فصلنامه

نوع مقاله : علمی - پژوهشی

نویسندگان

1 کارشناسی ارشد، گروه ژنتیک و تولید گیاهی، دانشکده کشاورزی، دانشگاه ولی‌عصر (عج) رفسنجان، ایران

2 دکتری تخصصی، گروه ژنتیک و تولید گیاهی، دانشکده کشاورزی، دانشگاه ولی‌عصر (عج) رفسنجان، ایران

چکیده

هدف: هدف از این تحقیق بررسی اثر عوامل تاثیرگذار بر القای ریشه مویین و بررسی میزان تولید آلکالوئیدهای ایندولی در ریشه­های مویین تولید شده در اثر تلقیح گیاه پروانش با Agrobacterium rhizogenes بود.
مواد و روش­ها: از گیاهچه استریل پروانش جهت تهیه ریزنمونه استفاده شد. اثر نوع محیط کشت، ریزنمونه، سویه باکتری و ژنوتیپ گیاه بر میزان القای ریشه مویین بررسی شد. میزان آلکالوئیدهای ایندولی با استفاده از دستگاه HPLC اندازه­گیری شد. ماهیت تراریختگی ریشه­های مویین با استفاده از روش PCR و پرایمرهای اختصاصی تایید گردید.
نتایج: سویه A4 به‫عنوان بهترین سویه A. rhizogenes جهت القای ریشه مویین و محیط کشت MS به‫عنوان بهترین محیط کشت برای توسعه و استقرار کشت ریشه مویین در ژنوتیپ سفید پروانش تعیین شدند. نتایج حاصل از تکثیر اختصاصی ژن‌های rolB و virD نشان دهنده ماهیت تراریختی ریشه‌های مویین بود. به‫طور کلی مقدار وین­دولین و کاتارانتین ریشه­های مویین بیشتر از ریشه معمولی و اندام‌ هوایی گیاه پروانش بـود. از طرفـی، مقـدار این آلکالوئیـدها در اندام هوایی گیاه از ریشه معمولی بـالاتر بـود.
نتیجه­گیری: به‫نظر می­رسد با ورود ژن­های rol از باکتری به ژنوم گیاه و ایجاد ریشه مویین و در نتیجه تغییر در میزان تولید هورمون­های درونزا و پاسخ­های سلول گیاهی به ورود ژن­های باکتری، میزان و پروفایل تولید متابولیت­های ثاتویه گیاه تغییر پیدا می­کند و در نتیجه می­توان با گرینش کلون­هایی با افزایش تولید آلکالوئیدهای مهم دارویی و بهینه سازی شرایط تولید انبوه متابولیت­ها در بیوراکتورها، به سمت تولید تجاری این ترکیبات از طریق کشت سلول و بافت گیاهی حرکت کرد.

تازه های تحقیق

-

کلیدواژه‌ها

dor -

عنوان مقاله [English]

Optimization of hairy root induction and producing high vindoline and catharanthine clones in Catharanthus roseus through Transformation by Agrobacterium rhizogenes

نویسندگان [English]

  • V Kardoost Parizi 1
  • M Mahmoodnia Meimand 2

1 Faculty of Agriculture, Vali-e-Asr University of Rafsanjan. Iran

2 Department of Genetics and Plant Production, Faculty of Agriculture, Vali-e-Asr University of Rafsanjan. Iran

چکیده [English]

Aim: Hairy roots induced by inoculation with Agrobacterium rhizogenes are suitable for the production and accumulation of plant secondary metabolites. Genetically modified hairy roots produce valuable secondary metabolites to a greater amount and with more genetic stability than cell suspension cultures and normal roots. Catharanthus roseus is one of the most important medicinal plants that produces valuable secondary metabolites such as indole alkaloids. The purpose of this research was to investigate the effect of factors influencing the induction of hairy roots and to investigate the amount of production of secondary metabolites (vindoline and catharanthine) in the hairy roots produced by inoculation of C. roseus plant with A. rhizogenes.
Material and Methods: In order to produce sterile C. roseus seedlings and to prepare explants, seeds cultured on MS culture medium. The effect of the type of culture medium (MS, 1/2 MS and B5), the type of explant (leaf and stem), the type of bacterial strain (A4, 1132 and 2656) and the type of plant genotype (white and red) on the amount of hairy root induction in a completely randomized design was investigated. Extraction of samples was done using methanol solvent, then the amount of indole alkaloids was calculated using HPLC method and standard curve. The nature of transgenic hairy roots was confirmed after DNA extraction from different samples using PCR method with specific primers (rolB and virD).
Results: According to the results, the most efficient strain in transferring T-DNA to the explants and the appearance of hairy roots was related to A4 strain (53.8%). 1/2 MS culture medium with 77.69% of root induction was the best medium combination for the appearance of hairy roots. Also, white genotype (62% rooting) and leaf explant (77% rooting) were identified as the best genotype and explant for the production of hairy roots. After the specific amplification of the rolB gene and the lack of amplification of the virD gene in the PCR reaction in the samples, the molecular confirmation of the transgenic nature of the hairy root clones was done. Based on the results of HPLC experiment, the average amount of vindoline and catharanthine in hairy roots (0.24 and 0.615 mg/g dry weight) is higher than aerial parts (0.106 and 0.488 mg/g dry weight) and normal root (0.021 and 0.013 mg/g dry weight). The amount of these alkaloids in the aerial parts was higher than in the normal roots of the plant.
Conclusion: The production of hairy roots in response to the inoculation of plant explants with A. rhizogenes is influenced by various factors such as the type of explant, the genotype of the plant, the strain of bacteria and the composition of culture medium. These factors must be optimized to establish effective hairy root cultur in a plant. It seems that with the introduction of rol genes from bacteria to the plant genome (hairy root) and as a result of the change in the amount of endogenous hormone production and the response of the plant cell to the entry of bacterial genes, the amount and profile of the production of the secondary metabolites of the plant will change. As a result, by selecting clones with increased production of medicinally important alkaloids and optimizing the conditions of large scale production of secondary metabolites in bioreactors, we can move towards the commercial production of these compounds through cell and plant tissue culture.

