analysis of human endometrial endothelial cells exposed to Bisphenol A. Reproductive Toxicology. 2009; 28(1): 18–25.

18. Tiwaria D, Kamblea J, Chilgundea S, Patil P,  et al. Clastogenic and mutagenic effects of bisphenol A: An endocrine disruptor. Mutation Research. 2012; 743(1-2): 83– 90.

19. Wang SW, Kim JM, Hwang KG. Effect of gestational exposure to Bisphenol A on neuronal stem cell differentiation in the neonatal rat hippocampus. Piscataway, NJ, USA. 2001; 18(3): 218-230.

20. Bindhumol V, Chitra KC, Mathur PP. Bisphenol A induces reactive oxygen species generation in the liver of male rats. Toxicology. 2003; 188(2-3): 117–124.

21. Chitra KC, Latchoumycandane C, Mathur PP. Induction of oxidative stress by bisphenol A in the

 

epididymal sperm of rats, Toxicology. 2003; 185(1-2): 119–127.

22. Bast A, Haenen GR, Doelman CJ. Oxidents, antioxidants; state of arts, Am J. Med. 1991; 91: 25–135.

23. Asahi J, Kamo H, Baba R, Doi Y, et al. Bisphenol A induces endoplasmic reticulum stress-associated apoptosis in mouse non-parenchymal hepatocytes. Life Sciences. 2010; 87: 431–438.

24. Terasaka H, Kadoma Y, Sakagami H, Fujisawa S. Cytotoxicity and Apoptosis-inducing Activity of Bisphenol A and Hydroquinone in HL-60 Cells. Anticancer Research. 2005; 25: 2241-2248.

25. Clarke PG. Developmental cell death: morphological diversity and multiple mechanisms. Anat Embryol (Berl). 1990; 181(3): 195–213.

26. Wyllie AH, Kerr JF, Currie AR. Cell death: the significance of apoptosis. Int Rev Cytol. 1990; 68: 251–306.

27. Iida H, Maehara K, Doiguchi M, Mori T, et al. Bisphenol A-induced apoptosis of cultured rat Sertoli cells. Reprod Toxicol. 2003; 17(4): 457-464.

1. Flint S, Markle T, Thompson S, Wallace E. Bisphenol A exposure, effects, and policy: A wildlife perspective. Journal of Environmental Management. 2012; 104: 19-34.

2. Wang SW, Kim JM, Hwang KG. Effect of gestational exposure to Bisphenol A on neuronal stem cell differentiation in the neonatal rat hippocampus. Piscataway, NJ, USA. 2011; 18(3): 218-230.

3. Cabado AG, Aldea S, Porro C, Ojea G, et al. Migration of BADGE (bisphenol A diglycidyl-ether) and BFDGE (bisphenol F diglycidyl-ether) in canned sea­food. Food Chem Toxicol. 2008; 46(5): 1674–1680.

4. Cao XL, Dufresne G, Clement G, Belisle S, et al. Levels of bisphenol A diglycidyl ether (BADGE) and bisphenol F diglycidyl ether (BFDGE) in canned liquid infant formula products in Canada and dietary intake estimates. J AOAC Int. 2009; 92(6): 1780–1789.

5. Kuo HW, Ding WH. Trace determination of bisphenol A and phytoestrogens in infant formula powders by gas chromatography-mass spectrometry. J. Chromatogr. 2004; 1027(1-2): 67–74.

6. Munguia-Lopez EM, Gerardo-Lugo S, Peralta E, Bolumen S, et al. Migration of bisphenol A (BPA) from can coatings into a fatty-food stimulant and tuna fish. Food Addit. Contam. 2005; 22(9): 892–898.

7. Thomson BM, Grounds PR. Bisphenol A in canned foods in New Zealand: an exposure assessment. Food Addit. Contam. 2005; 22(1): 65–72.

8. Wolfgang D, Wolfgang V. Human exposure to bisphenol A by biomonitoring: methods, results and assessment of environmental exposures. Toxicol. Appl. Pharmacol. 2008; 228: 114–134.

