بهبود تولید رده‌های سلولی پرتوان هاپلوئید از جنین‏‌های پارتنوژنتیک موش به واسطه مهار هم‏زمان مسیرهای پیام‌رسانی MEK و TGFβ

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی واحد دامغان، دانشکده علوم پایه، گروه زیست‌شناسی تکوینی، دامغان، ایران

2 پژوهشگاه رویان، گروه سلول‌‌های بنیادی و زیست‌شناسی تکوینی تهران، ایران

-

چکیده

هدف: در این طرح تولید سلول‌های بنیادی جنینی هاپلوئید پارتنوژنتیک در حضور مهارکننده‌های مسیرهای پیام‌رسانی ERK و TGF-β بررسی شده است. مواد و روش‌ها: ابتدا بلاستوسیست‌های پارتنوژنتیک حاصل از فعال‌سازی شیمیایی اووسیت‌ها، در محیط R2i (حاوی PD0325901 و SB431542 که به‏ترتیب مسیرهای پیام‌رسانی ERK و TGF-β را مهار می‌کنند) کشت شدند. سپس رده‌های سلول‌های بنیادی جنینی پارتنوژنتیک در این محیط تکثیر و نگه‏داری شدند. با استفاده از رنگ‌آمیزی ایمونوفلورسانس و qRT-PCR، بیان مارکرهای‌ پرتوانی و با روش تمایز خودبه‏خودی و ایجاد تراتوما پتانسیل تمایزی این سلول‌ها ارزیابی شدند. میزان هاپلوئیدی نیز با استفاده از روش فلوسایتومتری تعیین گردید. نتایج: در شرایط R2i، حدود 50 درصد از جنین‌های پارتنوژنتیک، رده سلولی تولید کردند و 10 تا 13 درصد سلول‌های هر رده به‌صورت هاپلوئیدی بودند. سلول‌های بنیادی پارتنوژنتیک تولید شده در محیط R2i ویژگی‌های سلول‌های بنیادی پرتوان مانند مورفولوژی، پاساژپذیری، بیان ژن‌های ویژه پرتوانی در سطح mRNA و پروتئین را نشان دادند. همچنین این سلول‌ها قادر به تمایز خودبه‏خودی به مشتقات سه لایه زاینده جنینی و ایجاد تراتوما بودند. نتیجه‌گیری: مهار مسیرهای پیام‌رسانی ERK و TGF-β می‌تواند شرایط مناسبی را برای تولید سلول‌های بنیادی هاپلوئید از جنین‌های پارتنوژنتیک فراهم کند. 

تازه های تحقیق

-

کلیدواژه‌ها


 

مقدمه

سلول‌های بنیادی جنینی از توده سلولی داخلی جنینی (در مرحله بلاستوسیست) مشتق می‌شوند (1 و 2). این سلول‌ها توانایی تکثیر نامحدود و تمایز به مشتقات هر سه لایه زایای جنینی را دارا می‌باشند. این ویژگی‌های بنیادی باعث شده است که این سلول‌ها به‌عنوان مدل مناسبی برای تحقیقات زیست‌شناسی تکوینی، ژنتیک تکوینی، سلول درمانی، مهندسی بافت و تست دارو مطرح گردند (3-5). تاکنون سلول‌های بنیادی جنینی تحت شرایط خاص از گونه‌های مختلف پستاندار و غیر پستاندار تولید شده‌اند. از آنجایی‌که سلول‌های پستانداران، به‌استثنای تخمک و اسپرم، دیپلوئید هستند و از هر ژن دو کپی در ژنوم خود دارند، سلول‌های بنیادی جنینی مشتق شده از این‌گونه‌ها نیز دیپلوئید هستند. وجود دو کپی از هر ژن در ژنوم، کاربرد این سلول‌ها را به‌ویژه در مطالعات ژنتیک تکوینی و غربالگری ژنتیکی (مستقیم و معکوس) دچار چالش می‌کند، به‌طوری‌که تنها با ایجاد جهش در هر دو کپی یک ژن می‌توان عملکرد آن ژن را آشکار ساخت (6). علی‏رغم پیشرفت‌های فوق‌العاده در فناوری هدف‌گیری ژن در سلول‌های بنیادی، فعالیت‌های ائتلاف بین‌المللی برای تولید موش knock out برای تمامی ژن‌های موشی و فناوری siRNA، غربالگری‌های ژنتیکی همچنان بسیار دشوار است (7 و 8).

اخیرا مطالعات متفاوتی تولید سلول‌های بنیادی هاپلوئید ماهی، موش، میمون و رت را از جنین‌های پارتنوژنتیک گزارش کرده‌اند (9-12). جنین‌های پارتنوژنتیک به‌واسطه تحریک شیمیایی تخمک لقاح نیافته حاصل ‌شده و بعد از رسیدن به مرحله بلاستوسیست برای تولید سلول‌های بنیادی هاپلوئید مورد استفاده قرارگرفته‌اند (13و 14). سلول‌های بنیادی هاپلوئید از نظر پتانسیل تمایزی پرتوان بوده و توانایی ایجاد اجسام شبه جنینی، ایجاد تراتوما و تمایز به هر سه رده جنینی را دارا هستند. سلول‌های بنیادی هاپلوئید با دارا بودن یک کپی از هر ژن بسیاری از مطالعات ژنتیکی را قابل انجام و آسان می‌کنند. از طرف دیگر به دلیل این‏که منشا این سلول‏ها گامت‏ها هستند مشکلات اخلاقی مرتبط با از بین بردن جنین مرتفع می‏گردد. با وجود یک سری کروموزوم همولوگ مادری، تنوع کمتری از آنتی‏ژن‏های سطح سلولی که در ارتباط با رد پیوند در فرد گیرنده این سلول‏ها هستند ایجاد می‏گردد و می‏تواند به‏عنوان گزینه مناسبی برای تولید و کاربردهای درمانی سلول‏های بنیادی

جنینی انسانی مطرح شود (10).