کلیدواژه‌ها [English]

  • Agrobacterium rhizogenes
  • Catharanthus roseus
  • HPLC
  • Secondary metabolites
  • مقدمه

در پیکر گیاهان دارویی مواد خاصی ساخته و ذخیره می‌شود که دارای خواص متعددی هستند و می‌توانند به‫عنوان مواد موثره برای مداوای برخی از بیماری­ها مورد استفاده قرار گیرند. مواد فعال مذکور که در طی یک سلسله فرایندهای ویژه و پیچیده بیوشیمیایی، به مقدار بسیار کم، معمولا کمتر از یک درصد وزن خشک گیاه ساخته می‌شوند به متابولیت­های ثانویه معروف­اند (1).

پروانش (Catharanthus roseus) یکی از گیاهان دارویی مهم و از تیره خرزهره (Apocynaceae) می‌باشد. مهم‌ترین ترکیبات ثانویه در گیاه پروانش‌، آلکالوئیدهای نوع ایندولی هستند که با توجه به ساختمان مولکولی‌شان به دو دسته آلکالوئیدهای مونومر (کاتارانتین، وین‌دولین و ...) و دیمر (وین‌بلاستین و وین‌کریستین) تقسیم می‌شوند. مقادیر بسیار پایین آلکالوئیدها در گیاه و اهمیت آن‫ها به‫عنوان داروهای پر مصرف ضد­سرطان سبب شده است که این ترکیبات از قیمت بسیار بالایی برخوردار گردند. ارزش دارویی و اقتصادی این آلکالوئید، موجب تشویق محققان برای بررسی روش‌های جدید سنتز و مطالعه راه‌های بیوتکنولوژیکی برای تولید این ماده مهم در گیاه شده است (2). عوامل موثر بر افزایش بیوسنتز وین‌بلاستین و وین‌کریستین و یا مونومرهای آنها نظیرکاتارانتین و وین‌دولین همواره از اهداف مهم تحقیقاتی محسوب می‌شود‌. بهبود فعالیت و جهت‌دهی مسیر بیوسنتز متابولیت‌ها در سلول‌های گیاهی، از اهداف اصلی دانش مهندسی متابولیک محسوب می‌شود. تکمیل، ترسیم و تفسیر جامع نقشه‌های متابولیکی، امکان دست­ورزی و مطالعه بهتر مسیرهای بیوسنتزی در گیاهان را برای محققان فراهم می‌کند (3)‌. تکنولوژی DNA نوترکیب و انتقال ژن به‫واسطه Agrobacterium عمده‌ترین تکنیک‌هایی هستند که در مهندسی متابولیک برای ایجاد گیاهان هدف واجد صفات مورد نظر استفاده می‌شوند.

باکتری Agrobacterium rhizogenes یک باکتری خاک‫زی است که موجب تولید ریشه مویین در محل زخم می‌شود. انتقال T-DNA از پلاسمید Ri این باکتری به سلول‌های گیاهی باعث تولید ریشه‌های مویین می‌شود (4). یکی از روش­هایی که امروزه در زمینه بررسی متابولیت‌های گیاهی مورد توجه قرار دارد، روش کشت اندام، بافت یا سلول گیاهی است. محققان با استفاده از این روش سعی کرده‌اند تا تولید متابولیت‌های با ارزش درگیاهان را افزایش دهند. در کشت سلول و بافت، به ویژه در مراحل قبل از تمایز بافت‌ها و اندام‌ها، ممکن است میزان تشکیل برخی از متابولیت‌ها با گیاه کامل تفاوت داشته باشد و آنزیم‌هایی که مسیر بیوسنتزی متابولیت‌ها را در گیاه کنترل می‌کنند، در کشت سلول در مقایسه با گیاه فعالیت یکسانی نداشته باشند. از آنجایی که محل بیوسنتز تعدادی از آلکالوئیدها ریشه است، دست­ورزی ژنتیکی با استفاده از A. rhizogenes، در فنون کشت بافت و بیوتکنولوژی، برای تولید این متابولیت‌ها از اهمیت زیادی برخوردار است (5)‌‌. استفاده از A. rhizogenes و کشت ریشه‌های مویین به‫علت رشد سریع، کاهش زمان تولید، سهولت نگه‫داری و توانایی سنتز گستره‌ای از ترکیبات شیمیایی، مزیت‌های بیشتری را به‫عنوان یک منبع پیوسته برای تولید متابولیت‌های ثانویه ارزشمند ایجاد می‌نماید. علاوه بر این، ریشه‌های مویین یک سیستم مدل ارزشمند برای ارزیابی، توسعه و کاربرد اصول مهندسی ژنتیک در گیاهان هستند (6). ریشه‌های تراریخته از قابلیت باززایی گیاهان کامل برخوردارند. با وجود این که گیاهان باززایی شده دچار تغییرات مورفولوژیکی و فیزیولوژیکی متعددی از جمله برگ‌های چروکیده و کوچک‌تر، کاهش غالبیت انتهایی و کوتاه شدن میان گره‌ها می‌شوند، اما ثبات ژنتیکی آن‫ها بسیار مطلوب است (7). برای استفاده از A. rhizogenes در انتقال ژن به گیاهان، موارد آزمایشی مختلفی باید بهینه شوند. این موارد عبارتند از شرایط محیط کشت، پیدا نمودن یک نژاد Agrobacterium که ژنوتیپ گیاهی مورد نظر را به‫نحو مطلوب آلوده نماید، طراحی و ساخت T-DNA تغییریافته‌ای که امکان بیان ژن در سلول‌های گیاهی را فراهم نماید، انتقال T-DNA تغییریافته به نژاد Agrobacterium انتخاب شده، انتقال T-DNA توسط Agrobacterium به گیاه با فراوانی زیاد و در نهایت گزینش سلول‌های گیاهی تراریخته و باززایی گیاه از آنها (8)‌. فرایند ترانسفورماسیون بافت‌های گیاهی و القا ریشه مویین در آن­ها تحت تاثیر عوامل مختلفی قرار می‌گیرد که شامل گونه، سن و نوع بافت گیاهی و وضعیت فیزیولوژیکی آن‌، نوع نژاد Agrobacterium و غلظت سوسپانسیون باکتریایی است. امروزه کشت ریشه‌های مویین به‫دلیل سرعت رشد بالا و افزایش تولید متابولیت‌های ثانویه در برخی از گونه‌های گیاهی جهت تولید متابولیت‌های ثانویه مورد استفاده در صنایع داروسازی، آرایشی و بهداشتی و افزودنی‌های خوراکی انجام می­گیرد (9)‌‌‌. در تحقیق حاضر تاثیر سویه‌های مختلف باکتری A. rhizogenes و محیط هم کشتی برای القا و رشد ریشه‌های مویین در دو ژنوتیپ و دو ریزنمونه از گیاه دارویی پروانش بررسی شد و میزان تولید آلکالوئیدهای ویندولین و کاتارانتین در بافت­های مختلف تعیین گردید. تثبیت کشت ریشه‌های مویین در این گیاه، از نظر بررسی قابلیت‌های بیوسنتزی ریشه‌های مویین آن حائز اهمیت است.

