اثرات تزریق ارکسینA به درون بطن سوم مغزی بر بیان ژن Translocator protein (TSPO) در تخمدان موش های آندروژنه بالغ

نوع مقاله: علمی - پژوهشی

نویسندگان

1 کارشناسی ارشد فیزیولوژی جانوری، دانشگاه شهید بهشتی، دانشکده علوم زیستی، گروه زیست شناسی، ایران، تهران

2 دانشگاه شهید بهشتی، دانشکده علوم زیستی، گروه زیست شناسی، ایران، تهران

چکیده

هدف: اثرات تزریق ارکسینA به درون بطن سوم مغز بر بیان ژن TSPO در تخمدان موش‌های آندروژنه (AND) بالغ و تاثیر آن بر روی سنتز استرویید‌‌‌‌‌‌‌‌‌‌‌‌‌‍‌‍‌های ضروری در تولید مثل بررسی شد. مواد و روش‏ها: بیست و چهار سر موش صحرایی ماده سه روزه در گروه‌های شش‌تایی با تزریق زیر پوستی تستوسترون پروپیونات آندروژنه شدند و شش سر موش ماده دیگر به‏عنوان گروه کنترل انتخاب شدند. بعد از بلوغ حیوانات در 5 گروه شش‌تایی به‏ترتیب تزریق مرکزی سالین یا مقادیر مختلف ارکسین  A(2، 4 یا 8 میکروگرم) را دریافت کردند. تخمدان‌ها به‏صورت دو طرفه خارج و فریز شدند. میزان بیان ژن TSPO با استفاده از روش نیمه کمی RT-PCR تعیین شد. نتایج: سطح بیان mRNA TSPO در تخمدان موش‌های صحرایی آندروژنه در مقایسه با گروه کنترل به‏طور معنی داری افزایش یافت. مقادیر مختلف ارکسین A میزان بیان ژن TSPO را در مقایسه با گروه کنترل آندروژنه به‏طور معنی داری کاهش دادند (05/0P<). نتیجه‌گیری: آندروژن‌ها اثر تحریکی بر میزان بیان TSPO در تخمدان موش‌های صحرایی ماده اعمال می‌کنند و ارکسین  Aبا کاهش بیان ژن‌های دخیل در استروئیدوژنز موجب کاهش فعالیت محور تولید مثلی در موش‌های صحرایی آندروژنه می‌شود.