کوچک مولکول‌ها به‌طور وسیعی برای تولید و حفظ سلول‌های بنیادی جنینی موشی به‏کار گرفته ‌شده‌اند (15). هم‌اکنون   به‌طور واضح مشخص ‌شده است که حفظ پرتوانی سلول‌های بنیادی جنینی موشی به‌طور قطعی وابسته به LIF            نیست و بستن مسیرهای تمایزی به‌وسیله کوچک      مولکول‌های مهارکننده­ی اختصاصی ERK           (Extracellular signal-regulated kinases) و GSK3 سبب حفظ پرتوانی و بقا سلول‌های بنیادی جنینی می‌شود. در مطالعه اخیر، حسنی و همکاران (16 و 17) نشان دادند که مهار مسیرهای TGF-β (Transforming growth factor beta) و ERK به‌وسیله کوچک مولکول‌های اختصاصی می‌تواند سبب تولید بسیار کارآمد سلول‌های بنیادی جنینی از تمام سویه‌های موشی شود. در این مطالعه تجربی، تاثیر مهار این دو مسیر پیام‌رسانی در تولید سلول‌های بنیادی جنینی هاپلوئید مورد ارزیابی قرار گرفته است.

 

مواد و روش‏ها

این مطالعه بر اساس مصوبه کمیته اخلاق پزشکی و پژوهشگاه رویان و رعایت مقررات استفاده از حیوانات آزمایشگاهی انجام شده است.

آماده‌سازی جنین‌های پارتنوژنتیک موشی: در مطالعه تجربی حاضر، از موش‌های ماده 8 تا 11 هفته‌ای هیبرید BALB/c×C57BL/6) F1) استفاده شد. موش‌ها از مرکز انستیتو پاستور تهیه شدند و قبل از استفاده در آزمایشگاه، حداقل یک هفته در حیوان خانه در شرایط دمایی 19 تا 23درجه سانتی‌گراد، رطوبت 40 تا 50 درصد و 12 ساعت روشنایی (6 صبح تا 6 عصر) نگه‏داری شدند. به‌منظور القای تخمک‌گذاری در موش‌ها، مقدار 5/7 واحد بین‌المللی در میلی‌لیتر هورمون PMSG(Pregnant Mares Serum Gonadotropin) (Invert) و 47 تا 48 ساعت بعد 5/7 واحد بین‌المللی در میلی‌لیتر هورمون hCG(Human Chorionic Gonadotropin) (Invert)، به‏روش درون صفاقی تزریق شد. تقریبا 16 ساعت پس از تزریق hCG، موش‌های ماده، به روش قطع نخاع گردنی، کشته شدند، و پوست شکم و صفاق باز شده و لوله‌های رحمی پس از جداسازی درون محیط کشت M2 حاوی 4 میلی‌گرم در میلی‌لیتر BSA(Bovin Serum Albumin) (Sigma) قرار داده شدند. سپس ناحیه آمپولا با سر سوزن سرنگ انسولین به‌آرامی برش داده شد و تخمک‌ها به‏همراه سلول‌های گرانولوزا از لوله رحمی خارج شدند و به‏مدت 1 دقیقه در داخل قطره شستشو حاوی50 میکرو‏لیتر محیط کشت M2 و 70 میکرو‏لیتر آنزیم هیالورونیداز (Sigma) به غلظت 250 میکروگرم نگه ‌داشته شدند. تخمک‌های جدا شده از سلول‌های گرانولوزا در داخل قطره‌های محیط M2 شستشو داده ‌شدند و حداکثر 10 تخمک به هر قطره 80 میکرو لیتری از محیط کشت M16 (Sigma) که حاوی 5 میلی‌مولار استرانسیم (Sigma) و 5/0 میلی‌مولارEGTA(Ethylene Glycol Tetra Acetic acid) (Sigma) بود انتقال یافتند. قطره‌های حاوی تخمک‌ها با روغن معدنی پوشانده شدند و به‏درون انکوباتور با دمای 37 درجه سانتی‌گراد و CO2 (5 درصد) منتقل شدند. بعد از گذشت90 دقیقه، تخمک‌ها در قطره‌های محیط M16 چندین بار شستشو داده‌ شدند و در نهایت به قطره‌های جدید M16 منتقل‌ شده و به‏درون انکوباتور انتقال یافتند. بعد از گذشت 4 روز، بلاستوسیست‌های حاصله برای ادامه کار در یک قطره جمع‌آوری شدند (شکل 1، الف).

 

 

شکل 1: الف) شکل شماتیک مراحل تولید سلول‏های بنیادی جنینی موشی از بلاستوسیست‌های پارتنوژنتیک. ب) مورفولوژی تخمک‌های طبیعی (بالا) و تخمک‌های غیر طبیعی (پایین) قبل از فعال سازی شیمیایی، علامت اندازه معادل 50 میکرومتر است. ج) مورفولوژی سلول‏های بنیادی موشی روی بستر ژلاتین از مرحله کشت بلاستوسیست  تا سومین پاساژ، علامت اندازه معادل 200 میکرومتر است.