  • مواد و روش‌ها

مواد گیاهی و تهیه ریزنمونه: به‫منظور تهیه گیاه‫چه استریل، بذور پروانش پس از ضدعفونی با الکل 70 درصد به‫مدت 30 ثانیه و شستشو با آب مقطر استریل و سپس ضدعفونی کردن با هیپوکلریت سدیم یک درصد به‫مدت 15 دقیقه و شستشو با آب استریل، در محیط کشت MS حاوی 3 درصد ساکاروز و 8/0درصد آگار کشت شدند و سپس در دمای 25 درجه سانتی‫گراد و شرایط نوری 16 ساعت روشنایی و 8 ساعت تاریکی نگه‫داری شدند. ریزنمونه‌های برگ و ساقه حاصل از گیاهچه‌های استریل (28روزه) که به مرحله چهار برگی رسیدند‌، به‫منظور تلقیح با باکتری مورد استفاده قرار گرفتند.

سویه­های باکتری و آماده سازی جهت تلقیح : به‫منظور القای ریشه‌های مویین، از باکتری A. rhizogenes سویه‌های 2656‌، 11325‌ و A4 (اهدایی از طرف دکتر علی پاکدین از پژوهشکده ژنتیک و زیست فناوری کشاورزی طبرستان) استفاده شد. به‫منظور تهیه‌ی سوسپانسیون تلقیح، سویه‌های باکتری در محیط کشت (Luria–Bertani) LB مایع حاوی 50 میلی­گرم بر لیتر آنتی­بیوتیک ریفامپسین در دمای 28 درجه سانتی‫گراد به‫صورت شبانه رشد داده شدند. کشت باکتریایی در دمای 4 درجه سانتی‫گراد و سرعت rpm 4500 به‫مدت 10 دقیقه رسوب داده شد و پلیت باکتری در محیط کشت B5 حاوی 100 میکرومولار استوسرینگون به‫آرامی حل شد. سپس ریزنمونه‌های برگ و ساقه‌ پس از جدا شدن از گیاهچه در سوسپانسیون تلقیح به‫مدت 2 دقیقه غوطه‌ور و پس از خشک شدن روی کاغذ صافی استریل، بر روی سه محیط کشت MS، MS و B5 با 7/5=pH کشت گردیدند. ظرف­های کشت حاوی ریزنمونه‌های گیاهی در تاریکی، به‫مدت 48 ساعت و در دمای 25 درجه سانتی‫گراد نگه‫داری شدند. 48 ساعت پس از انجام تلقیح، به‫منظور حذف باکتری، ریزنمونه‌ها به محیط 300 میلی­گرم بر لیتر آنتی‌بیوتیک سفوتاکسیم منتقل شدند. عمل انتقال، چند مرتبه تا حذف کامل باکتری از اطراف ریزنمونه‌ها تکرار شد.

بررسی اثر نوع محیط کشت و سویه باکتری و ژنوتیپ و ریزنمونه بر میزان القا و رشد ریشه‌های مویین: پس از ظهور ریشه‌های مویین از ریزنمونه‌های گیاه پروانش، میزان ریزنمونه‌هایی که موفق به تولید ریشه مویین شدند برای هر تیمار (محیط کشت، سویه باکتری، ریزنمونه و نوع ژنوتیپ) محاسبه و با نرم افزار SAS در قالب طرح کاملا تصادفی مورد  بررسی قرار گرفت.

میزان رشد (وزن) ریشه‌های مویین در 3 مرحله اندازه‌گیری شد. مرحله اول، زمانی که طول ریشه‌های مویین پس از تلقیح به اندازه 5 تا 10 سانتی‌متر رسیده بود و از محیط جامد به محیط مایع داخل ارلن منتقل شدند ‌(وزن تر اولیه)، دومین مرحله پس از گذشت سه ماه از رشد ریشه‌ها وزن آن­ها اندازه‌گیری شد (وزن تر نهایی) و بعد از آن ریشه‌ها در دمای 60 درجه سانتی‫گراد به‫مدت 48 ساعت در آون خشک شد و سپس وزن خشک آن­ها اندازه‌گیری شد.