کلیدواژه‌ها


مقدمه

فعالیت سیستم تولید مثلی تحت کنترل مرکزی محور هیپوتالاموس- هیپوفیز- گنادی (HPG) قرار دارد و توسط برهم کنش مجموعه‌ی پیچیده­ای از پپتیدهای مرکزی و محیطی تنظیم می­شود. از بین نوروپپتیدهای مرکزی موثر بر فعالیت محور تولید مثلی می‏توان به ارکسین اشاره کرد. ارکسین A پپتید هیپوتالاموسی با 33 اسید آمینه است که به‏طور عمده در هیپوتالاموس جانبی و نواحی مجاور آن سنتز شده و از طریق اتصال به گیرنده شماره 1 ارکسین (OX1R)  در تنظیم دریافت غذا و تعدیل فعالیت محور هیپوتالاموس-‌‌ هیپوفیز- گنادی و ترشح گنادوتروپین ها نقش ایفا می­کند (4-1). تحقیقات نشان داده است که ارکسین در سرکوب عمل‏کردهای تولید مثلی نقش دارد و سبب کاهش آزادسازی هورمون­های جنسی می­شود (5 و ‌6). پروتئین موسوم به گیرنده بنزودیازپینی محیطی (PBR) که امروزه به پروتئین ترانسلوکاتور (TSPO) معروف است پروتئینی 18 کیلو دالتونی است که به‏طور عمده در غشای خارجی میتوکندری یافت می­شود. پروتئین TSPO به‏طور عمده در غشای میتوکندریایی بافت­های استروئیدوژنز نظیر تخمدان­ها، بیضه­ها و سایر بافت­ها بیان می‏شود و در انتقال کلسترول به‏داخل میتوکندری سلول­های سازنده استروئیدها نقش مهمی ایفا می­کند (9-7). تحقیقات پیشین نشان داده­اند که در فولیکول‏های در حال تکوین، TSPO سلول‏های گرانولوزا تحت تحریک FSH بیان می‏شود. همچنان که بلوغ فولیکولی پیشرفت می‏کند سلول‏های گرانولوزا گیرنده LH را بیان می‏کنند و فعالیتTSPO  تحت تحریک هر دو هورمونLH  و FSH افزایش می‏یابد (10 و 11). همچنین مشخص شده است که تیمار موش‏های صحرایی ماده با آندروژن پس از تولد منجر به افزایش بسیار سطوح فعالیت TSPO در تخمدان شده و در نتیجه سیکل تولید مثلی و رفتار تولیدمثلی جنس ماده را مختل می‏کند و باعث عدم تخمک‏گذاری، عدم رهاسازی سرژ (اوج رهایش هورمون)LH ، کاهش پاسخ‏دهی هیپوفیز به GnRH و نازایی می‏شود (12 و 13). یافته‏ها ثابت کرده­اند که توزیع نورون­های­ارکسین با نورون‏های تولید کنندهGnRH  در ناحیه برجستگی میانی و هسته آرکوئت (ARC) هم‏پوشانی داشته و ارکسین در مهار آزادسازی هورمون‌هایGnRH، LH و FSH دخالت دارد (14). هورمون­های LH و FSH هر دو در کنترل بیان پروتئین TSPO نقش دارند و هر عامل تغییردهنده ترشح هورمون­های FSH و LH ممکن است در کاهش فعالیت استروئیدوژنز نقش داشته باشد. از آنجا که ارکسین در تنظیم فعالیت محور تولیدمثلی نقش داشته و تاکنون گزارشی درباره اثرات ارکسین بر میزان بیان ژن­های دخیل در استروئیدوژنز در هیچ یک از گونه­های جانوری آندروژنه وجود ندارد در این مطالعه، اثرات تزریق مرکزی ارکسینA  بر میزان بیان ژن TSPO در تخمدان موش­های ماده بالغ آندروژنه بررسی می­شود تا مشخص شود که پپتیدهای مهارکننده آزادسازی GnRH/LH و FSH در تنظیم بیان ژن­های دخیل در استروئیدوژنز که در چرخه جنسی موجود ماده و امر تولید مثل موثرند؛ نقش داشته باشند.

 

مواد و روش­ها

آزمایش انجام شده یک مطالعه تجربی است و در آن تمام اصول اخلاقی کار با حیوانات آزمایشگاهی مصوب انجمن آمریکایی SPCA (Society for the Prevention of Cruelty to Animals) در سال 2006، رعایت شده است.

واحدهای آزمایشی: موش‏های صحرایی ماده تازه متولد شده      (24سر) از نژاد ویستار (Wistar) (تهیه شده از مرکز تحقیقات علوم اعصاب دانشگاه شهید بهشتی) 50 میکروگرم تستوسترون پروپیونات (Sigma, USA) (15) را در حجم 100 میکرولیتر روغن زیتون (16) در روز سوم بعد از تولد از طریق زیر پوستی دریافت کردند. شش سر موش صحرایی نیز با تزریق روغن زیتون به‏عنوان گروه کنترل انتخاب شدند. حیوانات در شرایط استاندارد (دمای 2±22 و چرخه 12 ساعت روشنایی/ تاریکی با شروع روشنایی در ساعت 7 صبح) نگه‏داری شدند و در تمام مدت آزمایش دسترسی آزاد به آب و غذا داشتند.