 

 

تولید و نگه‏داری سلول‌های بنیادی جنینی موشی: برای تولید سلول‌های بنیادی جنینی موشی، از بلاستوسیست‌های پارتنوژنتیک استفاده شد. ابتدا لایه زوناپلوسیدای بلاستوسیست‌ها به‌وسیله محلول اسید تایرود حذف شدند. به این‏صورت که درون ظرف، سه قطره اسید تایرود و سه قطره محیط شستشو قرار داده شد و در زیر استریومیکروسکوپ، جنین‌ها‌ به‏کمک پیپت هدایت‌شونده توسط دهان، به اولین قطره اسید تایرود برده شدند و خیلی سریع از دو قطره بعدی اسید تایرود عبور داده شدند. در اسیدتایرود، ناحیه شفاف کاملا حل می‌شود و ممکن است در قطره آخر به کف ظرف بچسبد که باید به‌آرامی با پیپت کردن آن را جدا کرد. سپس جنین‎ها به قطره‌های شستشو منتقل و بعد از شستشو، درون ظرف‌های کشتِ 96 خانه پوشیده شده با ژلاتین 1/0درصد انتقال داده شدند. در این روش، محیط کشت عاری ازسرم، تحت عنوان محیط N2B27، که شامل 45 درصد DMEM/F12، 45 درصدNeurobasal medium، یک درصد N2، دو درصد B27، یک درصد Penicillin streptomycin، یک درصدL- glutamin، یک درصد NonEssential Amino Acids، 2 درصد BSA با غلظت 125میلی‌گرم در هر میلی‌لیتر، 1/0 میلی‌مولار بتامرکاپتواتانول، 1000 واحد LIF به‏ازای هر میلی‌لیتر، ۱ میکرومولار کوچک مولکول‌  PD0325901و ۱۰ میکرومولار کوچک مولکول‌ SB431542 بود (این دو کوچک ‌مولکول تحت عنوان Royan 2 inhibitors یا R2i نام‌ برده می‌شود، مورد استفاده قرار گرفتند. چهارتا شش روز پس از کشت بلاستوسیست‌ها، سلول‌های رشد یافته توسط Trypsin/EDTA منفرد شدند و به ظروف جدید پوشیده شده با ژلاتین و محیط R2i انتقال یافتند که این مرحله به‌عنوان پاساژ اول در نظر گرفته شد. پس از گذشت حدود 1 هفته، کلونی‌های قابل پاساژ به دست آمدند و از آن‌ پس هر دو روز یک‌بار پاساژ داده شدند.

رنگ‌آمیزی آلکالین فسفاتاز و ایمونوفلورسانس: رنگ‌آمیزی آلکالین فسفاتاز با استفاده از کیت مخصوص (SIGMA) و طبق دستورالعمل شرکت سازنده انجام شد و عکس‌برداری با دوربین دیجیتال متصل به میکروسکوپ فازکنتراست با زمینه روشن (Olympus) صورت گرفت. برای انجام رنگ‌آمیزی ایمونوفلورسانس، ابتدا محیط کشت روی سلول‌ها حذف شد و سلول‌ها یک‌بار با محلول شستشو (5/0 درصد PBS/Tween) شستشو داده ‌شدند و با پارافرمالدهید 4 درصد به‏مدت 20 دقیقه، در دمای 4 درجه سانتی‌گراد فیکس شدند. سپس سلول‌ها دو بار (هرکدام به‏مدت 5 دقیقه) با محلول شستشو در دمای اتاق شستشو داده شدند و برای نفوذپذیر کردن سلول‌ها برای رنگ‌آمیزی پروتئین‌های  هسته­ای و سیتوپلاسمی، انکوباسیون سلول‌ها با محلول 2/0درصد TritonX-100 به‏مدت 15 دقیقه در دمای اتاق انجام شد. بعد از دو بار شستشوی سلول‌ها (هر بار به‏مدت 5 دقیقه) در دمای اتاق، مسدود کردن جایگاه‌های غیراختصاصی اتصال آنتی‌بادی (بلوکه کردن) به‌وسیله تیمار سلول‌ها با سرم بز 10 درصد به‏مدت 60 دقیقه، در دمای 37 درجه سانتی‌گراد انجام شد. بعد از یک‌بار شستشو، آنتی‌بادی‌های اولیه Oct4 (Santa Cruz Biotechnology, sc- 5279) Nanog(BD Pharmingen, 560259)، SSEA1(R&D, MAB2155)، Tuj1(Sigma- Aldrich, T8660)، Map2(Sigma- Aldrich, M- 1406)،  Gata4 (Santa Cruz Biotechnology, sc- 1237) و αFP(Santa Cruz Biotechnology, sc- 8108) با رقت ۱:۱۰۰ به سلول‌ها اضافه شد و به‏مدت 60 دقیقه در دمای 37 درجه سانتی‌گراد انکوباسیون صورت گرفت. سپس 3 بار شستشو (هر بار به‏مدت 15 دقیقه) در دمای اتاق انجام شد و آنتی‌بادی ثانویه Mouse IgG (Invitrogen, A- 11001) Mouse IgG (Invitrogen, A- 11004) Mouse IgM (Invitrogen, A- 21042) Goat IgG(Invitrogen, A- 21223) Rabbit- IgG(Invitrogen, A- 11008) با رقت۵۰۰ :۱  به سلول‌ها اضافه شد و انکوباسیون به‏مدت 60 دقیقه در دمای 37 درجه سانتی‌گراد انجام شد. در ادامه سلول‌ها سه بار (هر بار به‏مدت 15 دقیقه) در دمای اتاق شستشو داده شدند و رنگ DAPI به‌منظور رنگ‌آمیزی هسته اضافه شد. مشاهده و تصویربرداری از نمونه‌های رنگ‌آمیزی شده با استفاده از میکروسکوپ فلورسنتس (Olympus) صورت گرفت.