استخراج DNA و تایید تراریختی ریشه­های مویین: استخراج DNA از نمونه­های ریشه مویین و ریشه معمولی به‫روشCTAB  (10) و همچنین استخراج پلاسمید به‫روشMinipreps  (11) از باکتری انجام شد. سپس برای تایید انتقال و حضور قطعه T-DNAی موجود در پلاسمید Ri A. rhizogenes به سلول­های ریشه مویین، واکنش زنجیره‌ای پلیمراز با استفاده از آغازگرهای اختصاصی ژن rolB و virD  و دستگاه PCR مدل Bio-Rad T100 انجام شد (جدول 1).

جدول 1: مشخصات آغازگرهای مورد استفاده جهت تایید تراریختی ریشه­های مویین

طول قطعه تکثیری

دمای ذوب

طول آغازگر

توالی آغازگر (¢3 ® ¢5)

نام آغازگر

421

55

19

GCTCTTGCAGTGCTAGTTT

رفت rolB

52

18

GAATGCAAGCTACCTCTC

برگشت rolB

438

65

22

ATGTCGCAAGGCAGTAAGCCCA

رفت virD

61

22

GGAGTCTTTCAGCATGGAGCAA

برگشت virD

تعداد چرخه‌های واکنش، 35 چرخه و حجم نهایی واکنش 25 میکرولیتر در نظر گرفته شد. واسرشت­سازی اولیه در دمای 94 درجه سلسیوس به‫مدت 4 دقیقه و 35 چرخه (واسرشت­سازی در دمای 94 درجه سانتی‫گراد به‫مدت 45 ثانیه، اتصال آغازگر در دمای 56 درجه سانتی‫گراد به‫مدت یک دقیقه و مرحله بسط آغازگر در دمای 72 درجه سانتی‫گراد و به یک مدت) انجام شد. 5 میکرولیتر محصول واکنش PCR با یک میکرولیتر رنگ بارگذاری بر روی ژل آگارز 5/1 درصد با بافر TBE  (نیم درصد) با ولتاژ 70 ولت به‫مدت 90 دقیقه تفکیک شد. سپس ژل حاوی رنگ Red sefe در دستگاه عکس برداری ژل مدل UVITEC مشاهده شد.

استخراج آلکالوئیدها از ریشه‌های مویین و اندام هوایی و ریشه گیاه پروانش: نمونه‌هایی شامل ریشه مویین، ریشه معمولی و اندام هوایی در آون در دمای 60 درجه سانتی‫گراد و به‫مدت 48 ساعت خشک شدند. 100 میلی­گرم پودر از هر نمونه توزین و به میکروتیوب‌های 5/1 میلی لیتری منتقل شد. از حلال متانول برای استخراج نمونه‌ها استفاده شد. به این‫صورت که به هرکدام از میکروتیوب‌های 5/1 میلی­لیتری 1 میلی­لیتر متانول خالص اضافه شد و به‫مدت 20 ساعت بر روی شیکر در دمای 25 درجه سانتی‫گراد قرار گرفتند. سپس میکروتیوب‌ها در سانتریفوژ به‫مدت 5 دقیقه با سرعت 15000 دور در دقیقه قرار گرفتند. در نهایت فاز رویی که حاوی آلکالوئیدهای استخراجی بود به میکروتیوب‌های جدید منتقل شد (12).

اندازه گیری وین‌دولین و کاتارانتین توسط HPLC: از دستگاه HPLC مدل D-14163 ساخت شرکت Knauer آلمان با آشکار ساز UV  و حجم بارگذاری 20 میکرولیتر برای اندازه‌گیری وین‌دولین و کاتارانتین استفاده شد. فاز متحرک شامل استونیتریل: فسفات بافر: استیک اسید خالص به نسبت 38: 62: 3/0 بود. از ستون C18 با قطر داخلی 4 میلی­متر و طول 300 میلی­متر به‫عنوان فاز ثابت استفاده شد. سرعت جریان فاز متحرک یک میلی­لیتر بر دقیقه و زمان حرکت هر نمونه 8 دقیقه و طول موج به کار برده شده 254 نانومتر بود (12)‌. جهت رسم منحنی استاندارد، استانداردهای وین‌دولین و کاتارانتین (خریداری شده از شرکت Sigma-Aldrich) با متانول به نسبت 10: 990 رقیق و سری رقت 2‌، 4، 8 و 16 برابر تهیه و به دستگاه تزریق شد و نهایتا پس از تنظیم و بهینه­سازی شرایط مختلف، منحنی‌ استاندارد رسم شد.

  • نتایج

مقایسه کارایی سویه‌های مختلف A. rhizogenes، نوع محیط کشت‌، ژنوتیپ و ریزنمونه گیاهی در تراریزش پروانش 

اولین ریشه‌های مویین پس از گذشت 12-10 روز از زمان تلقیح با باکتری ظاهر شدند. در مورفولوژی ریشه‌های حاصل از سویه‌های مختلف تفاوت بارزی دیده شد. به‫طوری‫که ریشه‌های مویین حاصل از سویه A4، سفید رنگ، کرکی، منشعب و دارای رشد سریع بودند. ریشه‌های حاصل از تلقیح سویه‌های دیگر در مجموع انشعابات کمتر و رشد بسیار کندتری داشتند (شکل 1). اغلب ریشه‌های مویین به‫دست آمده از دیگر سویه‌ها بعد از گذشت دو تا سه هفته بعد از ظهور، رنگ قهوه‌ای پیدا کرده و بیشتر آن‌ها به سمت کالوسی و ضخیم شدن پیش می‌رفتند. مشاهده کالوس در ریشه‌های مویین در مطالعات قبلی نیز گزارش شده است و علت آن تولید هورمون اکسین در اثر ورود برخی از ژن­های پلاسمید باکتری به ژنوم گیاه می‌باشد (13).