کانول گذاری داخل بطنی و عمل تزریق: حیوانات بعد از بلوغ در محدوده وزنی 180 تا 220 گرم،  با تزریق داخل صفاقی مخلوطی از کتامین و زایلزین ((Alfasan Company, Holand به‏ترتیب به مقدار (80 میلی گرم به‏ازای هر کیلوگرم وزن بدن) و (10میلی گرم به ازای هر کیلو گرم وزن بدن) (Alfasan-Holland) بی‏هوش شدند. کانول ساخته شده از سرسرنگ تزریقی gauge 22 با استفاده از دستگاه استریوتاکسیک (Stoelting U.S.A.) و با کمک دو عدد پیچ عینک و سیمان دندانپزشکی در سطح جمجمه تثبیت شد. بر اساس اطلس واتسون و پاکسینوس، میله مربوط به دندان پیشین فوقانی، 3/3 میلی‏متر پایین تر از خط مربوط به میله‏های گوشی و نوک کانول در مختصات بطن سوم (5/6=DV،0/0=ML،3/2=AP) قرار گرفت. حیوانات بعد از جراحی به قفس­های انفرادی برگردانده شدند و به آن‏ها  یک هفته اجازه بهبودی داده شد. پس از یک هفته دوره بهبودی 24 سرموش صحرایی درچهارگروه (در هر گروه 6=n) به‏ترتیب تزریق درون بطن سوم مغزی سالین یا مقادیر مختلف ارکسین (2، 4 یا 8 میکروگرم) را در حجم چهار میکرولیتر با استفاده از سرسرنگ دندانپزشکی gauge 27 که از طریق لوله رابط پلی اتیلنی به سرنگ هامیلتون 5 میکرولیتر وصل شده بود در ساعت 10تا 12 صبح دریافت کردند. پپتید ارکسین (Anaspec Co, USA) در آب مقطر حل شد. همچنین برای حصول اطمینان از اینکه ارکسین وارد بطن سوم شده است تصاویر بطن سوم مغز بعد از کانول گذاری و برش گیری با مختصات و تصویر بطن سوم مغز از اطلس Paxinos & Watson انطباق داده شد. شش سر موش صحرایی گروه کنترل نیز بعد از بلوغ در محدوده وزنی 180 تا 220 گرم چهار میکرولیتر سالین را از طریق تزریق درون بطن سوم مغزی دریافت کردند. بعد از دریافت مواد مورد نظر حیوانات بی‏هوش شدند و تخمدان‏ها به‏صورت دو طرفه خارج و  بلافاصله در نیتروژن مایع فریز و در دمای 80- درجه سانتی‏گراد تا زمان استخراج RNA نگه‏داری شدند.

مرحله استخراج RNA: نمونه‏های تخمدانی با استفاده از pureZol و دستگاه هموژنایزر هوموژن شدند. RNA کل نمونه‏ها با استفاده از کلروفرم، ایزوپروپانول و اتانول 75 درصد طبق دستورالعمل کیت (PureZol (Bio  Rad Co, U.S.A استخراج شد. رسوب RNA استخراج شده در آب DEPC (تهیه شده از شرکت سیناژن، ایران) حل شد و تا زمان سنتز cDNA در فریزر 20- درجه سانتی‏گراد نگه‏داری گردید. غلظت RNA با خواندن میزان جذب RNA در 260 نانومتر تعیین شد. همچنین، میزان خلوص RNA با خواندن میزان جذب در 280 نانومتر و براساس نسبت جذب280A/260A محاسبه گردید.

مرحله سنتز cDNA و واکنش زنجیره ای پلیمراز ترانس کریپتاز معکوس RT- PCR)): cDNA تک رشته‏ای با استفاده از 5 میکروگرم از RNA مطلق، پرایمر پلی‏تیمین، آنزیم DNA پلیمراز وابسته به RNA و کیت سنتز cDNA  (vivantis Co, Malaysia)   طبق دستورالعمل کیت به‏وسیله دستگاه ترمال سایکلر (Bio RAD Co, U.S.A) سنتز شد. از آنجا که ژن خانه­دار β- اکتین به‏طور پیوسته در بافت‏های مختلف از جمله تخمدان سنتز می‏شود. تعیین سطح mRNA آن توسط روش RT- PCR نیمه کمی برای نرمال کردن نمونه‏های mRNA TSPO استفاده شد. برای انجام PCR  نمونه‏های cDNA برای 35 چرخه (94 درجه سانتی‏گراد برای 30 ثانیه، 58 درجه سانتی‏گراد برای 30 ثانیه و 72 درجه سانتی‏گراد برای30 ثانیه) در حجم نهایی µl 50  (cDNA template (2µl), 10× PCR buffer (5µl), 50 mM MgCl2(1.5µl), 10mM dNTP Mix(1µl), 100µM of sense and antisense    primers (1µl of each one) and 1.25 U Taq DNA Polymerase (0.25 sterile water(38.25µl) بر حسب دستورالعمل کیتPCR  ( (Bio RAD, Co. U.S.A و با استفاده از دستگاه ترمال سایکلر (Bio RAD, Co. U.S.A)  تشدید ژنی شدند. توالی‏های الیگونوکلئوتیدی ویژه برای پرایمرهای سنس و آنتی سنس استفاده شده برای ژن β- اکتین به ترتیب برابر با 5′-GAAATCGTGCGTGACATTAAG-3′ و5′-   GCTAGAAGCATTTGCGGTGGA -3′  و برای TSPO به‏ترتیب برابر با5′- AAGAGCTGGGAGGTTTCACA -3′  و 5′- CCAGGCCAGGTAAGGATACA -3′ است (17 و 18). محصولات β- اکتین و TSPO حاصل از تکثیر ژنی به‏ترتیب 511 و 223 جفت بازی هستند. محصولات PCR توسط الکتروفورز ژل آگارز 5/1 درصد آنالیز شدند. تراکم باندها با رنگ آمیزی safe view نمایان شده و توسط نرم افزار  ImageJکمی شدند.

