فصلنامه

نوع مقاله : علمی - پژوهشی

نویسندگان

گروه زیست شناسی، دانشکده علوم، دانشگاه اراک، اراک، ایران

چکیده

هدف: دی-2-اتیل هگزیل فتالات(DEHP) به‫عنوان نرم کننده پلاستیک در صنایع غذایی و پزشکی استفاده شده و انسان‫ها با روش‫های متفاوت مانند تزریقات پزشکی در معرض این آلاینده قرار می­گیرند. قبلا اثر غلظت‫های مختلف این آلاینده بر توانایی حیات، تکثیر و تمایز سلول‫های بنیادی مزانشیم مغزاستخوان رت ویستار (BMSCs) بررسی شده است. در این پژوهش مکانیسم اثر DEHP بر ژن‫های دخیل در تمایز BMSCs به استئوبلاست بررسی شد. مواد و روش ها: در این مطالعه­ی تجربی  BMSCs در محیط استئوژنیک با غلظت‫های 0 و100 میکرومولار از DEHP  برای مدت 21 روز تیمار و از آزمون MTT جهت بررسی توانایی حیات و از آزمون آلیزارین رد، اندازه گیری فعالیت آلکالین فسفاتاز و تعیین غلظت کلسیم ماتریکس برای بررسی معدنی شدن استفاده شد. بیان ژن­های دخیل در تمایز با تکنیک RT-PCR ارزیابی شد. نتایج:  آنالیز آماری نشان داد که توانایی زیستی نیز  با کاهش معنی‫دار (42 %) مواجه شد. همچنین کاهش تولید ماتریکس بر اساس کاهش میزان آلیزارین رد، غلظت کلسیم و فعالیت آنزیم آلکالین فسفاتاز نشان داد که تمایز BMSCs به استئوبلاست در حضور DEHP کاهش معنی‫دار داشته است.  ضمنا کاهش بیان ژن­های ضروری مشاهده  شد. نتیجه­گیری:  DEHP در مدت طولانی باعث کاهش معدنی ماتریکس تولید  شده توسط  سلول‫ها شده است و در نتیجه کاهش تمایز BMSCs به استئوبلاست می‫شود. از آن‫جا که DEHP در تهیه وسایل پزشکی و ظروف غذایی استفاده می‫شود، پیشنهاد می‫شود در مصرف این ترکیب محدودیت­های قانونی اعمال شود. 

تازه های تحقیق

-

کلیدواژه‌ها

dor -

عنوان مقاله [English]

Effect of Di-2-ethylhexylphthalate on alkalinephospatase activity was due to down regulation of osteogenic related genes

نویسندگان [English]

  • Z Shayeganfar
  • MH Abnosi
  • J Sargolzaei

Department of Biology, Faculty of Sciences, Arak University, Arak, Iran

چکیده [English]

Aim: Di-2-ethylhexyl phthalate (DEHP) is used as plasticizer to produce flexible polyvinyl chloride (PVC) which is used in food and medical industries. Due to temperature change and contact with biological fluids and other liquids, DEHP leaches out from PVC. Humans get exposed to DEHP in different way including food consumption and medical utilities such as blood bags, blood transfusion tubes, syringes. At 2002, 120000 tons of DEHP has been produced in United States of America and this production was raised up to 230000 tons at 2006. In Iran, only in one of the industries called as Farabi petrochemical industries, 55000 tons of phthalate per year is produced. It has been reported that the DEHP concentration in human blood might reach to 52 to 55 µg/ml when blood is stored in polyvinyl chloride bags for two weeks.  Previously, the effect of different concentration of DEHP on viability, proliferation and differentiation of rat bone marrow mesenchymal stem cells was investigated. In the present study, effect of 100 µM (39 µg/ml) of DEHP on the expression of genes related to osteogenic differentiation of rat bone marrow mesenchymal stem cells was investigated.
Material and methods: In this experimental study, rat bone marrow mesenchymal stem cells were extracted from Wistar rats and after 3rd passage the cells cultured was performed in osteogenic media in presence of 100 µM of DEHP for 21 days. The viability of the cells was studied using 3-[4, 5-dimethylthiazol-2yl]-2, 5-diphenyl-tetrazolium bromide (MTT) assay. In addition, the osteogenic differentiation of the rat bone marrow mesenchymal stem cells was investigated using quantitative alizarin red test and calcium concentration determination. In addition, alkaline phosphatase enzyme activity as a marker of osteogenic differentiation was measured.  Expression of the osteogenic related genes (osteonectin, SMAD1، BMP2، BMP7 and RUNX2) were studied using reverse transcriptase-PCR. Data was analyzed and the minimum level of significant was considered as p<0.05.
Results: Data analysis revealed, rat bone marrow mesenchymal stem cells viability reduced significantly (p<0.05) following treatment with 100 µM of DEHP when compared to control one. Also, we observed a significant (p<0.05) reduction in matrix production based on significant reduction in alizarin red concentration as well as calcium content and alkaline phosphatase enzyme activity. In addition, a significant (p<0.05) reduction in total protein also was observed in the samples extracted from BMSCs differentiated to osteoblasts in presence of DEHP. Meanwhile, a significant (p<0.05) down regulation of osteogenic related genes was confirmed while no change (p>0.05) was observed in the expression of GAPDH.
Conclusion: based on this study, long term exposure to DEHP caused reduction in matrix production which strongly showed the osteogenic differentiation of rat bone marrow mesenchymal stem cells is affected by low concentration of this environmental pollutant. As it was observed, the concentration used in this study was lower than the concentration of this pollutant in blood bags. Therefore, if a patient gets exposed to the biological or non-biological fluids in a treatment procedure, large amount of DEHP would enter the blood circulation system. As DEHP is used in production of food containers and medical utilities such as blood tubing, blood bags, dialysis tubes in dialysis machines, we strongly suggest a legal restriction to be forced on the industrial which using this chemical as plasticizer.