بر اساس نتایج تجزیه واریانس اثر تمام عامل­های مورد بررسی در سطج یک درصد معنی­دار شد. نتایج مقایسه میانگین اثر سویه‌ باکتری، محیط کشت‌، ریزنمونه و ژنوتیپ بر القای ریشه مویین در شکل 2 آورده شده است. القای ریشه مویین در ریزنمونه برگ (77 درصد) نسبت به ریزنمونه ساقه (7 درصد) برتری داشت. همچنین ژنوتیپ سفید با 62 درصد ریشه­زایی نسبت به ژنوتیپ قرمز با 38 درصد ریشه­زایی، ژنوتیپ برتر جهت القای ریشه مویین مشخص شد. سویه A4 با 8/53 درصد ریشه­زایی نسبت به سویه 11325 و 2656 (به‫ترتیب 41 و 4/1 درصد) کارایی بیشتری از خود نشان داد. سویه A4 در محیط کشت MS، بالاترین کارایی در انتقال T-DNA به ریزنمونه‌های برگ با ژنوتیپ سفید را نشان داد. محیط کشت MS با 78 درصد ریشه­زایی، بهترین ترکیب محیطی جهت ظهور ریشه‌های مویین پروانش بود. محیط کشت MS و B5 سهم کمتری در ریشه­زایی داشتند (به ترتیب 17 و 10 درصد). نتایج بدست آمده از این بررسی نشان داد که ریشه‌های مویین در پاسخ به تلقیح A. rhizogenes به برگ‌های جداسازی شده از گیاه، تولید می‌گردند. لیکن همه نژادهای باکتری در ایجاد این تراریزش طبیعی از کارآیی یکسانی برخوردار نبوده و برخی از سویه­ها مانند A4 مؤثرتر عمل می‌کنند. نتایج حاصل از بررسی قابلیت سه محیط کشتMS ، MS و B5 در حمایت از القا و تثبیت ریشه‌های مویین، حاکی از تاثیر کاملا متفاوت این محیط کشت‌ها به نفع محیط کشت MS بود. این مشاهدات نشان می‌دهد که ترکیبات محیط کشت تاثیر بسزایی بر القای ریشه‌های مویین و فراوانی آن­ها دارد (شکل 2). با توجه به نتایج اندازه­گیری وزن ریشه­های مویین در سه محیط کشت، بیشترین وزن تر و خشک ریشه‌ها مربوط به محیط کشت MS و بعد از آن، محیط MS و B5 بود (شکل 3).

 

شکل 1: الف) ظهور اولین ریشه­های مویین پس از گذشت 10 تا 12 روز بعد از تلقیح با A. rhizogenes. اثر سویه باکتری بر سرعت رشد و ظاهر ریشه‌های مویین، ب: ریشه­های مویین حاصل از تلقیح با سویهA4 ، ج: ریشه­های مویین حاصل از تلقیح با سویه 2656، د: ریشه­های مویین حاصل از تلقیح با سویه 11325

 

شکل 2: مقایسه میانگین میزان القای ریشه مویین تحت تاثیر نوع ژنوتیپ، ریزنمونه، سویه باکتری و محیط کشت. میانگین‌های دارای حداقل یک حرف مشترک در هر عامل اختلاف معنی‌داری با آزمون LSD در سطح 01/0 ندارند.

 

 

شکل 3: مقایسه رشد (وزن) ریشه‌های موئین در سه محیط کشت MS, B5 و MS. میانگین‌های دارای حداقل یک حرف مشترک در هر گروه اختلاف معنی‌داری با آزمون LSD در سطح 01/0 ندارند.

 

تایید مولکولی تراریختگی ریشه‌های مویین از طریق واکنش زنجیره‌ای پلی مراز (PCR)

در آزمون PCR با آغازگرهای اختصاصی، مشاهده باند مرتبط با ژن rolB (قطعه 421 جفت بازی) در باکتری (کنترل مثبت) و ریشه­های مویین نشان از صحت طراحی آغازگرهای مورد استفاده و تراریختی ریشه­های مویین داشت. عدم رویت باند (438 جفت بازی) مرتبط با ژن virD (خارج از T-DNAی پلاسمید Ri است و در ژنوم گیاه درج نمی‌شود) در نمونه‌های حاصل از PCR ریشه­های مویین، حاکی از عدم آلودگی ریشه‌های مویین به باکتری و حذف موفق باکتری است. عدم حضور ژن virD و حضور ژن rolB گویای این مطلب است که ریشه‌های مویین تراریخته بودند (شکل 4).

 

شکل4: آنالیز PCR جهت تایید تراریختگی ریشه‌های مویین. چاهک 1 و 9: سایز مارکر (GeneRuler 100 bp Plus)، چاهک 2، 3، 4 و 5 تکثیر ژن rolB به ترتیب مربوط به ریشه معمولی، ریشه موئین 1، ریشه موئین 2 و باکتری، چاهک 6، 7 و 8: تکثیر ژنvirD به‫ترتیب مربوط به ریشه مویین 1، ریشه مویین 2 و باکتری

 

مقایسه مقدار آلکالوئیدهای ریشه‌های مویین با ریشه معمولی و اندام هوایی

با استفاده از سری رقت استاندارد و سطح زیر منحنی مربوطه، معادله خط رسم و غلظت وین‌دولین و کاتارانتین نمونه­های مجهول بر اساس سطح زیر منحنی (در زمان نگه‫داری هر متابولیت) و معادله خط محاسبه گردید (شکل‌ 5 و 6). بر اساس محاسبات انجام شده میانگین مقدار وین‌دولین در ریشه معمولی 021/0 میلی­گرم بر گرم وزن خشک، اندام هوایی 106/0 میلی­گرم بر گرم وزن خشک و ریشه مویین 240/0 میلی‌گرم بر گرم وزن خشک ریشه برآورد شد (شکل7). مقدار وین‌دولین موجود در یکی از کلون­های ریشه مویین 5/11 برابر کلون ریشه معمولی و 1/2 برابر اندام هوایی بود. میانگین کاتارانتین موجود در کشت­های ریشه معمولی 130/0 میلی­گرم بر گرم وزن خشک، اندام هوایی 488/0 میلی­گرم بر گرم وزن خشک و در ریشه‌ مویین 615/0 میلی‌گرم بر گرم وزن خشک برآورد شد (شکل7). مقدار کاتارانتین موجود در ریشه‌های مویین 73/4 برابر ریشه معمولی و 26/1 برابر اندام هوایی بود.