 

تجزیه و تحلیل آماری: نتایج حاصل به‏صورت میانگین±انحراف معیار ارائه شدند. داده‏ها با استفاده از آزمون T- testجفت نشده، آزمون ANOVA یک‏طرفه و نرم افزار  SPSS آنالیز شدند. مقایسه میانگین داده‏ها با آزمون توکی بررسی شد. در تمام آنالیزهای آماری انجام شده نتایج با 05/0P<  معنی‏دار گزارش شدند.

 

نتایج

فراوانی سطح mRNA‌‌‌ TSPO در تخمدان موش­های صحرایی آندروژنه شده نسبت به موش­های صحرایی کنترل به‏طور معنی‫داری افزایش یافت (شکلA1). سطح  mRNA β-اکتین (که به‏عنوان کنترل داخلی استفاده شده است) به‏میزان نسبتا بالا و سطح یکسانی در تخمدان موش­های صحرایی آندروژنه شده و کنترل مشاهده شد (شکلA1). شکل 1، B آنالیز نیمه کمی تراکم باندهای حاصل از نرم افزار ImageJ (میانگین داده‏های به‏دست آمده از 5 موش صحرایی در هر گروه) را نشان می‏دهد.

اگر چه نتایج نشان داده شده در شکل B1 تخمین‏های نسبی را نشان می‏دهند ولی همان‏طور که در شکل 1، B ملاحظه می‏شود سطح mRNA TSPO در تخمدان موش­های صحرایی آندروژنه شده نسبت به موش­های صحرایی کنترل به‏طور معنی‏داری بالاتر است (شکلB1).


A                  

 

 

 

 

 

 

 B                                    

 

 

شکل 1: فراوانی سطح mRNATSPO در تخمدان مو­ش­های صحرایی آندروژنه شده نسبت به مو­ش­های صحراییکنترل. (A الکتروفورز ژل آگارز برای ژن های β-اکتین و TSPO تشدید شده توسط روش نیمه کمی RT-PCR را نشان می‏دهد. B) میانگین سطح TSPO در هر گروه (6=n) را نشان میدهد که توسط نرم افزار ImageJ کمی شده است. cDNA تشدید شده ازβ mRNA -اکتین برای نرمال کردن نتایج  TSPOاستفاده شده است. نتایج بهصورت واحدهای اختیاریارائه شده است (05/0p<). * نشان دهنده افزایش معنی‏دار سطح mRNATSPO در تخمدان مو­ش­های صحرایی آندروژنه شده نسبت به مو­ش­های صحراییکنترل در سطح احتمال (05/0p<).                                                                                                    


 

همچنین نتایج حاصل از آنالیز داده ها نشان داد که فراوانی سطح mRNA TSPO در تخمدان موش‏های صحرایی آندروژنه تحت تیمار با مقادیر 2 و 4 و 8 میکروگرم ارکسین A در مقایسه با موش­های صحرایی گروه کنترل آندروژنه به‏ترتیب به‏میزان 42، 60 و 70 درصد کاهش یافت و این میزان کاهش در هر سه گروه در مقایسه با گروه کنترل آندروژنه از نظر آماری معنی­دار است (شکلA2). سطح mRNA β-اکتین (که به‏عنوان کنترل داخلی استفاده شده است) به‏میزان نسبتا بالا و سطح یکسانی در تخمدان موش­های صحرایی تیمار شده  با مقادیر مختلف ارکسین و موش­های صحرایی گروه کنترل آندروژنه مشاهده شد

 

 

(شکلA2). شکل B2 آنالیز نیمه کمی تراکم باندهای حاصل از نرم افزار ImageJ (میانگین داده‏های به‏دست آمده از 5 موش صحرایی در هر گروه) را نشان می‏دهد. همان‏طور که از نمودار مشخص است میانگین بیان ژن TSPO در گروه­های دریافت‏کننده مقادیر 2، 4 یا و 8 میکروگرم ارکسین A در مقایسه با موش­های صحرایی گروه کنترل آندروژنه به‏طور معنی­داری پایین­تر است (شکل B2).