کلیدواژه‌ها [English]

  • Bone marrow mesenchymal stem cells
  • Di-2-ethylhexylphthalate
  • Osteogenic differentiation
  • Collagen
  • Gene expression

مقدمه

از محصولات پلی ونیل کلرید (PVC) به‫صورت کسترده در صنایع مختلف استفاده می‫شود (1)، و استفاده از این پلیمر شیمیائی در صنایع پزشکی به‫خصوص تهیه سرنگ، لوله‫های مخصوص تزریق مایعات، کیسه‫های جمع آوری خون، کیسه‫های مخصوص نگه‫داری محصولات پالایش خون و غیره استفاده می‫شود (2 و 3). از آن‫جا که محصولات تولید شده توسط PVC سخت و شکننده هستند، برای رفع این مشکل از نرم کننده‫های شیمیائی استفاده می‫شود (3). در بین نرم کننده‫های شیمیائی، استرفتالاتها مهم‫ترین خانواده از نرم کننده‫ها شیمیائی هستند که برای تهیه محصولات PVC به آن اضافه می‫شوند (4). سالانه مقادیر زیادی از استرفتالات‫ها در دنیا تولید و مورد مصرف قرار می‫گیرند، با توجه به مطالعه انجام گرفته در ایران مشخص شده است که فتالات‫ها و متابولیت‫های آن در ادرار خانم‫های باردار که از لوازم آرایش استفاده کرده و همچنین برای حمل و نگه‫داری غذا از ظروف پلاستیکی استفاده می‫کنند بیشتر دیده شده است (5). از طرفی  در ایالات متحده آمریکا، در سال 2002 میزان 120000 تن دی اتیل هگزیل فتالات تولید شد و این مقدار در سال 2006 به میزان 230000 تن رسید (6).  درسال 2011 در کشور چین میزان 50 میلیون تن محصولات پلاستیک از PVC تولید شده است که استرهای فتالات 90 درصد نرم کننده ها استفاده شده در این محصولات را تشکیل می‫دهد (7). در میان 25 نوع مختلف از استرهای فتالات، دی اتیل هگزیل فتالات (DEHP) بیشترین استفاده در تولید محصولات صنعتی تولید شده از PVC را دارد (4). اگرچه قوانین متعددی در توقف استفاده از DEHP در آمریکا و اروپا وضع شده است، ولی در حال حاضر استفاده از این نرم کننده در صنعت پلاستیک به‫صورت روز افزونی در حال افزایش است (6).

جدای از آلودگی گسترده محیط زیست که توسط صنایع مختلف بوجود می آید (8) عمده‫ترین مشکل درخصوص استفاده از این ماده شیمیائی به آزاد سازی آن از محصولات صنعتی تولید شده از PVC بر می‫گردد. با توجه به عدم برقراری پیوند کووالانس این ترکیب با PVC، در صورت تغییر دما یا نگه‫داری مایعات و مواد غذائی در ظروف پلاستیک، این ترکیب شیمیائی به راحتی از PVC جدا و وارد مایعات و مواد غذائی می‫شود. در مطالعه انجام شده توسط رحیمی و همکاران (9) مشخص شد که با تغییر دما DEHP به آب لیموهای داخل بطری پلاستیکی انتقال پیدا می‫کنند. همچنین موذن و همکاران (10) نشان دادند که DEHP بیشترین میزان مهاجرت به نوشابه‫های داخل بطری های تولید شده از پلی اتیلن تری فتالات (PET) را در مقایسه با دیگر استرهای فتالات داشته است.  از طرفی از آن‫جا که مصنوعات متعددی در خصوص درمان، سلامت و بهداشت (سرنگ‫های تزریق، لوله های تزریق، کیسه‫های نگه‫داری خون و فراوردهای خونی، ظروف کشت سلولی، ظروف نگه‫داری لوسیون‫ها و لوازم آرایشی و بهداشتی) از PVC تولید می‫شوند، حضور DEHP در خون، ادرار، شیر مادر و دیگر مایعات بیولوژیک گزارش شده است (11). مطالعات متعددی وجود دارد که اثر سمی DEHP بر روی سلول‫های مختلف را گذارش نموده اند، در ادامه به برخی از این مطالعات اشاره می‫شود. در مطالعه Sumner و همکاران (12) مشاهده شد که DEHP باعث کاهش تحرک و شکستگی DNA در اسپرم انسان و  سگ می‫شود. همچنین مشخص شده  است که  تیمار با DEHP باعث کاهش بیان گیرنده‫های  مینرالوکورتیکوئیدها درسلول‫های لیدیگ می‫شود (13)، ضمنا نشان داده شده  است که تیمار 48 ساعته سلول‫های HepG2  با DEHP باعث افزایش تولید رادیکال‫های آزاد اکسیژِن (ROSs) و کاهش بیان پروتئین Nrf-2 در این سلول‫ها می‫شود (14). حضور این ترکیب شیمیائی در خون و خاصیت هیدروفوب آن موجب حضور DEHP در مغز استخوان را فراهم نموده به‫صورتی که می‫تواند باعث مسمومیت سلول‫های بنیادی مغز استخوان شود.

در مغز استخوان دو نوع سلول بنیادی خون‫ساز و مزانشیم وجود دارد، که به‫ترتیب مسئولیت تولید سلوهای خونی (رده میلوئیدی و لنفوئیدی) و سلول استئوبلاست به‫عهده این سلول‫های بنیادی می‫باشد (15). از آن‫جا که سلول‫های استئوبلاست مسئول تولید ماتریکس استخوان می‫باشند، مسمومیت سلول‫های بنیادی مزانشیم مغز استخوان به معنی کاهش تمایز این سلول‫ها به استئوبلاست بوده و در نتیجه می‫تواند در تولید ماتریکس استخوان اختلال ایجاد نماید. تحقیقات نشان داده است که DEHP در محیط آزمایشگاهی می‫تواند توانائی زیستی این سلول‫ها را کاهش داده و باعث توقف چرخه سلولی و القای آپوپتوزیس در سلول‫های بنیادی مزانشیم مغز استخوان رت (BMSCs) شوند. آبنوسی و علیاری (16) در مطالعه خود نشان دادند که تیمار BMSCs با غلظت‫های 5/0 تا 2500 میکرومولار DEHP در زمان‫های 12، 24 و 48 ساعت باعث کاهش معنی‫دار توانائی زیستی در زمان‫های 24 و 48 ساعت از 500 میکرومولار به‫صورت وابسته به غلظت شد. از طرفی غلظت 500 میکرومولار در 48  ساعت باعث کاهش قطر هسته و تراکم کروماتین و کوچک شدن سیتوپلاسم این سلول‫ها شد. البته آن‫ها متذکر شدند که تیمار طولانی مدت باعث شده است که غلظت 100 میکرومولار نیز باعث ایجاد مسمومیت شود به‫صورتی‫که در تیمار 7 و 14 روز این غلظت باعث کاهش تعداد و قطر کلونی‫ها شد. ضمنا تیمار 4 و 8 روز نیز باعث شد که غلظت 100 میکرومولار موجب کاهش دوبرابر شدگی جمعیت سلول‫های بنیادی  مزانشیم مغز استخوان شود. از طرفی در مطالعه دیگری آبنوسی و همکاران (17) نشان دادند که تیمار BMSCs در مدت زمان 48 ساعت، غلظت 100 میکرومولار باعث توقف چرخه سیکل سلولی در مرحله G1 شده و آپوپتوزیس وابسته با کاسپاز را نیز در این سلول‫ها القا می‫کند.