 

شکل5: منحنی استاندارد. الف) وین­دولین ب) کاتارانتین

شکل 6: گراف HPLC کاتارانتین و ویندولین در عصاره یکی از کلون­های ریشه‌ مویین به ترتیب در زمان نگه‫داری 63/2 و 21/3 دقیقه

 

شکل7: مقایسه میانگین میزان وین­دولین و کاتارانتین در ریشه مویین، اندام هوایی و ریشه معمولی. میانگین‌های دارای حداقل یک حرف مشترک در هر متابولیت اختلاف معنی‌داری با آزمون LSD در سطح 01/0 ندارند.

 

  • بحث

انتقال T-DNA از آگروباکتریوم به ژنوم گیاهی فرایند پیچیده‌ای است که تحت تأثیر عوامل مختلفی نظیر سویه باکتری، دوره‌ی پیش کشتی، ژنوتیپ و نوع ریز نمونه گیاهی می‌باشد (14). بدیهی است نه تمامی سویه‌های Agrobacterium برای انتقال ژن به سلول گیاهی قابلیت بیماری­زایی دارند و نه تمامی گیاهان آماده‌ پذیرش ژن بیگانه هستند. دلیل این پدیده چندان مشخص نیست و فقط می‌توان گفت که چنین حالتی در قالب اثرات متقابل گیاه ـ پاتوژن قابل بحث است که یک واریته گیاهی پاسخ‌های متفاوتی را به نژادهای مختلف یک گونه بیماری‌زا می‌دهد. بنابراین، بهبود شرایط بیماری‌زایی، سویه مناسب باکتری و آمادگی سلول و ریزنمونه گیاهی، در افزایش احتمال انتقال T-DNA به سلول گیاهی نقش به سزایی دارد (15). یکی از عوامل مهم در القای ریشه مویین نوع سویه و خاصیت بیماریزایی باکتری است که در مطالعات قبلی نیز این موضوع ثابت شده است (16 و 17). در تحقیق حاضر سویه A4 بیشترین تاثیر در القای ریشه مویین داشت و پس از آن به ترتیب سویه 11325 و 2656 قرار داشتند. در مطالعات قبلی نیز سویه A4 بیماریزایی بالا و سویه 11325 بیماریزایی متوسط نشان داد (16). این تفاوت در بیماریزایی را می­توان به تفاوت در ژنوم باکتری و ژن­هایی از باکتری که در هنگام حمله باکتری به گیاه نقش دارند ولی وارد ژنوم گیاه نمی­شود، دانست (14). در فرایند تراریختی مکان­های ژنی مختلفی همچون ژن­های پلاسمید Ri (ناحیه T-DNA و ژن­های vir) و ژن­های بیمایزایی کروموزوم باکتری (chv) دخالت دارند. ژن­های vir و chv به ژنوم گیاه وارد نمی­شوند ولی عملکرد متفاوت این ژن­ها در سویه­های مختلف باکتری بر قدرت تراریزش باکتری موثر است (18).

یکی دیگر از عوامل موثر بر القای و تولید ریشه مویین نوع محیط کشت است. مشاهدات ما نشان داد که ترکیبات محیط کشت تاثیر بسزایی بر القای ریشه‌های مویین و فراوانی آنها دارد. دینی‌ترکمانی و همکاران نیز گزارش دادند که نوع ترکیبات محیط کشت بر میزان رشد ریشه­های موئین تاثیر معنی­دار دارد (19). به نظر می­رسد که محیط کشت MS به دلیل رقیق­تر بودن و کاهش غلظت نمک­ها، محیط مناسب­تری برای رشد و استقرار ریشه­های مویین است.

اثر نوع ریزنمونه و ژنوتیپ بر القای ریشه مویین در چندین پژوهش بررسی شده است. از جمله در تحقیقی مشخص شد در گیاه پروانش ریزنمونه برگ نسبت به ساقه جهت القای ریشه مویین (به ترتیب 88 درصد و 14 درصد) مناسب­تر است (20). این موضوع می‌تواند به دلیل نوع بافت برگ و بهتر قرار گرفتن آن روی محیط کشت و استفاده بهتر از مواد مغذی محیط و پاسخ بهتر به پاتوژن باکتری باشد که در این تحقیق برتری ریز نمونه برگ بر ریز نمونه ساقه تایید شد. همچنین در پژوهشی اثر ژنوتیپ گیاهی و سویه باکتری و اثر متقابل آنها بر تولید ریشه مویین گیاه پروانش بررسی شد که مطابق با تحقیق حاضر اثر این عوامل معنی­دار شد (21). 

در تحقیقات قبلی سه نوع مورفولوژی ریشه موئین شامل، ریشه ضخیم و رشد آهسته، ریشه نازک با رشد سریع و ریشه­هایی با ساختار معمولی و رشد متوسط مشاهده شد، با این حال، ریشه‌های نوع دوم فراوان‌تر از سایر انواع بودند (19 و 20). در این تحقیق نیز تنوع زیادی در مورفولوژی کلون‌های ریشه موئین وجود داشت که می­توان آن را به این واقعیت نسبت داد که هر کلون ریشه موئین از یک رویداد تراریختی مستقل به‫وجود آمده است. این تفاوت در مورفولوژی ریشه‌های حاصل از سویه‌های متفاوت، در آزمایش‫های قبلی نیز گزارش شده است (13 و 22).