 

 

 

 

A                                                       

 

 

 

 

 

 

 

 

 

 


                                  B

                                                                          

 

 

 

 

 

شکل 2 :فراوانی سطح mRNA TSPOدر تخمدان موش‏های صحرایی آندروژنه تحت تیمار با مقادیر2، 4 یا 8 میکروگرمارکسینA. A) الکتروفورز ژل آگارز برای ژنهای β-اکتین و  TSPO تکثیر شده توسط روش نیمه کمی  RT-PCRرا نشان می‏دهد. B) میانگین سطح TSPO در هر گروه (6=n) را نشان می‏دهد که توسط نرم افزار ImageJ کمی شده است. cDNA تشدید شده از mRNAβ-اکتین برای نرمال کردن نتایج TSPO استفاده شده است. نتایج بهصورت واحدهای اختیاری ارائه شده است (05/0p<). * نشان دهنده کاهش معنی‏دار سطح mRNA TSPOدر تخمدان موش‏های صحرایی آندروژنه تحت تیمار با مقادیر2، 4 یا 8 میکروگرمارکسینA نسبت به مو­ش­های صحراییکنترل آندروژنه در سطح احتمال (05/0p<).


 

بحث

در این مطالعه اثرات تزریق زیر پوستی تستوسترون در موش صحرایی ماده در روز سوم بعد از تولد بر روی بیان ژن TSPO در دوران بلوغ بررسی شد.  نتایج حاصل نشان داد که تزریق زیرپوستی تستوسترون بیان ژنTSPO  را نسبت به گروه کنترل در دوران بلوغ افزایش می‏دهد. تحقیقاتی که تاکنون انجام شده  است، ثابت کرده است کهTSPO  یکی از پروتئین‏‏های کلیدی در مسیر سنتز هورمون‌های استروئیدی است که در روند تولید مثل ضروری هستند. تیمار موش‏های ماده با آندروژن در دوره‏ی بحرانی جنینی و پس از تولد منجر به افزایش سطح بیان ژن و فعالیتTSPO  تخمدان می‏شود و در نتیجه سیکل تولید مثلی و رفتار تولید مثلی جنس ماده را مختل می‏کند و باعث عدم تخمک‏گذاری می‏شود به‏عبارت دیگر موجود دیگر نه نر است و نه ماده (19). نشان داده شده است که افزایش در دسترس بودن تستوسترون در سیستم عصبی مرکزی هم به‏طور مستقیم و یا غیر مستقیم از طریق افزایش میزان دهیدروتستوسترون سبب

 

تنظیم افزایشی گیرنده‏های آندروژنی (گیرنده‏های ویژه تستوسترون) می‌شود و تعداد نورون‏های حاوی گیرنده آندروژن را افزایش می‌دهد. افزایش گیرنده‏های آندروژنی به نوبه خود محتوای نوروترانسمیتری مغز موش ماده را تغییر داده و تمایز جنسی مغز را به سمت نر شدن می‌برد (20). نتایج حاصل از این تحقیق منطبق بر تحقیقات پیشین است که گزارش کرده‌اند در موش‏های صحرایی نر و ماده آندروژنه شده در دوران جنینی و یا پس از تولد بیان ژن   TSPOافزایش یافته است و آندروژن‏ها نقش اساسی در بیان ژنTSPO  تخمدان ایفا می­کنند (11 و 21). تحقیقات پیشین ثابت کرده‏اند تمایز فولیکول‏ها به‏وسیله گنادوتروپین‌ها و استروئید‌های جنسی نظیر پروژسترون، تستسترون و استروژن تنظیم می­شود (12). نشان داده شده است که تیمار با استروژن سبب تکثیر سلول‏های گرانولوزای تخمدان شده و سطح آنزیم‏های کلیدی در استروئیدوژنز و حساسیت سلول‏های گرانولوزا به تحریک به‏وسیلهFSH  را بالا می‏برد (22). تیمار با تستوسترون درجه فعالیت آنزیم آروماتاز (آنزیمی که آندروژن­ها نظیر تستوسترون را به استروژن تبدیل می­کند) (23) و پاسخ‏دهی تخمدان به گنادوتروپین را بالا می‏برد (11). آزمایش‏ها نشان داده‏‏اند که تیمار با تستوسترون، سطح استروژن سرم را افزایش می­‏دهد. بنابراین، اثرات تستـوستـرون بر روی غلظت  TSPOتا حدودی به‏وسیله ساختن

استروژن تخمدانی و به‏واسطه آن میانجی‏گری می­شود (21).