اخیرا آبنوسی و علیاری (18) نشان دادند که DEHP با القای استرس اکسیداتیو و اختلال در متابولیسم سلولی باعث کاهش تمایز BMSCs به  سلول‫های استئوبلاست می‫شود. در ادامه مطالعه آن‫ها، برای اولین بار به بررسی بیشتر بیان ژنهای دخیل در تمایز سلول‫های BMSCs به استئوبلاست پرداخته شده است تا بتوان مکانیزم این اختلال را مورد بررسی قرار دهیم.

2- مواد و روشها

در این مطالعه تجربی رت نر نژاد ویستار از انستیتو پاستور- تهران خریداری و در اتاق حیوانات دانشگاه اراک تحت شرایط استاندارد نور و دما نگه‫داری شد. ملاحظات اخلاقی: پس از کسب مجوز از کمیته اخلاق دانشگاه علوم پزشکی اراک و اخذ کد اخلاق (IR.ARAKMU.REC.1399.099) و رعایت اصول اخلاقی، موش‫های صحرائی نژاد ویستار به کمک دی اتیلن اتر بی‫هوش و بعد از قربانی شدن، استخوان‫ها ی ران و ساق پای آن‫ها جدا و پس از جدا کردن بافت‫ها‫ی پیوندی، استخوان‫ها در محیط کشت کامل شامل محیط دولباسکو ایگل مودیفاید میدیم (DEME) حاوی 15 درصد سرم جنین گاوی (FBS) و پنی‫سیلین-استرپتومایسین (PEN-STRP) قرار داده شد و به زیر هود لامینار منتقل شد. سپس دو سر استخوان با قیچی استریل قطع و مغز استخوان با تزریق محیط کشت به‫داخل استخوان (عمل فلاشینگ) خارج و به در لوله فالکون حاوی محیط کشت تخلیه شد. سپس سلول‫های استخراج شده در دور 250 g به‫مدت 5 دقیقه سانتریفیوژ  و پس از تخلیه محیط رویی و رسوب سلولی مجددا در یک میلی لیتر محیط تازه معلق و به فلاسک کشت T25 انتقال و در انکوباتور با دمای 37 درجه سانتی‫گراد و سطح اشباع 5 درصد دی اکسید کربن نگه‫داری شد. پس از 24 ساعت محیط رویی خارج و سلول‫ها با بافر فسفات نمکی (PBS)  شستشوی و در فلاسک T25  قرار داده شد. محیط کشت سلول‫ها به‫مدت 14 روز هر سه روز یک‫بار تعویض و زمانی‫که کف فلاسک با سلول‫های تک لایه پوشیده شد به‫کمک ترپسین-دی اتیل تترا استیک اسید (Trp-EDTA)، سلول‫ها جدا و مجددا در یک فلاسک T25 دیگر کشت داده شد. عمل کشت مجدد سه بار تکرار و خلوص سلول‫ها با استفاده از روش فلوسایتومتری بررسی و برای آنالیزهای بعدی استفاده شد

بررسی توانائی زیستی: برای بررسی توانایی زیستی، سلول های پاساژ سوم با تعداد 5000 سلول در پلیت 12 خانه کشت و پس از آن‫که به تراکم 70 درصد رسیدند  با غلظت 100 میکرومولار DEHP به‫مدت 21 روز با تعویض هر سه روز یک بار محیط  کشت تیمار شدند. سپس با استفاده از روش MTT فعالیت آنزیم‫های دهیدروژناز میتوکندریائی به‫عنوان شاخص متابولیک سلولی مورد ارزیابی  قرار گرفت. به‫طور خلاصه:  محیط کشت هر چاهک تخلیه و پس از شستشو با PBS، 1 میلی لیتر محیط کشت فاقد سرم به‫هر چاهک اضافه و به‫هر چاهک میزان 100 میکرولیتر محلول تترازولیوم (5 میلی‫گرم بر میلی‫لیتر PBS) اضافه و پلیت برای مدت 4 ساعت در دمای 37 درجه سانتی‫گراد نگه‫داری شد. بعد از تخلیه محیط کشت مجددا هر چاهک با PBS شستشو و سپس برای استخراج کریستال‫های فورمازان به‫هر چاهک 1 میلی‫لیتر دی متیل سولفوکساید (DMSO) اضافه و پلیت برای مدت 30 دقیقه در دمای اتاق نگه‫داری شد. 100 میکرولیتر از محلول استخراج شده به چاهک یک پلیت 96 خانه منتقل و جذب نمونه ها توسط میکروپلیت ریدر مدل (Medical SCO GmbH; Germany) در طول موج 505 نانومتر قرائت شد (1).

بررسی تمایز استئوژنیک و اندازه گیری میزان رنگ آلیزارین رد: تمایز استئوژنیک در پلیت 6 خانه و با محیط کشت کامل DMEM حاوی سدیم گلیسروفسفات (1میلی مولار)، ال-آسکوربیک اسید (50 میکروگرم بر میلی‫لیتر) و دگزامتازون (10 نانومولار) انجام شد. چاهک‫ها با غلظت 100 میکرومولار DEHP در حضور کنترل تیمار و در دمای 37 درجه سانتی‫گراد در محیط حاوی 5 درصد دی اکسید کربن به‫مدت 21 ر وز با تعویض محیط  برای هر سه روز یک‫بار نگه‫داری شد. بعد از این مدت، محیط  کشت حذف و سلول‫ها به‫مدت 15 دقیقه با فرمالدئید 10 درصد فیکس شدند. به‫هر چاهک 2 میلی‫لیتر محلول آلیزارین رد (40 میلی‫مولار، pH 2/4) اضاله و پلیت به‫مدت 40 دقیقه در دمای  اتاق نگه‫داری شد. بعد از شستشوی رنگ اضافی، تصویر برداری توسط میکروسکوپ معکوس مجهز به دوربین انجام و سپس برای اندازه گیری کمی رنگ الیزارین رد جذب  شده توسط ماتریکس، 1 میلی‫لیتر اسید اسیتیک 10 درصد به‫هر چاهک اضاقه شد. بعد از 30 دقیقه سلول‫ها توسط اسکراپر جمع آوری و در یک میکروتیوپ قرار گرفت و به‫مدت 30 ثانیه به‫شدت بهم زده شد. مقدار 200 میکرولیتر روغن معدنی به‫هر میکروتیوب  اضافه و به‫مدت 10 دقیقه در دمای 85 درجه سانتی‫گراد قرار داده شد. بلافاصله میکروتیوب‫ها خارج و به‫مدت 5 دقیقه بر روی یخ قرار داده شده و در دور 10000 g سانتریفوژ شد. مقدار 500 میکرولیتر از محلول روئی با 200 میکرولیتر محلول آمونیوم سولقات 10 درصد خنثی سازی و جذب 100 میکرولیتر از نمونه‫ها در طول موج 405 نانومتر توسط میکروپلیت ریدر  قرائت شد.