تمایز در شرایط In vitro و In vivo: برای اثبات پرتوانی سلول‌های بنیادی جنینی حاصل از جنین‌های پارتنوژنتیک، تمایز خودبه‌خودی به‌واسطه تشکیل اجسام شبه‌جنینی انجام شد. در این روش سلول‌های بنیادی جنینی منفرد شده به‌صورت سوسپانسیون سلولی در محیط کشت حاوی سرم و فاقد LIF، درون ظروف کشت نچسب (ظرف کشت باکتریایی) به‏مدت پنج‌ تا هفت روز کشت شدند. سپس توده‌های سلول‌های بنیادی جنینی که به آن‌ها اجسام شبه‌جنینی گفته می‌شود، به ظروف ژلاتینه شده انتقال‌ یافتند و به‏مدت 12 روز در محیط فوق کشت و نگه‌داری شدند. در کل فرآیند تمایز، تعویض محیط کشت به‌صورت یک روز در میان انجام شد.

توانایی تمایزی سلول‌های بنیادی جنینی به‌صورت in vivo با تشکیل تراتوما بررسی شد. برای تشکیل تراتوما حدود           106 × 5- 3 سلول منفرد شده با ماتریژل مخلوط شده و به‌صورت زیرپوستی به موش‌های هم‌نژاد تزریق شد. پس از گذشت 30 تا 40 روز تومورهای حاصله استخراج شدند و برای بررسی بافتی درون محلول بوئن تثبیت شدند.

استخراج RNA، نسخه‌برداری معکوس و واکنش زنجیره‌ای پلیمراز: کل RNA از سلول‌های بنیادی جنینی و تمایز یافته با استفاده از کیت RNeasy Mini kit (QIAGEN) طبق دستورالعمل شرکت سازنده کیت، استخراج و غلظت هر نمونه با استفاده از دستگاه اسپکتروفوتومتر تعیین شد. کیفیت RNA با بارگذاری RNA روی ژل آگارز 1 درصد بررسی شد. پس از اطمینان از کیفیت RNA استخراج شده، نسخه‌برداری معکوس (سنتز cDNA) با استفاده از 2 میکروگرم از کل RNA به همراه هگزامرهای تصادفی و با استفاده از کیت و طبق دستورالعمل کیت انجام شد. واکنش زنجیره‌ای پلیمراز (PCR) برای ژن‌های Oct4 (F: 5' GCG TTC TCT TTG GAA AGG TG 3' و R: 5' CGG TTC TCA ATG CTA GTT CG 3')، Nanog(F: 5' CTG ATT CTT CTA CCA GTC CCA 3' و R: 5' AAA CCA GGT CTT AAC CTG CTT AT3')، GATA4 (F: 5' GCC CAA GAA CCT GAA TAA ATC 3' و R: 5' TAG TGG CAT TGC TGG AGT TA 3')، Nestin (F: 5' CAC ACC TCA AGA TGT CCC 3' و R: 5' GAA AGC CAA GAG AAG CCT 3')، ALBUMIN (F: 5' AGA CAT CCT TAT TTC TAT GCC C3'  و R: 5' GAC CAA TGC TTT CTC CTT CAC 3') و Β-TUBULIN (F: 5' GCCCAAGAACCTGAATAAATC3' و R: 5' TAGTGGCATTGCTGGAGTTA 3') توسط دستگاه ترموسایکلر (مدل اپندورف) و طبق برنامه: 5 دقیقه در 95 درجه سانتی‏گراد، 45 ثانیه در 95 درجه درجه سانتی‏گراد، 45 ثانیه در 60 درجه درجه سانتی‏گراد، 45 ثانیه در 72 درجه و 10 دقیقه در 72 درجه و به تعداد 35 سیکل انجام شد. محصول PCR بر روی ژل آگارز 7/1 درصد بارگذاری و بررسی شد.

فلوسایتومتری: محیط کشت سلول‌های بنیادی جنینی خارج شد و سلول‌ها یک‌بار با  PBS(فاقد کلسیم و منیزیم) شستشو داده ‌شدند و به‏مدت 3 دقیقه با آنزیم Trypsin/EDTA(Gibco) تیمار شدند. فعالیت آنزیم با اضافه کردن محیط کشت سلول‌های بنیادی جنینی موشی حاوی سرم (ES- FBS)  خنثی شد و با استفاده از پیپت کردن، سلول‌ها به‌صورت منفرد درآمدند. سپس سوسپانسیون سلولی به‏مدت 5 دقیقه با سرعت rpm 1500 سانتریفوژ شد و محیط کشت جدید به رسوب سلولی اضافه گردید. به‏دنبال شمارش سلولی، یک سوسپانسیون سلولی حاوی ۱۰۶ سلول در یک میلی‌لیتر محیط کشت تهیه شد و به آن رنگ Dye cycle با غلظت 1 میکرولیتر در میلی‌لیتر محیط کشت اضافه شد. بعد از نگه‏داری به‏مدت 30 دقیقه در دمای 37 درجه سانتی‌گراد، میزان DNA هاپلوئیدی توسط دستگاه فلوسایتومتری (BD FACSAriaII) مورد بررسی قرار گرفت.

 