طبق آنچه در بالا بیان شد. آندروژنه کردن پس از تولد بیان ژن TSPO را به‏طور چشمگیری در دوران بلوغ افزایش می‌دهد که در روند تولید مثل اثر مثبت خواهد داشت.

همچنین در این تحقیق میزان بیان ژن TSPO در تخمدان موش‏های صحرایی بالغ آندروژنه دریافت­کننده مقادیر مختلف ارکسینA  نسبت به موش های صحرایی بالغ آندروژنه دیگر بررسی شد. نتایج نشان داد که میزان بیان ژن TSPO در تخمدان موش‏های صحرایی آندروژنه دریافت کننده مقادیر مختلف ارکسین A به‏طور معنی‏داری نسبت به گروه آندروژنه کاهش یافت. هر چند که در این تحقیق برای اولین بار اثرات ارکسین بر بیان یکی از ژن­های دخیل در استروئیدوژنز بررسی شد و نمی­توان نتایج حاصل را با تحقیقات پیشین مقایسه کرد ولی می­توان احتمال دخالت برخی از مکانیسم­های عصبی مرکزی را در اثرات ارکسین بر بیان ژن TSPO مطرح نمود. تاکنون مشخص شده است که ارکسین بر سیستم تولیدمثلی و آزادسازی هورمون­های GnRH/LH و FSH در موش‏های بالغ، به‏طور عمده اثرات مهاری اعمال می­کند (23 و 24). این احتمال وجود دارد که اثرات مهاری ارکسین بر نورون های GnRH به صورت غیر مستقیم و از طریق فعال کردن سایر نورون‏های موجود در ناحیه پره اپتیک اعمال شود که گیرنده نوع یک ارکسین (OXR1) را بیان می کنند و اثرات مهاری بر نورون های GnRH دارند (7 و 9). حدود 85 درصد نورون‏های GnRH گیرنده OXR1 را بیان می‏کنند و  75 تا 85  درصد نورون‏های GnRH در ارتباط مستقیم با نورون‏های ارکسین می‌باشند (6). بنابراین به احتمال زیاد ارکسین از طریق اثر مستقیم بر نورون‏های GnRH سبب مهار گنادوتروپین‌ها می‏شود (6). در یکسری آزمایشات دیگر، ارکسین A، بعد از تزریق به‏داخل هسته آرکوئت (ARC) و ناحیه برجستگی میانی نیز اثرات مهاری بر آزادسازی پالسی LH نشان داد (14). بر اساس تحقیقات پیشین فرض بر این است که احتمالا ارکسین A به‏طور مستقیم رهاسازی GnRH را از پایانه‏های نورونی ناحیه برجستگی میانی مهار می‌کند و یا شاید به‏صورت غیر مستقیم در ناحیه پره اپتیک میانی، هسته ARC و ناحیه برجستگی میانی و از طریق سیستم‌های مهاری دیگر نظیر β-اندورفین و یا γ- آمینوبوتیریک اسید که سبب مهار GnRH می شود، این عمل را انجام می دهد (8 و 25). نشان داده شده است که درسلول‏های تکای تخمدان، آندروژن‌ها تحت تحریک LH تولید می شوند و سپس به‏عنوان پیش ساز سنتز استروژن در سلول‌های گرانولوزای تخمدانی تحت تحریکFSH/LH  قرار می‏گیرند (12). آندروژن‏ها فعالیت تحریکی FSH در بیان ژن TSPO را در مرحله­ی اولیه تکوین فولیکولی با افزایش سطح cAMP افزایش می‏دهد (26). بنابراین احتمال دارد که ارکسین از طریق مهار آزادسازی پالسیGnRH و LH موجب کاهش تولید آندروژن‏ها در سلول تکای تخمدان می‏شود و در نتیجه عمل تحریکی آن بر FSH در مسیر بیان ژن TSPO در مراحل اولیه رشد فولیکول کاهش می‏یابد.