نمودار استاندارد با تهیه 5 غلظت مشخص از محلول آلیزارین رد (محلول 2 میلی مولار با اضافه کردن محلول 40 میلی مولار آلیزارین رد به مخلوط اسید استیک (10 درصد) و آمونیوم سولفات (10 درصد) به نسبت 5  به 2 به‫عنوان محلول استاندارد تهیه شد) رسم و سپس با استفاده از فرمول خطی Y=0.7572-0.0079 با R2=0.9994 غلظت (µM/ml) رنگ آلیزارین رد استخراج شده از نمونه محاسبه و گزارش شد.

اندازه گیری غلظت کلسیم استخراج شده از ماتریکس: پلیت بعد از 21 روز تیمار با PBS شستشو و سلول‫های توسط اسکراپر جمع آوری و در یک میکروتیوب با وزن مشخص (برای تعیین وزن سلول‫های پس از تفاضل اوزان) قرار گرفت. کلسیم موجود در وزن مساوی از سلول‫های با استفاده از 50 میکرو لیتر اسید کلریدریک (5/0 نرمال) در 4 درجه سانتی‫گراد به‫مدت 24 ساعت استخراج و سپس میزان کلسیم موجود در ماتریکس سلولی با کمک کیت کلسیم شرکت پارس آزمون (کد محصول 1400007) اندازه‏گیری شد. در این روش 20 میکرولیتر نمونه سلولی با یک میلی‏لیتر محلول واکنش موجود در کیت مخلوط و اختلاف جذب بین صفر و 3 دقیقه در طول موج 570 نانومتر با کمک دستگاه اسپکتروفتومتر(PG Instrument Company, England ) اندازه‏گیری و غلظت کلسیم با  استفاده از نمودار استاندارد (تهیه شده از غلظت‫های مختلف کلرید کلسیم) با استفاده از فرمول خطی Y=0.0076X+0.0088 و  R2=0.9981 تعیین بر اساس mg/dl گزارش شد.

اندازه گیری فعالیت آنزیم  آلکالین فسفاتاز: سلول‫های تیمار داده شده با غلظت‏های 100 میکرومولار DEHP به‫مدت 21 روز ابتدا با استفاده از PBS شستشو و سپس بعد از جمع آوری بروش انجماد و ذوب لیز و به‫مدت 10 دقیقه با 10000  g سانتریفیوژ شدند. میزان پروتئین موجود در محلول رویی به‏کمک روش لاوری و با استفاده از سرم آلبومین گاوی (BSA) به‏عنوان استاندارد اندازه‫گیری شد. فعالیت آنزیم براساس میزان نمونه با مقدار پروتئین مساوی  اندازه گیری شد. برای اندازه‫گیری فعالیت آنزیم آلکالین فسفاتاز (ALPs) از کیت پارس آزمون (کد محصول 1400002) استفاده شد و بر اساس روش ارائه شده توسط شرکت میزان 20 میکرولیتر از نمونه با یک میلی‏لیتر از محلول واکنش موجود در کیت مخلوط و اختلاف جذب بین صفر و 3 دقیقه در طول موج 405 نانومتر با دستگاه اسپکتروفتومتر(PG Instrument Company, England) قرائت شد. فعالیت آنزیم بر حسب واحد بر میلی‏گرم پروتئین محاسبه گردید. میزان فعالیت آنزیم براساس فرمول خطی Y=0.0015X+0.0004و R2=0.9993 به‫دست آمده از نمودار استاندارد تعیین و فعالیت آنزیمی بر حسب واحد بین المللی در لیتر بر گرم پروتئین  (U/L) (میزان فعالیت آنزیم هر نمونه به ‏مقدار پروتئین تام آن نمونه تقسیم شد) گزارش شد.

بررسی بیان ژنهای دخیل در تمایز استئوژنیک: به‫منظور انجام PCR-معکوس (RT-PCR)، RNA کل سلول‫های تمایز یافته بعداز 21روز تیمار با استفاده از کیت Super RNA extraction kit for tissue and cells (YT9080) استخراج و  DNA مکمل (c-DNA) کل توسط کیت BioFACT(BR631-096) سنتز گردید. واکنش PCR به‫منظور بررسی بیان ژن­های مورد نظر با استفاده از پرایمرهای اختصاصی (جدول 1) انجام شد. بدین منظور از دستگاه ترموسایکلر مدل (Eppendorf mastercycler gradient) و برنامه­های دمایی: دمای95 درجه­ی سانتی‫گراد به‫مدت 5 دقیقه، دمای 95 درجه­ی سانتی‫گراد به‫مدت 1 دقیقه ، دمای اتصال پرایمر اختصاصی متناسب با نوع پرایمرها به‫مدت 1 دقیقه، دمای 72 درجه­ی سانتی‫گراد به‫مدت 1 دقیقه و دمای 72 درجه­ی سانتی‫گراد به‫مدت 7 دقیقه با تعداد 35 سیکل تکرار انجام شد.

 

 

 

 

 

 

 

 

 

جدول1 : پرایمر­های اختصاصی مورد استفاده برای  PCR

ژن

توالی پرایمر

دمای اتصال

(درجه سانتیگراد)

طول محصول

ALP

F: CATGTTTCCTGGGAGATGGTA

4/58

bp144

 

R: GTGTTGTACGTCTTGGAGAGA

4/59

OC

F: AACGGTGGTGCCATAGATGC

5/60

bp294

R: AGGAGGCTCTCTGCTCAC

5/62

ON

F: AAACATGGCAAGGTGTGTGA

4/56

bp301

R: AGGTGACCAGGACGTTTTTG

4/58

RUNX2

F: CCGCACGACAACCGCACCAT

6/64

bp 289

R: CGCTCCGGCCCACAAATCTC

6/64

SMAD1

F: CCGCCTGCTTACCTGCCTCCTGAA

4/70

bp246

R: GAACGCTTCGCCCACACGGTTGT

2/68

BMP2

F: CGTCAAGCCAAACACAAACAGC

1/62

bp 106

R: GAGCCACAATCCAGTCATTCCAC

7/64

BMP7

F: AAGCCCAGATGGTACGG

8/54

bp136

R: GCACCTCCAGGGAAAAC

8/54

GAPDH

F: TCGTCTCATAGACAAGATGG

4/56

bp136

R: GTAGTTGAGGTCAATGAAGGG

4/59

 

3- آنالیز آماری دادهها

با استفاده از روش آماری آنالیز واریانس یک‫طرفه (one way ANOVA) و تست Tukey داده­های به‏دست آمده آنالیز و تفاوت میانگین‫ها در سطح 05/0

 

4- نتایج:

توانائی زیستی

جهت بررسی توانای زیستی سلول‫های بنیادی مزانشیم مغزاستخوان رت تمایزیافته به استئوبلاست از روش MTT استفاده شد. در این مطالعه نتایج تست MTT نشان داد که غلظت 100 میکرومولار دی2-اتیل هگزیل فتالات بعداز 21 روز باعث کاهش توانایی زیستی سلول‫های تمایزیافته به‫صورت معنی­دار(05/0<p) در مقایسه با کنترل  شد (جدول2).