نتایج

بهبود فعال‌سازی تخمک با استفاده از استرانسیوم و EGTA

به‏دنبال استخراج تخمک‌ها از رحم موش و حذف سلول‌های گرانولوزا، تخمک‌ها ازنظر مورفولوژی مورد ارزیابی قرار گرفتند. تخمک‌هایی که در آن‌ها لایه شفاف یکنواخت نبوده و فاصله آن با غشای تخمک زیاد بود به‌عنوان تخمک غیرطبیعی در نظر گرفته شد و از ادامه مطالعه حذف شدند (شکل1، ب). به‌منظور بهینه کردن شرایط برای فعال‌سازی تخمک‌ها، از مواد شیمیایی مختلف شامل اتانول، استرانسیوم و EGTA به‏همراه محیط‌های M16 و R2i استفاده شد. مدت‌زمان تیمار با اتانول (به‏همراه محیط M16) 5 دقیقه بوده و برای استرانسیوم و استرانسیوم/EGTA در هر دو محیط M16 و R2i، تیمار به‏مدت 90 دقیقه انجام شد. از آنجایی‌که در این مطالعه دست‌یابی به بلاستوسیت برای تولید سلول‌های بنیادی ضروری بود، میزان بلاستوسیست‌های حاصل از هرکدام از فعال‌کننده‌ها مورد ارزیابی قرار گرفت (جدول1). نتایج نشان داد که محیط کشت M16 حاوی 5 میلی‏مولار استرانسیوم و 2 میلی‏مولار EGTA، بهترین شرایط برای فعال‌سازی تخمک را فراهم می‌کند، به‌طوری‌که 10درصد از تخمک‌ها توانایی رشد و ایجاد بلاستوسیست را داشتند. بلاستوسیست‌های ایجاد شده تحت این شرایط برای تولید سلول‌های بنیادی جنینی موشی مورد استفاده قرار گرفتند.

تولید سلول‌های بنیادی در حضور R2i: به‏منظور حذف لایه شفاف بلاستوسیست‌های حاصل از فعال‌سازی به‏واسطه استرانسیوم و EGTA، تیمار با اسید تایرود صورت گرفت. بلاستوسیست‌های فاقد لایه شفاف، بر روی ژلاتین و در محیط کشت فاقد سرم تحت عنوان N2B27 که حاوی R2i بود کشت شدند. 4 تا 6 روز پس از کشت، سلول‌های رشد یافته، با استقاده از تریپسین، پاساژ داده شدند و پس از گذشت یک هفته کلونی‌های شبیه سلول‌های بنیادی جنینی موشی ظاهر شدند و از آن‌ پس، هر دو روز یک بار پاساژ داده شدند. (شکل 1، ج). ارزیابی میزان تولید رده‏های سلول‌های بنیادی جنینی در حضور R2i نشان داد که در تکرارهای مختلف، بیش از 50 درصد بلاستوسیست‌های پارتنوژنتیک منجر به تولید رده‏های سلول‏های بنیادی شدند (جدول 2). این نتایج نشان می‏دهد که مهار هم‏زمان مسیر پیام رسانی ERK و MEK شرایط مناسبی را برای تولید سلول‏های بنیادی از جنین‏های پارتنوژنتیک فراهم می‌کند.

 

 

جدول 1: بازده ایجاد بلاستوسیست های پارتنوژنتیک در حضور فعال کننده‌های مختلف

فعال‌کننده

تعداد تخمک

تعداد دژنره (%)

 تعداد دوسلولی (%)

 تعداد هشت سلولی/مورولا (%)

تعداد بلاستوسیست (روز چهارم)

اتانل 5 درصد (M16)

۲۰

۲۰(۱۰۰)

۰

۰

۰

استرانسیم5mM  (M16)

۲۰

۲(۱۰)

۱۸(۹۰)

۸(۴۰)

۱(۵)

استرانسیم5mM (R2i)

۲۰

۵(۲۵)

۱۵(۷۵)

۰

۰

استرانسیم5mM  +EGTA2mM  (M16)

۲۰

۲(۱۰)

۱۸(۹۰)

۱۲(۶۰)

۲(۱۰)

 

جدول 2: بازده ایجاد بلاستوسیست‌های پارتنوژنتیک و رده‌های سلولی پارتنوژنتیک

گروه

تعداد تخمک

تعداد بلاستوسیست

تعداد رده سلولی

درصد بلاستوسیست/ تخمک

درصد رده سلولی/ بلاستوسیست

۱

۷۰

۱۲

۶

۱۷

۵۰

۲

۷۰

۱۰

۵

۱۴

۵۰

۳

۸۰

۱۱

۶

۱۳

۵۴

۴

۹۰

۱۲

۷

۱۳

۵۴

۵

۵۰

۸

۳

۱۶

۳۷

۶

۷۰

۱۱

۷

۱۵

۶۳

 

 

ویژگی سلول‌های بنیادی جنینی موشی تولید شده در حضور R2i: تمام رده‌های سلول‌های بنیادی جنینی موشی تولید شده، تا 10 پاساژ بر روی ژلاتین و در شرایط بدون لایه تغذیه ‌کننده در محیط N2B27 حاوی PD+SB تکثیر شدند. تمام رده‌های سلول‌های بنیادی ویژگی پاساژ ‏پذیری با استفاده از تریپسین، نسبت بالای هسته نسبت به سیتوپلاسم و رشد کلونال (از یک سلول منفرد) را نشان می‌دادند. از بین رده سلول‌های بنیادی جنینی، دو رده PmESC1 و PmESC8 برای ارزیابی‌های بیشتر انتخاب شدند. سلول‌های هر دو رده، فعالیت بالای آنزیم آلکالین فسفاتاز را نشان دادند و مارکر سطحی SSEA1 و فاکتورهای نسخه‌برداری Oct4 و Nanog را در سطح پروتئین (شکل2، الف) و mRNA بیان می‌کردند   (شکل2، ب). پتانسیل تمایزی سلول‌های رده PmESC1 در شرایط In vitro، با تمایز خودبه‌خودی به‌واسطه تشکیل اجسام شبه جنینی نشان داده شد. (شکل3، الف). رنگ‌آمیزی ایمونوفلورسانس نشان داد که سلول‌های PmESC1 تکثیر شده در محیط N2B27+R2i توانایی ایجاد مشتقات اندودرمی (کبد، αFP+)، مزودرمی (قلب، αMHC+) و اکتودرمی (عصب، Map2+) را دارا می‌باشند (شکل3، الف). همچنین بیان فاکتورهای نسخه‌برداری ویژه سلول‌های تمایز یافته، شامل Nestin  (اکتودرم)، Gata4 (مزودرم) و Albumin (اندودرم) در سلول‌های تمایز یافته هر دو رده PmESC1 و PmESC8 به‌وسیله RT-PCR مورد تایید قرار گرفت (شکل3، ج). توانایی تمایزی سلول‌های این دو رده در شرایط In vivo با بررسی تشکیل تراتوما مورد ارزیابی قرار گرفت. بررسی بافتی، وجود مشتقات هر سه لایه زاینده جنینی را در تراتوما اثبات کرد ( شکل3، ب). بنابراین سلول‌های بنیادی جنینی موشی که از بلاستوسیست‌های پارتنوژنتیک تولید شده بودند ازنظر بیان مارکر و پتانسیل تمایزی، پرتوان بودند.