بنابراین ارکسین با اعمال مکانیسم‌های ذکر شده بیان ژن TSPO را که در مراحل ابتدایی استروییدوژنز و تولید مثل ضروری است را به‏طور معنی‏داری کاهش می‌دهد.

 

نتیجه گیری

در کل همان‌طور که انتظار می‌رفت یافته‏های تحقیق حاضر نشان داد که آندروژنه کردن موش‌هایی که سه روز از تولد‌شان می‌گذشت بیان ژن TSPO را نسبت به گروه کنترل افزایش می‌دهد و همچنین تزریق پپتید ارکسین Aبه‏داخل بطن سوم مغزی موش­های صحرایی که آندروژنه شده و به سن بلوغ رسیده‌اند بیان ژن  TSPOرا در تخمدان در مقایسه با موش‌های صحرایی آندروژنه شده‌ی دیگر به‏طور معنی­داری کاهش می‏دهد. در نتیجه عمل آندروژنه کردن ژن TSPO را که انتقال دهنده کلسترول در غشای خارجی میتوکندری است و برای ساختن هورمون‌های استروییدی مورد نیاز روند تولید مثل ضروری است را افزایش می‌دهد. از طرف دیگر ارکسین اثر مهاری بر بیان ژن TSPO دارد و مقدار آن را در تخمدان کاهش می‌دهد، در نتیجه بر عمل تولید مثل اثر مهاری می‌گذارد.

 

 

 

 

 

 

تشکر و قدردانی

به این وسیله نویسندگان از همکاری سرکار خانم دکتر سمیعی از دانشکده علوم زیستی دانشگاه شهید بهشتی و آقای غفاری از مرکز تحقیقات علوم اعصاب دانشگاه علوم پزشکی شهید بهشتی و سرکار خانم ملیحه سلیمی جهت همکاری صمیمانه­شان کمال تشکر و قدردانی را دارند. ضمنا این آزمایش طرح مصوب نمی‌باشد و صرفا در قالب پایان نامه کارشنـاسی ارشد انجام شده

است.

 

1. Bingham S, Davey PT , Babbs AJ , Irving EA , et al. Orexin-A, An Hypothalamic Peptide With Analgesic Properties. Pain. 2001; 92(1-2): 81-90.

2. Ripley B, Fujiki N, Okura M, Mignot E, et al. Hypocretin Levels In Sporadic And Familial Cases Of Canine Narcolepsy. Neurobiology Of Disease. 2001; 8(3): 525-534.

3. Cai Xue J, Evans Martyn L, Lister Carolyn A, Leslie Ron A, et al. Hypoglycemia Activates Orexin Neurons And Selectively Increases Hypothalamic Orexin-B Levels: Responses Inhibited By Feeding And Possibly Mediated By The Nucleus Of The Solitary Tract. Diabetes. 2001; 1: 105-112.

4. Haynes Andrea C, Jackson B, Chapman H, Tadayyon M, et al. A Selective Orexin-1 Receptor Antagonist Reduces Food Consumption In Male And Female Rats. Regulatory Peptides. 2000; 1-2 (86): 45-51.

5. Hiroto Y, Nobuhiko T, Satoshi T, Miho N, et al. A Selective Orexin-1 Receptor Antagonist, Sb334867, Blocks 2-Dg-Induced Gastric Acid Secretion In Rats. Neuroscience Letters. 2005; 376(2, 11): 137-142.

6. Ning H, GE Y, Su J, Zhang W, et al. Effects of Orexin A on mRNA Expression of  Various Neuropeptides in the Hypothalamus and Pituitary, and on Serum LH Levels in Ovariectomized Gilts. Agricultural Sciences in China. 2010; 9(9): 1362–1371

7. Tatjana Kostic S,  Natasa J, Stojilkovic, Stanko S, et al. Pharmacological Doses of Testosterone Upregulated Androgen Receptor and 3-Beta-Hydroxysteroid Dehydrogenase/Delta-5-Delta-4 Isomerase and Impaired Leydig Cells Steroidogenesis in Adult Rats. Toxicological  Sciences. 2011; 121(2): 397–407.