جدول2: مقایسه میانگین توانایی زیستی سلول های بنیادی مزانشیم مغز استخوان رت طی روند تمایز به استئوبلاست پس از تیمار به‫مدت 21 روز با دی2-اتیل هگزیل فتالات براساس میزان جذب رنگ بنفش فورمازان

غلظت (μM)

زمان (21 روز)

0

005/0 ± a507/0

100

01/0 ± b335/0

مقادیر به­صورت mean ±SD می باشد. میانگین­ها با کد حرف­های متفاوت دریک ستون دارای تفاوت معنی­دار می­باشد (05/0p<،Tukey test ، one way ANOVA)

میزان معدنی شدن ماتریکس براساس آزمون آلیزارین رد

آنالیز آماری نشان داد که غلظت 100میکرومولار دی 2-اتیل هگزیل فتالات بعداز 21 روز باعث کاهش معنی­دار (05/0p<) معدنی شدن ماتریکس در مقایسه با کنترل شد (جدول3). مشاهدات میکروسکوپی نیز تایید کننده­ی نتایج آنالیزهای کمی در رابطه با میزان معدنی شدن ماتریکس سلول‫ها بود (شکل 1).

جدول 3: مقایسه­ی میانگین میزان رنگ آلیزارین رد (mM) استخراج شده از نمونه­های استئوژنیک تیمار شده با دی2-اتیل هگزیل فتالات با گروه کنترل در 21 روز.

غلظت (μM)

زمان (21 روز)

0

02/0 ± a261/0

100

03/0 ± b126/0

مقادیر به­صورت mean ±SD می­باشد. میانگین­ها با کد حرف­های متفاوت دریک ستون دارای تفاوت معنی‫دار می­باشد (05/0

 

 

 

 

 

 

 

شکل1 : تصاویر میکروسکوپی (بزرگنمایی X200). A) گروه کنترل B) گروه تیماری با 100میکرومولار از دی2-اتیل هگزیل فتالات

تعیین غلظت فاکتورهای بیوشیمایئ دخیل در تمایز

آنالیز آماری داده‫ها نشان داد غلظت پروتئین کل استخراج شده از سلول‫های بنیادی مزانشیم مغزاستخوان رت تمایز یافته به استئوبلاست بعد از تیمار با غلظت­های 0 و 100 میکرومولار از DEHP در مدت 21 با کاهش معنی­دار (05/0<p) در گروه تیماری نسبت به کنترل روبرو شده بود (جدول 4). همچنین آنالیز آماری نشان داد که غلظت 100 میکرومولار دی 2-اتیل هگزیل فتالات در 21 روز در مقایسه با کنترل، باعث کاهش معنی­دار (05/0<p) فعالیت آنزیم آلکالین فسفاتاز شد(جدول 4). از طرفی غلظت 100 میکرومولار از DEHP باعث کاهش معنی­دار (05/0<p) میزان کلسیم در سلول‫های مزانشیم مغز استخوان رت تمایز یافته به استئوبلاست نسبت به کنترل بعد از 21روز شد (جدول4).

 

 

جدول 4: مقایسه میانگین میزان پروتئین کل (μg/ml)، فعالیت آنزیم آلکالین فسفاتاز (IU/L) و میزان کلسیم استخراج شده از ماتریکس (mg/dl) داخل سلولی سلول‫های بنیادی مزانشیم مغز استخوان رت طی روند تمایز به استئوبلاست پس از21 روز تیمار با DEHP

غلظت (μM)

پروتئین کل

آنزیم آلکالین فسفاتاز

غلظت کلسیم ماتریکس

0

25/16 ± a50/157

05/36 ± a08/294

00/1 ± a59/25

100

61/6 ± b25/121

03/24 ± b61/147

64/0 ± b36/16

مقادیر به­صورت mean ±SD می­باشد. میانگین­ها با کد حرف­های متفاوت دریک ستون دارای تفاوت معنی­دار می­باشد (05/0p<،Tukey test ، one way ANOVA).

بررسی میزان بیان ژن­های دخیل در تمایز سلولهای بنیادی مزانشیم مغز استخوان رت به استئوبلاست بهکمک تکنیک RT-PCR :

در روند تمایز سلول‫های بنیادی مزانشیم مغز استخوان به استئوبلاست، ژن­های مختلفی شامل ژن­های ALP، OC، RUNX2، ON، SMAD1، BMP2، BMP7 و GAPD دخیل هستند. تکنیک RT-PCR (شکل 2) نشان داد که 21 روز تیمار سلول‫های بنیادی مزانشیم مغز استخوان رت در طی روند تمایز با DEHP باعث کاهش بیان این ژن­ها شد. ژن GAPDH به‫عنوان کنترل در این مطالعه استفاده شد و در هیچ یک از گروه­ها تغییر معنی­دار نشان نداد. در جدول5  شدت رنگ حاصل از باندها بر روی ژل آگارز توسط نرم افزار Imagej اندازه­گیری و نشان داده شده است.

جدول 5: مقایسه میانگین بیان ژن­های دخیل در روند تمایز سلول‫های بنیادی مزانشیم مغز استخوان رت به استئوبلاست پس از 20 روز تیمار با 100میکرومولار دی2- اتیل هگزیل فتالات

      غلظت( μM)

ژن

0

100

GAPDH

 

03/0 ± a55/0

01/0 ± a55/0

BMP7

 

04/0 ± a49/0

08/0 ± b23/0

BMP2

 

03/0 ± a62/0

03/0 ± b45/0

SMAD1

 

08/0 ± a61/0

06/0 ± b41/0

ON

 

07/0 ± a59/0

02/0 ± b43/0

RUNX2

 

05/0 ± a60/0

05/0 ± b46/0

OC

 

01/0 ± a61/0

04/0 ± b40/0

ALP

 

07/0 ± a51/0

04/0 ± a36/0

 

 

 

 

 

 

 

 

 

مقادیر به­صورت mean ±SD می­باشد. میانگین­ها با کد حرف­های متفاوت دریک ستون دارای تفاوت معنی­دار می­باشد (05/0p<،Tukey test ، one way ANOVA).

 

 

 

ALP

OC

ON

Runx2

BMP2

Smad1

GAPDH

BMP7

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 2: میزان بیان ژن­های دخیل در تمایز استئوژنیک سلول‫های بنیادی مزانشیم مغز استخوان رت تیمار شده با DEHP در مدت زمان 21 روز.