 

 

 

 

 

شکل 2: بیان مارکرهای پرتوانی در سلول‏های بنیادی جنینی مشتق شده از بلاستوست‌های پارتنوژنتیک. الف) بیان آنزیم آلکالین فسفاتاز، پروتئین سطحی SSEA1 و فاکتورهای نسخه‏برداری Oct4  و Nanog توسط سلول‏های بنیادی جنینی رده PmESC1 و PmESC8. رنگ‌آمیزی هسته با DAPI انجام شده است. علامت اندازه معادل 200 میکرومتر است. ب) نتایج RT-PCR فاکتورهای نسخه‌برداری پرتوانی Oct4 و Nanog توسط سلول‏های ‌بنیادی جنینی رده PmESC1 و PmESC8. سلول‏های ‌بنیادی رده Royan B20 به‏عنوان کنترل مثبت مورد استفاده قرار گرفتند.

 

شکل 3: پتانسیل پرتوانی سلول‌های بنیادی جنینی موشی مشتق شده از بلاستوسیت‌های پارتنوژنتیک در شرایط In vitro و In vivo. الف) تشکیل اجسام شبه‌جنینی از سلول‏های بنیادی جنینی رده PmESC1 و رنگ آمیزی ایمونوفلورسانس بعد از تمایز خودبه‏خودی این سلول‏ها برای مارکرهای Map2 (عصب، اکتودرم)، αMHC (قلب، مزودرم) وαFP (کبد، اندودرمی). علامت اندازه معادل 200 میکرومتر است. ب) تشکیل تراتوما به‏واسطه تزریق زیر پوستی سلول‏های بنیادی جنینی رده PmESC1 و رنگ‌آمیزی مقاطع بافتی مشتقات سه لایه زاینده جنینی در این تراتوما. (I): روزت عصبی (اکتودرمی )، (II) : کندروسیت (مزودرم) و (III) :اپی‏تلیوم روده (اندودرم). ج) نتایج RT-PCR بیان ژن‏های تمایزی Nestin (اکتودرم)، GATA4 (مزودرم) و Albumin (اندودرم) توسط سلول‏های حاصل شده به‏واسطه تمایز خودبه‏خودی سلول‌های بنیادی رده PmESC1 و PmESC8. سلول‏های حاصل از تمایز خودبه‏خودی سلول‏های بنیادی رده Royan B20 به‏عنوان کنترل مثبت مورد استفاده قرار گرفتند.

 

تشخیص و تعیین سلول‌های بنیادی هاپلوئید

برای بررسی و تعیین میزان سلول‌های هاپلوئید موجود در جمعیت هر دو رده PmESC1 و PmESC8، میزان DNA هاپلوئیدی در پاساژ چهارم به‌وسیله دستگاه فلوسایتومتری مورد سنجش قرار گرفت. سلول‌های بنیادی جنینی موشیRoyan B20 که از بلاستوسیست‌های طبیعی (لقاح یافته) تولید شده بودند به‏عنوان کنترل (سلول‌های دیپلوئید واقعی) استفاده شدند. نتایج نشان داد دو رده سلولی PmESC1 و PmESC8، نسبت به رده سلولی Royan B20، به‏ترتیب دارای 10 و 12 درصد سلول‌های هاپلوئیدی هستند (شکل4).

 

 

شکل 4: بررسی میزان DNA هاپلوئیدی در سلول‌های بنیادی جنینی رده سلولی PmESC1 و PmESC8 در مقایسه با Royan B20 به‏عنوان کنترل         (100 درصد دیپلوئید)

                                     

 