مطابق با تحقیق حاضر، افزایش مقدار آلکالوئیدها در کشت ریشه مویین پروانش در گزارشات قبلی نیز گزارش شده است. در تحقیقی مقدار وین­کریستین در بهترین کلون ریشه موئین پروانش (442 نانوگرم بر میلی­گرم وزن تر)، 1473 برابر ریشه معمولی (3/0 نانوگرم بر میلی­گرم وزن تر) گزارش شد و مقدار کاتارانتین در ریشه­های موئین از 3/0 تا 7/0 متغیر بود ولی در ریشه شاهد کاتارانتین قابل اندازه­گیری، مشاهده نشد (20). بر حسب محل درج ژن­های ناحیه T-DNA در ژنوم گیاه و نوع ژن انتقال یافته (rolA, rolB, rolC و rolD) و تاثیری که این ژن­ها بر تغییر الگوی بیان ژن­های گیاه میزبان می­گذارند، میزان تولید متابولیت­های ثانویه در کلون­های ریشه مویین  نیز متفاوت است (27-23). در اکثر پژوهش­های انجام شده اثر مثبت انتقال ژن­های rol پلاسمید Ri به گیاه میزبان و القای ریشه مویین بر افزایش میزان متابولیت­های ثانویه گیاهی گزارش شده است (31-28) که با نتایح تحقیق حاضر مطابقت دارد.

  • نتیجه­گیری

نتایج این پژوهش نشان می­دهد که القای ریشه مویین به فاکتورهایی مانند ژنوتیپ گیاه، نوع ریزنمونه، نژاد باکتری و محیط کشت مورد استفاده وابسته است. ظهور ریشه مویین تقریبا 10 روز پس از تلقیح ریزنمونه گیاهی با باکتری
A. rhizogenes و از محل برش ریزنمونه صورت گرفت. سویه A4 و محیط کشت 1/2MS به‫ترتیب به‫عنوان بهترین سویه جهت القای ریشه مویین در گیاه پروانش و بهترین محیط کشت برای توسعه و استقرار کشت ریشه­های مویین در ژنوتیپ سفید و ریزنمونه برگ پروانش تعیین گردید.

در حال حاضر روش­های سنتزی و نیمه سنتزی در مقیاس صنعتی برای تولید آلکالوئیدهای پروانش (از جمله وین‌بلاستین، وین‌کریستین و مونومرهای آن‌ها نظیر وین‌دولین و کاتارانتین) به دلیل پیچیدگی ساختار شیمیایی آن­ها مناسب نیستند و بخش عمده این ترکیبات از طریق استخراج از این گیاه حاصل می­شود (32). از آنجا که تقاضای بسیاری برای این ترکیبات وجود دارد و میزان آنها در مواد خام اولیه استخراج شده از گیاه پروانش کم است، اهمیت مطالعه بر روی روش­هایی که تولید این ترکیبات را در گیاه افزایش دهد، چند برابر می‌شود. ریشه‌های مویین نسبت به اندام‌های هوایی و کشت کالوس متابولیت‌های ثانویه را با عملکرد بیشتر، سریع­تر و پایدارتر تولید می‌کنند (12 و 33) لذا توسعه ریز ازدیادی پروانش در محیط درون شیشه و به‫دنبال آن ایجاد و کشت ریشه‌های مویین اهمیت فراوانی دارد و شاید راه حل مناسبی برای جمع آوری مواد خام جهت بازیافت این آلکالوئیدها باشد. ریشه­های مویین دارای شرایط اختصاصی از جمله رشد سریع و منشعب، رشد در محیط بدون هورمون، پایداری از لحاظ تولید بیشتر متابولیت­ها نسبت به ریشه معمولی است (13). در این تحقیق با توجه به اهمیت دارویی و تجاری فوق العاده کاتارانتین و وین‌دولین به بررسی مزیت تولید این ترکیبات از طریق کشت ریشه مویین پرداخته شد که نتایج به­دست آمده نشان دهنده افزایش تولید این آلکالوئیدها از طریق کشت ریشه مویین در این گیاه است. بنابراین در تحقیقات آتی می­توان با بهینه­سازی شرایط کشت در مقیاس بالا در بیوراکتورها به سمت تولید تجاری این ترکیبات از طریق کشت ریشه مویین حرکت کرد.

  • تشکر و قدردانی

نویسندگان از دانشگاه ولی عصر (عج) رفسنجان به دلیل در اختیار قرار دادن امکانات آزمایشگاهی و منابع مالی و از آقای دکتر علی پاکدین از پژوهشکده ژنتیک و زیست­فناوری کشاورزی طبرستان به‫دلیل اهدای سویه­های باکتری مورد استفاده در این پژوهش سپاس­گزاری می­کنند.