 

5- بحث

توانایی زیستی سلول‫های تمایز یافته تیمار شده با غلظت 100میکرومولار DEHP در مقایسه با گروه کنترل کاهش معنی­دار داشت. بررسی انجام شده توسط آبنوسی و علیاری (18) نیز نشان داد که DEHP باعث القای استرس اکسیداتیو و اختلال در غشا می­شود. با توجه به نتایج آزمون MTT، از آن‫جا‫که استرس اکسیداتیو می‫تواند فعالیت میتوکندری را مختل کند، احتمالا دلیل کاهش توانائی زیستی سلول‫ها، اختلال در عملکرد میتوکندری و ساختار غشایی آن بوده است که باعث کاهش میزان تولید کریستال فورمازان شده است.

در مطالعه Bhat و همکاران (19) ، غلظت­ 100 میکرومولار DEHP در تیمار 24 ساعت باعث کاهش توانایی زیستی سلول‫های استئوبلاست جمجمه موش شد این درحالی‫ست که در تیمار 48 ساعت تاثیر این غلظت از نظر آماری بی معنی گزارش شده است. علاوه برآن در مطالعات Chiu و همکاران (20) توانایی زیستی سلول‫های استرومال مغزاستخوان در حضور غلظت 100میکرومولار DEHP بعد از 7 روز بدون تغییر گزارش شد. این درحالیست که Sabbieti و همکاران (21) نشان دادند بنزیل بوتیل فتالات و دی بوتیل فتالات حتی در غلظت 1 میکرومولار در طی 24 ساعت توانایی زیستی سلول‫های MC3T3-E1 را به‫صورت معنی‫دار کاهش می­دهد. از طرفی مطالعات آبنوسی و علیاری (18) موید کاهش توانایی زیستی سلول‫های استئوبلاست تمایز یافته از سلول‫های بنیادی مزانشیم مغز استخوان می­باشد. عدم تطابق نتایج مطالعات پیشین در خصوص مسمومیت ناشی از DEHP با مطالعه حاضر را نمی­توان تفسیر کرد و تنها نکته قابل توجه تفاوت در مدت زمان تیمار در این مطالعات می­باشد. ضمنا با توجه به مسمومیت این آلاینده و تاثیر آن بر سلول‫های دیگر از طرفی و کاهش فعالیت متابولیک و القاء استرس اکسیداتیو از طرفی دیگر نیاز بیشتری به مطالعه تاثیر این ترکیب شیمیایی بر توانایی حیات سلول‫های استئوبلاست ضروری به‫نظر می­رسد.

در مطالعه حاضر فعالیت آنزیم آلکالین فسفاتاز و غلظت کلسیم ماتریکس به‫عنوان دو فاکتور مهم برای بررسی تمایز سلول‫های بنیادی مزانشیم به استئوبلاست بررسی شد. در واقع برای حضور یون کلسیم، فعالیت آنزیم آلکالین فسفاتاز ضروری  میباشد و این آنزیم باعث تجزیه پیروفسفات در سلول و تسهیل ورود یون کلسیم برای تشکیل ماتریکس زمینه ای (هیدروکسی آپاتیت) می­باشد (22). از طرفی برای این‫که هیدروکسی آپاتیت بتواند تشکیل و رسوب نماید حضور پروتئین کلاژن ضروری است، در این راستا ابتدا سلول استئوبلاست با ترشح پروتئین کلاژن و دیگر پروتئین‫ها امکان تشکلیل ماده معدنی ماتریکس و رسوب آن‫را فراهم می‫کند (23). کاهش میزان پروتئین کل درسلوهای تمایز یافته تایید بر تاثیر DEHP بر کاهش میزان ماده آلی ماتریکس تولید شده توسط سلول‫های استئوبلاست می‫باشد، زیرا 90 درصد پروتئین‫های ماتریکس را کلاژن 1 تشکیل می‫دهد (23) که بیشترین نوع پروتئین در ماتریکس است که  این خود موید عدم حضور ماده آلی ماتریکس برای تشکیل رسوب یا نودول کلسیمی است. در مطالعه حاضر فعالیت آلکالین فسفاتاز و غلظت کلسیم در سلول‫های بنیادی مزانشیم مغز استخوان تحت تیمار با غلظت 100 میکرومولار DEHP بعداز 21روز نسبت به گروه کنترل کاهش معنی­دار نشان داد. همچنین نتایج کمی و کیفی آزمون آلیزارین رد و کاهش بیان پروتئین  کلاژن 1 نیز تایید کننده این نتایج بود.   نتایج نشان داد که تشکیل نودول­های کلسیمی در گروه تیماری نسبت به کنترل کاهش معنی‫دار داشت است.

مطالعات دیگر نیز در راستای نتایج این مطالعه می­باشد به‫صورتی که Bhat و همکاران (19) نشان دادند، تیمار سلول‫های  استئوبلاست جمجمه موش با غلظت­ 100 میکرومولار DEHP در 24  ساعت باعث کاهش فعالیت آنزیم آلکالین فسفاتاز، کاهش میزان کلاژن و کاهش نودول­های استخوانی شد. علاوه بر آن در مطالعات Chiu و همکاران (20) نشان داده شد که تیمار موش­های اورکتومی شده  با DEHP باعث کاهش میزان پروتئین استئوکلسین و کلاژن نوع 1 شده است که این خود نشان دهنده تاثیر منفی این آلاینده بر سلامت بافت استخوان می­باشد. همچنین آن‫ها نشان دادند که موش‫ها بعد از تیمار با غلظت­های 10 و 100 میلی‫گرم بر کیلوگرم DEHP به‫مدت 8 هفته دستخوش کاهش معنی­دار تراکم استخوان شدند و فعالیت آنزیم آلکالین فسفاتاز و میزان نودل­های استخوانی در محیط کشت استئوبلاست استخراج  شده نیز کاهش معنی­دار نشان داده است.

تشکیل ماتریکس خارج سلولی توسط سلول‫های بنیادی مزانشیم مغزاستخوان در محیط آزمایشگاهی از روز هفتم شروع و تا روز بیستم به بالاترین میزان خود می­رسد (24). ژن­های متعددی در فرایند تمایز سلول‫های بنیادی مزانشیم مغزاستخوان به استئوبلاست نقش دارند که برخی از این ژن­ها آغازین (Early Genes ) می­باشند که در مرحله­ی شروع فرایند استئوژنز بیان و تا انتهای مرحله تمایز نیز بیان آن‫ها ادامه دارد، از این ژن­ها می­توان آلکالین فسفاتاز را نام برد (25). از طرفی ژن استئوکلسین به‫عنوان خاتمه (Late Gene) در طی فرایند شروع به بیان شدن کرده و در انتهای فرایند تمایز به بیشترین مقدار خود می­رسد (26). ضمنا بیان ژن استئونکتین به‫دنبال بیان ژن آلکالین فسفاتاز به‫عنوان ژن میانی (med gene) بعد از بیان کلاژن باعث اتصال آن به این پروتئین شده و نقش مهمی در تشکیل ماتریکس خارج سلولی دارد (27).  بیان این ژن­ها به‫دنبال بیان ژن­های دیگر از قبیل  BMP7، SMAD1 و RUNX2 امکان پذیر است. با توجه به اختلال در فرایند استئوژنیک بررسی بیان ژن­های دخیل در این فرایند نیز مورد بررسی قرار گرفت و مشخص شد بیان ژن­های ALP، BMP2، BMP7، SMAD1، RUNX2، OC و  ON در اثر تیمار با غلظت 100میکرومولار به‫مدت 21 روز کاهش معنی‫دار داشته است.