بحث

استفاده از سلول‌های بنیادی پرتوان برای مقاصد و اهداف گوناگون در دنیای پزشکی روزبه‌روز بیشتر می‌شود. مهم‌ترین کاربرد بالقوه این سلول‌ها در پزشکی ترمیمی است که ازجمله می‌توان به ترمیم بافت‌های آسیب ‌دیده قلب، بافت‌های استخوانی، ضایعات عصبی، سوختگی‌ها و ضایعات پوستی اشاره کرد. ازجمله محدودیت‌های عمده پیش روی محققان در استفاده از سلول‌های بنیادی جنینی پرتوان، پس‌زدگی این سلول‌ها در پیوند سلولی است؛ زیرا آنتی‌ژن‌های سازگاری نسجی این سلول‌ها با شخص گیرنده یکی نبوده است و احتمال پس‌زدگی آن‌ها بالا می‌رود (18). استفاده از جنین‌های پارتنوژنتیک مزایای منحصربه‌فردی دارد. جنین‌های پارتنوژنتیک منبع توانمندی از سلول‌های بنیادی دارای سازش‌پذیری بافتی هستند و دشواری‌های ناشی از تطبیق بافت جهت پیوند را به‏میزان زیادی کاهش می‌دهند. در این‏صورت می‌توان هموزیگوتی را به‌عنوان یک مزیت تلقی کرد، زیرا باعث کاهش ایمنی‌زایی مشتقات یک سلول بنیادی می‌شود و احتمال تولید سلول‌های بنیادی هموزیگوت برای تعداد زیادی از فنوتیپ‌های قابل تطبیق موجود برای یک پیوند را به‌طور معنی‏داری افزایش می‌دهد (19). به‏علاوه از هموزیگوت بودن می‌توان برای انتخاب رده‌های سلولی دارای ژن‌های پاسخگو به دارو، ژن یک بیماری و یا ژن سرطانی استفاده کرد که ابزار تحقیقاتی مفید برای آزمایش دارو و بهبود اثرات آن است. البته نباید خطرات جدی هموزیگوت بودن را نادیده گرفت. فقدان هتروزیگوت می‌تواند هر نوع نقص ژنتیکی بالقوه حاضر در ژنوتیپ را تقویت و بروز دهد و در نتیجه می‌تواند محدودیت جدی را در پی داشته باشد. در مطالعه حاضر شرایط کشت جدیدی برای تولید رده سلولی پرتوان از جنین‌های پارتنوژنتیک معرفی ‌شده است. در این مطالعه سلول‌های بنیادی جنینی پارتنوژنتیکی موشی از جنین‌های پارتنوژنتیکی فعال ‌شده با استرانسیم تولید و نگه‏داری شدند. بر اساس مطالعات انجام‌شده، امروزه روش‌های فعال‌سازی مصنوعی تخمک بسیار زیاد است. این روش‌ها شامل تحریک‌های الکتریکی، شیمیایی و مکانیکی است (13). اغلب این عوامل سبب افزایش یکنواخت کلسیم درون‌سلولی می‌شوند. در بین آن‌ها استرانسیم کلراید برخلاف دیگر القاکننده‌ها به‌صورت متوالی و مکرر باعث افزایش نوسانات کلسیمی می‌شود که شبیه ورود اسپرم به تخمک است. استفاده از غلظت 5 میلی‌مولار استرانسیم به‏همراه غلظت 2 میلی‌مولار EGTA به‌عنوان بهترین فعال‌کننده تخمک معرفی ‌شده است (14). نتایج مطالعه حاضر نیز موافق با یافته فوق بود، به‏‌طوری‌که 10 درصد تخمک‌های فعال‌شده با استرانسیم و EGTA به مرحله بلاستوسیست رسیدند که بهترین بازده تولید بلاستوسیست‌های سالم بود. یکی از مشکلات عمده تولید سلول‌های بنیادی جنینی بازده پایین آن است. در این خصوص محققین با دست‌کاری مسیرهای پیام‌رسانی با استفاده از کوچک مولکول‌ها توانستند رده‌های سلولی موردنظر را با کارایی بالا تولید کنند (20 و 21). به‏کار بردن کوچک مولکول‌ها در تولید سلول‌های بنیادی جنینی نمایانگر تاثیر و کارایی آن‌ها در حفظ پرتوانی و فرآیندهای مختلف زیستی است. استفاده از این مولکول‌ها، نسبت به‏روش‌های ژنتیکی برای ایجاد تغییر در یک سلول ازنظر زمان، سختی کار و هزینه مقرون‌ به‌صرفه است (22). محیط کشت بهینه در سطح بین‌المللی برای تولید و نگه‏داری رده‌های پرتوان موشی متشکل از دو بازدارنده‌ی مسیرهای MEK و GSK3 است که تحت عنوان محیط 2i شناخته ‌شده است. یکی از چالش‌های اصلی این محیط عمل‏کرد منفی مهار GSK3 بر حفظ تمامیت ژنومی است. عامل اصلی از دست رفتن تمامیت ژنومی در این مسیر مولکول APC است. مولکول APC یکی از مولکول‌های شناخته ‌شده مهم در مسیر اصلی Wnt است. همچنین نشان داده ‌شده است که مهارکننده‌های GSK3 باعث جلوگیری از جدا شدن کروموزوم‌ها می‌شوند که این اثر با استفاده از ابزار RNAi مطالعه و اثبات ‌شده است (23). اخیرا روش جدیدی را برای تولید موثر سلول‌های بنیادی جنینی از نژادهای مقاوم به تولید رده معرفی‌ شده است که در آن کوچک مولکول بازدارنده‌ی مسیر GSK3 با یک کوچک مولکول دیگر که کاریوتایپ سلول را متاثر نمی‌کرد استفاده کردند. در این روش، به‌کارگیری کوچک مولکول‌های PD0325901 و SB431542 که به‏ترتیب مهارکننده مسیرهای تمایزی MAPK و TGFβ هستند (تحت عنوان Royan 2 inhibitors یا R2i)، به تولید بسیار موفق رده‌های پرتوان سلولی بنیادی جنینی از نژادهای NMRI، BALB/c، C57BL/6، DBA/2 و FVB/N که همگی مقاوم به تولید رده سلولی تحت شرایط متعارف هستند، منجر شد (16 و 21).