8. Levin E, Premkumar A, Veenman L, Kugler W, et al. The Peripheral-Type Benzodiazepine Receptor and Tumorigenicity: Isoquinoline Binding Protein (IBP) Antisense Knockdown in the C6 Glioma Cell Line. Biochemistry. 2005; 44(29): 9924-35.

9. Giatzakis, C. Transcription Regulation of the Mouse Peripheral-type Benzodiazepine Receptor (PBR) Gene in Steroidogenic Cells, Washington D.C: Georgetown University Medical Center; 2005.

10. Joëlle D, Virginie M, Stéphanie C, Christelle R, et al. Ghrelin in Female and Male Reproduction. International Journal of Peptides. 2010; 158102.

 

11. Irahara M, Tamura T, Matuzaki T, Saito S, et al. Orexin-A Suppresses the Pulsatile Secretion of Luteinizing Hormone via β-Endorphin. Biochemical and Biophysical Research Communications. 2006; 281(1): 232-6.

12. Burger L, Haisenleder Dj, Wotton Gm. The regulation of FSH beta transcription by gonadal steroids: testosterone and estradiol modulation of the activin intracellular signaling pathway. Am J PhysiolEndocrinolMetab. 2007; 293(1): 277–85.

13. Ithurralde J, Costas AL, Pessina P, Cueto E, et al. Immunohistochemical determination of estrogen receptor-α in canine vaginal biopsies throughout proestrus, estrus, and early diestrus. Theriogenology. 2013; 80(7): 805–811.

14. Small CJ, Goubillon M-L, Murray JF, Siddiqui A, et al. Central Orexin A Has Site-Specific Effects on Luteinizing Hormone Release in Female Rats. Endocrinology. 2003; 144(7): 3225-36.

15. Robinson J. Prenatal programming of the female reproductive neuroendocrine system by androgens. Reproductio.2006; 132(4): 539–47.

16. Gonzalez DE, Deis RP. Maternal behavior in cyclic and androgenized female rats: Role of ovarian hormones. Physiology & Behavior. 1986; 38(6): 789-93.

17. Akingbemi BT, Braden TD, Kemppainen BW, Hancock KD, et al. Exposure to Phytoestrogens in the Perinatal Period Affects Androgen Secretion by Testicular Leydig Cells in the Adult Rat. Endocrinology. 2007; 148(9): 4475-88.

18. Bar-Ami S, Bendel N, Leschiner S, Levin E. et al. The effects of prostaglandin F2α treatment on peripheral-type benzodiazepine receptors in the ovary and uterus during pseudopregnancy of rats. Biochemical Pharmacology. 2006; 71(4): 472–478.

19. Eacker  Sm, Agrawal N, Qian K, Dichek Hl, et al. Hormonal regulation of testicular steroid and cholesterol homeostasis. Mol. Endocrinol. 2008; 22: 623–635.

20. Charles F Roselli. Brain aromatase: Roles in reproduction and neuroprotection. The Journal of Steroid Biochemistry and Molecular Biology. 2007; 106(1–5): 143–150.

21. Campbell RE, Smith MS, Allen SE, Grayson BE, et al. Orexin neurons express a functional pancreatic polypeptide Y4 receptor. J Neurosci. 2003; 23(4): 1487-97.

22. Genissel C, Carreau S. Regulation of the aromatase gene expression in mature rat Leydig cells. Molecular and Cellular Endocrinology. 2001; 178(1–2): 141-6.

23. Piper DC, Upton N, Smith MI, Hunter AJ. The novel brain neuropeptide, orexin-A, modulates the sleep–wake cycle of rats. European Journal of Neuroscience. 2000; 12(2): 726-30.

24. Tamura T, Irahara M, Tezuka M, Kiyokawa M, et al. Orexins, Orexigenic Hypothalamic Neuropeptides, Suppress the Pulsatile Secretion of Luteinizing Hormone in Ovariectomized Female Rats. Biochemical and Biophysical Research Communications. 1999; 264(3): 759-62.

25. Couse Jf, Yates M, Deroo Bj, Korach Ks. Estrogen receptor-_ is critical to granulosa cell differentiation and the ovulatory response to gonadotropins. Endocrinology. 2005; 146(8): 3247–62.

26. Stocco C. Aromatase expression in the ovary: Hormonal and molecular regulation. Steroids. 2008; 73(5): 473-87.