پروتئین­های مورفولوژیک استخوان (BMPs) یکی از تنظیم کننده­های تمایز سلول به استئوبلاست و مسئول حفظ هموستاز استخوان­ها می­باشد (28)، این پروتئین­ها از  خانواده­ی بزرگ TGF-β (TGF-β super family) میباشند که در تمایز به استئوبلاست نقش حیاتی دارند (29). پروتئین­های TGF-β مانند BMP2 و BMP7در بخش سیتوپلاسمی به گیرنده­های اختصاصی سرین/ترئونین کیناز متصل شده و با فسفوریلاسیون BMPІІR باعث فسفوریلاسیون BMPІR و درنهایت فسفوریلاسیون SMAD1 می‫شود (30). پروتئین­ SMAD1 از اصلی­ترین گیرنده­ها است که توسط گیرنده­های TGF-β فعال شده و  به‫صورت مستقیم در تنظیم رونویسی (31) فاکتورهای رونویسی Dlx5 ، RUNX2 و Osterix (Osx) در بیان ماتریکس سلولی سلول‫های بنیادی مزانشیم در حال تمایز نقش دارد. از طرفی باید متذکر  شویم که RUNX2 در تمایز سلول‫های بنیادی مزانشیم مغز استخوان به پری استئوبلاست­ها و استئوبلاست­های نابالغ وOsterix در تبدیل استئوبلاست­های نابالغ به بالغ و استئوسیت­ها نقش دارند (32). ژن RUNX2 به‫واسطه کمپلکس SMAD1,5,8,4 در هسته بیان می‫شود و به دنبال بیان RUNX2 سایر مارکرهای استخوانی مانند ALP، colI ، ON، OC و OP و سیالوپروتئین استخوان (BSP) نیز که برای تمایز استئوبلاست ضروری هستند به‫صورت متوالی بیان می­شوند (33). علاوه بر کلاژن نوع 1، پروتئین استئوکلسین (OC) در تشکیل هسته­ی کریستال هیدروکسی آپاتیت نقش مهمی را ایفا می‫کند (26).

غلظت 100 میکرومولار DEHP با اثر بر فنوتیپ معدنی شدن (پروتئین ماتریکس از قبیل کلاژن 1 و فعالیت آنزیم آلکالین فسفاتاز) باعث کاهش معنی­دار تمایز سلول‫ها گردید. این تاثیر به دلیل کاهش بیان ژن­های  دخیل در تمایز سلول‫های BMSCs به استئوبلاست مانند ALP، OC، Runx2، SMAD1، BMP2، BMP7 موجب کاهش رسوب کلسیم در ماتریکس معدنی شده است (22). همچنین علاوه بر کاهش فعالیت آنزیم ALP کاهش بیان ژن­های Runx2، SMAD1، BMP2، BMP7 بر بیان پروتئین COL-1A1 تاثیر داشته است که این خود باعث کاهش میزان تشکیل نودولهای معدنی ماتریکس شده است.

6-  نتیجه گیری

به‫عنوان نتیجه گیری بررسی حاضر نشان داد که DEHP میتواند با تاثیر بر مسیر BMP/SMAD باعث کاهش بیان ژن­های دخیل در روند تمایز استئوبلاست شود و در نتیجه با کاهش بیان پروئین و کاهش فعالیت آنزیم آلکالین فسفاتاز تمایز BMSCs را به استئوبلاست کاهش دهد. این کاهش می‫تواند در دراز مدت امکان ابتلا به بیماری‫های مربوط به استخوان مانند استئوپورزیس را در حیوانات افزایش دهد.

7- تشکر و قدردانی

تحقیق حاضر در  دانشگاه اراک، گروه زیست شناسی انجام شد، لذا نویسندگان مقاله  لازم می‫دانند  از همه دست اندر کاران و مسئولین  دانشکده و گروه زیست شناسی تقدیر و تشکر نمایند.

 نویسندگان اعلام میدارند که هیچ نوع تعارض منافعی وجود ندارد.

سهم نویسندگان: محمد حسین آبنوسی در طرح ایده تحقیقاتی، متدولوژی و تایید نتایج آزمایش و همچنین نگارش مقاله نقش داشته است، جواد سرگلزائی در انجام امور تحقیقاتی و آنالیز داده های تحقیق نقش داشته است. زهرا شایگان در انجام کلیه آزمون‫ها و تست‫های انجام شده و آنالیز داده ها نقش داشته اشت.