9. Oka T, Adati N, Shinkai T, Sakuma K, et al. Bisphenol A induces apoptosis in central neural cells during early development of Xenopus laevis. Biochemical and Biophysical Research Communications. 2003; 312(4): 877–882.

10. Noguchi S, Nakatsuka M, Asagiri K, Habara T, et al. Bisphenol A stimulates NO synthesis through a non-genomic estrogen receptor-mediated mechanism in mouse endothelial cells. Toxicology Letters. 2002; 135: 95-101.

11. Bosch P, Pratt S, Stice S. Isolation, characterization, gene modification, and nuclear reprogramming of porcine mesenchymal stem cells. Biol Reprod. 2006; 74(1): 46-57.

12 Minguell J, Erices A, Conget P. Mesenchymal stem cells. Exp Biol Med (Maywood). 2001; 226(6): 507-20.

13. Yang L, Luo L, Ji W, Gong C, et al. Effect of low dose bisphenol A on the early differentiation of human embryonic stem cells into mammary epithelial cells. Toxicol Lett. 2013; 218(3): 187-93.

14. Soleimani Mehranjani M, Mosavi M. Cadmium chloride toxicity suppresses osteogenic potential of rat bone marrow mesenchymal stem cells through reducing cell viability and matrix mineralization. Indian Journal of Medical Research. 2011; 67(4): 157-167.

15. Abnosi MH, Soleimani Mehranjani M, Shariatzadeh MA, Dehdehi L. Para-Nonylphenol Impairs Osteogenic Differentiation of Rat Bone Marrow Mesenchymal Stem Cells by Influencing the Osteoblasts Mineralization.  Iranian Journal of Basic Medical Sciences. 2012; 15(5): 1131-1139.

16. Hwang JK, Min KH, Choi KH, Hwang YC, et al. Bisphenol A reduces differentiation and stimulates apoptosis of osteoclasts and osteoblasts. Life Sciences. 2013; 17; 93(9-11): 367-372.

17. Bredhulta C, Sahlinb L, Olovsson M. Gene expression analysis of human endometrial endothelial cells exposed to Bisphenol A. Reproductive Toxicology. 2009; 28(1): 18–25.

18. Tiwaria D, Kamblea J, Chilgundea S, Patil P,  et al. Clastogenic and mutagenic effects of bisphenol A: An endocrine disruptor. Mutation Research. 2012; 743(1-2): 83– 90.

19. Wang SW, Kim JM, Hwang KG. Effect of gestational exposure to Bisphenol A on neuronal stem cell differentiation in the neonatal rat hippocampus. Piscataway, NJ, USA. 2001; 18(3): 218-230.

20. Bindhumol V, Chitra KC, Mathur PP. Bisphenol A induces reactive oxygen species generation in the liver of male rats. Toxicology. 2003; 188(2-3): 117–124.

21. Chitra KC, Latchoumycandane C, Mathur PP. Induction of oxidative stress by bisphenol A in the

 

epididymal sperm of rats, Toxicology. 2003; 185(1-2): 119–127.

22. Bast A, Haenen GR, Doelman CJ. Oxidents, antioxidants; state of arts, Am J. Med. 1991; 91: 25–135.

23. Asahi J, Kamo H, Baba R, Doi Y, et al. Bisphenol A induces endoplasmic reticulum stress-associated apoptosis in mouse non-parenchymal hepatocytes. Life Sciences. 2010; 87: 431–438.

24. Terasaka H, Kadoma Y, Sakagami H, Fujisawa S. Cytotoxicity and Apoptosis-inducing Activity of Bisphenol A and Hydroquinone in HL-60 Cells. Anticancer Research. 2005; 25: 2241-2248.

25. Clarke PG. Developmental cell death: morphological diversity and multiple mechanisms. Anat Embryol (Berl). 1990; 181(3): 195–213.

26. Wyllie AH, Kerr JF, Currie AR. Cell death: the significance of apoptosis. Int Rev Cytol. 1990; 68: 251–306.

27. Iida H, Maehara K, Doiguchi M, Mori T, et al. Bisphenol A-induced apoptosis of cultured rat Sertoli cells. Reprod Toxicol. 2003; 17(4): 457-464.