رده‌های سلولی مشتق از جنین‌های پارتنوژنتیک هاپلوئیدی اولین بار تحت شرایط عاری ازسرم و روی لایه تغذیه‌ کننده، در حضور 2i  تولید شده است (10). نتایج مطالعه حاضر نشان داد که محیط کشت عاری ازسرم، حاوی R2i می‌تواند به‌عنوان یک روش بسیار موثر برای تولید رده‌های سلولی بنیادی جنینی پرتوان از جنین‌های پارتنوژنتیک موش در بستر کشت ژلاتینی مورد استفاده قرار گیرد. در این مطالعه حدود 500 تخمک، به‌منظور تولید رده سلولی، مورد استفاده قرار گرفت. بعد از فعال‌سازی، حدود 17 درصد از تخمک‌ها به مرحله بلاستوسیست، رسیدند و 50 درصد از بلاستوسیست‌ها، رده سلولی پرتوان تولید کردند. سلول‌های بنیادی جنینی تولید شده در این مطالعه، ازنظر ریخت کلونی و سلولی (نسبت هسته به سیتوپلاسم بالا) کاملا مشابه با سلول‌های بنیادی جنینی حاصل از بلاستوسیست معمولی بودند. این سلول‌ها در محیط آزمایشگاه تا بیش از ده پاساژ پیش رفتند که نشان از تکثیر پذیری آن‌ها است. همچنین این رده‌ها، مارکرهای خاص بنیادینگی از قبیل Oct4، Nanog، SSEA1 و ALP را بیان کردند. تمایز خودبه‌خودی برای دو رده، توانایی تمایز و تولید دودمان‌های سه لایه زایای جنینی اکتودرم، مزودرم، و اندودرم را نشان داد. بنابراین، تغییر مورفولوژی سلول‌ها و همچنین بیان ژن‌های تمایزی و تشکیل تراتوکارسینوما به‌عنوان آزمایش تکمیلی حاکی از پرتوانی سلول‌های بنیادی تولید شده از جنین‌های پارتنوژنتیک بود.

 

نتیجه گیری

ارزیابی سلول‌های بنیادی تولیدشده در این مطالعه نشان داد که در حدود 10 تا 12 درصد از جمعیت سلولی هاپلوئیدی بودند. این درصد در مقایسه با اولین گروهی که موفق به تولید رده سلولی پرتوان هاپلوئیدی روی سلول‌های تغذیه‌کننده با بازده 10درصد شده بودند، درصد قابل‌تاملی بود (10). با توجه به اهمیت رده‌های سلولی پرتوان هاپلوئیدی در مطالعات ژنتیکی، به نظر جداسازی و نگه‏داری جمعیت‌های هاپلوئیدی می‌تواند در پیشبرد مطالعات بعدی بسیار پر اهمیت باشد.

 

تشکر و قدردانی

هزینه‌ انجام این طرح توسط پژوهشگاه رویان تامین‌ شده است.

1. Evans MJ, Kaufman MH, Establishment in culture of pluripotential cells from mouse embryos. nature. 1981; 292(5819): 154-156.

2. Martin, GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A. 1981; 78(12): 7634-8.

3. Ebert AD, Svendsen CN. Human stem cells and drug screening: opportunities and challenges. Nat Rev Drug Discov. 2010; 9(5): 367-72.

4. Murry CEKeller G. Differentiation of embryonic stem cells to clinically relevant populations: lessons from embryonic development. Cell. 2008; 132(4): 661-80.

 

5. Li W, et al. Androgenetic haploid embryonic stem cells produce live transgenic mice. Nature, 2012;490(7420): 407-11.

6. Hong Y. Medaka haploid embryonic stem cells. Methods Cell Biol. 2010; 100: 55-69.

7. Mortensen R. Overview of gene targeting by homologous recombination. Curr Protoc Neurosci. 2007; Chapter 4: p. Unit 4 29.

8. Pettitt SJ, et al. A genetic screen using the PiggyBac transposon in haploid cells identifies Parp1 as a mediator of olaparib toxicity. PLoS One, 2013. 8(4): e61520.

9. Yi M, Hong N, Hong Y. Generation of medaka fish haploid embryonic stem cells. Science. 2009; 326(5951): 430-433.

10.  Leeb M, Wutz A. Derivation of haploid embryonic stem cells from mouse embryos. Nature. 2011; 479(7371): 131-4.

11. Yang H, et al. Generation of haploid embryonic stem cells from Macaca fascicularis monkey parthenotes. Cell research. 2013; 23(10): 1187-1200.

12. Li W, et al. Genetic modification and screening in rat using haploid embryonic stem cells. Cell Stem Cell. 2014; 14(3): 404-14.

13. Marcus GJ. Activation of cumulus-free mouse oocytes. Mol Reprod Dev. 1990; 26(2): 159-62.

14. Kishigami S, Wakayama T. Efficient strontium-induced activation of mouse oocytes in standard culture media by chelating calcium. Journal of Reproduction and Development, 2007. 53(6): 1207-1215.

15. Wu B, et al. Stem cells and small molecule screening: haploid embryonic stem cells as a new tool. Acta Pharmacol Sin. 2013; 34(6): 725-31.

16. Hassani SN, et al. Inhibition of TGFbeta signaling promotes ground state pluripotency. Stem Cell Rev. 2014; 10(1):16-30.

17. Baharvand H, Hassani SN. A new chemical approach to the efficient generation of mouse embryonic stem cells. Methods Mol Biol. 2013; 997: 13-22.

18. Lindvall O, Kokaia Z. Stem cells for the treatment of neurological disorders. Nature. 2006; 441(7097): 1094-6.

19. Lin H, et al. Multilineage potential of homozygous stem cells derived from metaphase II oocytes. Stem Cells. 2003; 21(2): 152-161.

20. Ying QL, et al. The ground state of embryonic stem cell self-renewal. Nature. 2008; 453(7194): 519-23.

21. Hassani SN, et al. Simultaneous Suppression of TGF-β and ERK Signaling Contributes to the Highly Efficient and Reproducible Generation of Mouse Embryonic Stem Cells from Previously Considered Refractory and Non-permissive Strains. Stem Cell Reviews and Reports. 2012; 8(2): 472-481.

22. Xu Y, Y. Shi, Ding S. A chemical approach to stem-cell biology and regenerative medicine. Nature. 2008; 453(7193): 338-344.

23. Tighe A, et al. GSK-3 inhibitors induce chromosome instability. BMC Cell Biol. 2007; 8(1): 34.