-

  1. Martínez-Razo LD, Martínez-IbarraA . Vázquez-Martínez ER. The impact of Di-(2-ethylhexyl) Phthalate and Mono(2-ethylhexyl) Phthalate in placental development, function, and pathophysiology. Environment International. 2021; 146: 106228. DOI: 10.1016/j.envint.2020.106228.
  2. Sasakawa S, Mifomi Y. Di-2-ethylhexylphthalate (DEHP) Content of Blood or Blood Components Stored in Plastic Bags. Vox Sang. 1978; 34: 81-86.
  3. Green R,  Hauser R, Calafat AM,  et al. Use of Di(2-ethylhexyl) Phthalate–Containing Medical Products and Urinary Levels of Mono(2-ethylhexyl) Phthalate in Neonatal Intensive Care Unit Infants. Environ Health Perspect. 2005; 113(9): 1222–1225.
  4. Tickner JA, Schettler T, Guidotti T, McCally M, et al. Health risks posed by use of Di-2-ethylhexyl phthalate (DEHP) in PVC medical devices: A critical review. American journal of industrial medicine. 2001; 39(1):100-11.
  5. Darvishmotevalli M,  Bina B,  Feizi A,  Ebrahimpour K, et al. Monitoring of urinary phthalate metabolites among pregnant women in Isfahan, Iran: the PERSIAN birth cohort. J Environ Health Sci Eng. 2019 Dec; 17(2): 969–978.
  6. Zolfaghari M, Drogui P, Seyhi B , Brar SK , et al. Occurrence, fate and effects of Di (2-ethylhexyl) phthalate in wastewater treatment plants: A review, Environmental Pollution (2014), http://dx.doi.org/10.1016/j.envpol.2014.07.014.
  7. Wang W, WahLeung AO, HangChu L, HungWong M. Phthalates contamination in China: Status, trends and human exposure-with an emphasis on oral intake. Environmental Pollution. 2018; 283: 771-782.
  8. Hassanzadeh N, Esmaili Sari A, Khodabandeh S, Bahramifar N. The Concentrations of Di (2-Ethylhexyl) Phthalate (DEHP) and Di-n-Butyl Phthalate (DnBP) in the Surface Waters of Anzali Wetland in May 2013. J Mazandaran Univ Med Sci 2014; 24(117): 204-213 (Text in Persian).
  9. Rahimi L, Ghanbarzadeh B, Dehghannya J. Migration of Phthalate Esters from Polyethylene Terephthalate into a Lemon Juice Simulant. Iranian Food Science and Technology Research Journal 2016; 12(1): 79- 87 (Text in Persian).
  10. Moazzen M, Rastkari N, Alimohammadi M, Shariatifar N, et al. Assessment of Phthalate Esters in A Variety of Carbonated Beverages Bottled in PET. Journal of Environmental Health Engineering. 2014; 2(1): 7-18. (Text in Persian).
  11. Chang YJ, Lin KL, Chang YZ. Determination of Di-(2-ethylhexyl)phthalate (DEHP) metabolites in human hair using liquid chromatography–tandem mass spectrometry. Clinica Chimica Acta. 2013; 420: 155–159.
  12. Sumner, R.N., Tomlinson, M., Craigon, J. England GCW., et al. Independent and combined effects of diethylhexyl phthalate and polychlorinated biphenyl 153 on sperm quality in the human and dog. Science Report 2019; 9: 3409. DOI: 10.1038/s41598-019-39913-9.
  13. Martinez-Arguelles DB, Culty M, Zirkin BR, Papadopoulos V. In utero exposure to di-(2-ethylhexyl) phthalate decreases mineralocorticoid receptor expression in the adult testis. Endocrinology. 2009;150(12):5575–5585.
  14. Liu H, Han W, Zhu S, Li Z, et al. Effect of DEHP and DnOP on mitochondrial damage and related pathways of Nrf2 and SIRT1/PGC-1α in HepG2 cells. Food and Chemical Toxicology. 2021; 158: 112696. DOI: 10.1016/j.fct.2021.112696.
  15. To ̈gel F, Westenfelder C. Adult Bone Marrow–Derived Stem Cells forOrgan Regeneration and Repair. Developmental Dynamics. 2007; 236: 3321–3331.
  16. Abnosi MH, Aliyari-Babolghani Z. Diethylhexyl phthalate induced oxidative stress and caused metabolic imbalance in bone marrow mesenchymal stem cells. Physiology and Pharmacology. 2022; 26: 88-100.
  17. Abnsi MH, Sargolzaei J, Shayeganfar Z. Induction of caspase dependent apoptosis in rat bone marrow mesenchymal stem cells due to di-2-ethylhexyl phthalate toxicity was found to arrest the cell cycle at G1 stage. 2023; in press.
  18. Abnosi MH, Aliyari Babolghani Z. The Inhibitory Role of Di-2-ethylhexyl Phthalate on Osteogenic Differentiation of Mesenchymal Stem Cells Via Down-regulation of RUNX2 and Membrane Function Impairment. International Journal of Medical Toxicology and Forensic Medicine. 2020; 10(2):26673. https://doi.org/10.32598/ijmtfm.v10i2.26673.
  19. Bhat FA, Ramajayam G, Parameswari S, Vignesh R, et al. Di 2-ethyl hexyl phthalate affects differentiation and matrix mineralization of rat calvarial osteoblasts–in vitro. Toxicology in Vitro. 2013;27(1):250-56.
  20. Chiu CY, Sun SC, Chiang CK, Wang CC, et al. Plasticizer di (Di-2-ethylhexyl) phthalate interferes with osteoblastogenesis and adipogenesis in a mouse model. Journal of Orthopaedic Research. 2018;36(4):1124-34.
  21. Sabbieti M, Agas D, Santoni G, Materazzi S, et al. Involvement of p53 in phthalate effects on mouse and rat osteoblasts. Journal of cellular biochemistry. 2009;107(2):316-27.
  22. Golub EE, Boesze-Battaglia K. The role of alkaline phosphatase in mineralization. Current opinion in Orthopaedics. 2007;18(5):444-8.
  23. Sroga GE, Vashishth D. Effects of Bone Matrix Proteins on Fracture and Fragility in Osteoporosis. Curr Osteoporos Rep. 2012; 10(2): 141–150.
  24. Glueck M, Gardner O, Czekanska E, Alini M, et al. Induction of osteogenic differentiation in human mesenchymal stem cells by crosstalk with osteoblasts. BioResearch open access. 2015;4(1):121-30.
  25. Choi M-H, Noh W-C, Park J-W, Lee J-M, et al. Gene expression pattern during osteogenic differentiation of human periodontal ligament cells in vitro. Journal of periodontal & implant science. 2011;41(4):167-75.
  26. Sila-Asna M, Bunyaratvej A, Maeda S, Kitaguchi H, et al. Osteoblast differentiation and bone formation gene expression in strontium-inducing bone marrow mesenchymal stem cell. Kobe J Med Sci. 2007;53(1-2):25-35.
  27. Zhu YS, Gu Y, Jiang C, Chen L. Osteonectin regulates the extracellular matrix mineralization of osteoblasts through P38 signaling pathway. Journal of Cellular Physiology. 2020;235(3):2220-31.
  28. Reddi AH, Reddi A. Bone morphogenetic proteins (BMPs): from morphogens to metabologens. Cytokine and Growth Factor Reviews. 2009;5(20):341-2.
  29. Bruderer M, Richards R, Alini M, Stoddart MJ. Role and regulation of RUNX2 in osteogenesis. Eur Cell Mater. 2014;28(28):269-86.
  30. Wu C-J, Lu H-K. Smad signal pathway in BMP-2-induced osteogenesis a mini review. J Dent Sci. 2008;3(1):13-21.
  31. Qi H, Aguiar DJ, Williams SM, La Pean A, et al. Identification of genes responsible for osteoblast differentiation from human mesodermal progenitor cells. Proceedings of the National Academy of Sciences. 2003;100(6):3305-10.
  32. Sinha KM, Zhou X. Genetic and molecular control of osterix in skeletal formation. Journal of cellular biochemistry. 2013;114(5):975-84.
  33. Schindeler A, Little DG. Ras‐MAPK signaling in osteogenic differentiation: Friend or foe? Journal of Bone and Mineral Research. 2006;21(9):1331-38.