-

  1. Omidbaigi R. Approarches to production and processing of medicinal plants. Behnashr Co. (the Publication of Astan Quds Razavi). 2018; 346 pp. (In Persian)
  2. Oksman-Caldentey KM, Inzé D. Plant cell factories in the post-genomic era: new ways to produce designer secondary metabolites. Trends in Plant Science. 2004; 9(9): 433-40.
  3. Bourgaud F, Gravot A, Milesi S, Gontier E. Production of plant secondary metabolites: a historical perspective. Plant Science. 2001; 39: 158-61.
  4. Giri A, Narasu ML. Transgenic hairy roots: recent trends and applications. Biotechnology Advances 2000; 18: 1-22.
  5. Dechaux C, Boitel Conti M. A strategy for overaccumulation of scopolamine in Datura innoxia hairy root cultures. Acta Biologica Cracoviensia Series Botanica. 2005; 47(1): 101-7.
  6. Hildebrand E. Life history of the hairy root organism in relation to its pathogenesis on nursery apple trees. Technology & Engineering. 1934; 110 pp.
  7. Tepfer D. Transformation of several species of highplants by Agrobacterium rhizogenes: Sexual transmission of the transformed genotype and phenotype. Cell. 1984; 37(3): 959- 67.
  8. Hu Z, Du M. Hairy root and its application in plant genetic engineering. Plant Biology. 2006; 48: 121-7.
  9. Norouzi R, Babalar M, Mirmasoumi M. Investigation of hairy root induction in some Salvia L. species. Nova Biologica Reperta. 2017; 4(2): 173-80. (In Persian)
  10. Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin. 1987; 19(1): 11-15.
  11. Green MR, Sambrook J. Preparation of Plasmid DNA by Alkaline Lysis with Sodium Dodecyl Sulfate: Minipreps. Cold Spring Harbor Protocols. 2016; 10: 911-6.
  12. Tikhomiroff C, Jolicoeur M. Screening of Catharanthus roseous secondary metabolites by high-performance liquid chromatography. Journal of Chromatography A. 2002; 955: 87-93.
  13. Pietrosiuk A, Furmanowa M, Lata B. Catharanthus roseus: Micropropagation and in vitro techniques. Phytochemistry Rrviews. 2007; 6: 459-73.
  14. Sevon N, Oksman Caldentey KM. Agrobacterium rhizogenes mediated transformation: root cultures as a source of alkaloids. Planta Medica. 2002; 68: 859–68.
  15. De Buck S, Jacobs A, Van Montagu M, Depicker A. Agrobacterium tumefaciens transformation and cotransformation frequencies of Arabidopsis thaliana root explants and tobacco protoplasts. Molecular Plant-Microbe Interactions. 1998; 11: 449-57.
  16. Mohammadi S, Haddad R, Mohammadi V. Assessment of hairy roots induction in Echium khuzistanicum by different strains of Agrobacterium rhizogenes. Agricultural Biotechnology Journal. 2020; 12(1): 63-80. (In Persian)
  17. Vanhal L, Hiltunen R, Oksman caldenty KM. Virulence of different Agrobacterium strains on hairy root formation of Hyoscyamus muticus. Plant Cell. 1995; 14: 236-40.
  18. Biswas D, Chakraborty A, Mukherjee S, Ghosh B. Hairy root culture: a potent method for improved secondary metabolite production of Solanaceous plants. Frontiers in Plant Science. 2023; 14: 1197555.
  19. Dini Torkamani MR, Abaspour N, Jafari M, samadi A. Induction and Optimization of Hairy Root Growth Condition for Valeriana officinalis L. Through Inoculation by Agrobacterium rhizogenes. Journal of Cell & Tissue. 2014; 5(1): 23-30. (In Persian)
  20. Hanafy MS, Matter MA, Asker MS, Rady MR. Production of indole alkaloids in hairy root cultures of Catharanthus roseus L. and their antimicrobial activity. South African Journal of Botany. 2016; 105: 9-18.
  21. Toivonen L, Balsevich JW, Kurz WG. Indole alkaloid production by hairy root cultures of Catharanthus roseus. Plant Cell, Tissue and Organ Culture. 1989; 18: 79-93.
  22. Zolala J, Farsi M, Gordan HR, Mahmoodnia M. Producing a high scopolamine hairy root clone in Hyoscyamus muticus through transformation by Agrobacterium rhizogenes. Journal of Agricultural Science and Technology. 2007; 9 (4): 327-39.
  23. Bulgakov VP, Veremeichik GN, Shkryl YN. The rolB gene activates the expression of genes encoding microRNA processing machinery. Biotechnology Letters. 2015; 37: 921-5.
  24. Bulgakov VP, Veremeichik GN, Grigorchuk VP, Rybin VG, et al. The rolB gene activates secondary metabolism in Arabidopsis calli via selective activation of genes encoding MYB and bHLH transcription factors. Plant Physiology and Biochemistry. 2016; 102: 70-9.
  25. Bulgakov VP, Vereshchagina YV, Bulgakov DV, Veremeichik GN, et al. The rolB plant oncogene affects multiple signaling protein modules related to hormone signaling and plant defense. Scientific Reports. 2018 8(1): 2285.
  26. Gutierrez-Valdes N, Häkkinen ST, Lemasson C, Guillet M. et al. Hairy root cultures— a versatile tool with multiple applications. Frontiers in Plant Science 2020; 11: 33.
  27. Sahandi A, Pazhouhandeh M, Mohajjel Shoja H. The effect of rolC gene on the medicinal plant Catharanthus roseus. Genetic Engineering and Biosafety Journal 2016; 5(1): 41-50. (In Persian)
  28. Chandra S. Natural plant genetic engineer Agrobacterium rhizogenes: role of T-DNA in plant secondary metabolism. Biotechnology Letters. 2012; 34: 407-15.
  29. Faraz R, Gokhale M, Gothalwa R. Hairy root culture through Agrobacterium rhizogenes for enhancement of secondary metabolites production in medicinal plants: a review. Journal of Applied Microbiology. 2020; 4: 45-58.
  30. Zhang B, Chen M, Pu S, Chen L, et al. Identification of secondary metabolites in Tripterygium wilfordii hairy roots and culture optimization for enhancing wilforgine and wilforine production. Industrial Crops and Products. 2020; 148: 112276.
  31. Veremeichik GN, Bulgakov VP, Shkryl YN, Silantieva SA. et al. Activation of anthraquinone biosynthesis in long-cultured callus culture of Rubia cordifolia transformed with the rolA plant oncogene. Journal of Biotechnology. 2019; 306: 38-46.
  32. Hisiger S, Jolicoeur M. Analysis of Catharanthus roseus alkaloids by HPLC. Phytochemistry Reviews. 2007; 6: 207-34.
  33. Miura Y, Hirata K, Kurano N. Isolation of vinblastine in callus culture with differentiated roots of Catharanthus roseus. Agricultural and Biological Chemistry. 1987; 51(2): 611-4.