ساخت لنتی‏ویروس‏های نوترکیب ناقل ژن DJ-1 و انتقال آن‏ها به سلول‏های انسانی

نوع مقاله: علمی - پژوهشی

-

چکیده

هدف: اهداف این مطالعه ساب‏کلونینگ ژن (PARK7) DJ-1 به‏ درون وکتور انتقال لنتی‏ویروسی، تولید لنتی‏ویروس‏های نوترکیب و آلوده سازی سلول‏های هدف با این ویروس‏ها می‏باشند.
مواد وروش‏ها: ژن DJ1 با استفاده از آنزیم های محدود کننده EcoR1 و Xho1 از وکتور pcDNA-DJ1 به دست آمد. وکتور انتقالی لنتی ویروس به صورت همزمان توسط آنزیم های محدود کننده EcoR1 و Sal1 بریده شد. ژن DJ1 توسط آنزیم DNA لیگاز T4 به داخل وکتور ترانسفر و بالادست ژن DJ1 وارد شد، به طوریکه توالی DJ1-IRES-Jred در پایین دست و تحت کنترل پروموتر CMV قرار گرفت. برای تولید لنتی ویروس های نوترکیب، وکتور ساخته شده به همراه دو وکتور بسته بندی و پوشش ویروس به طور همزمان به درون سلول های HEK (Human Embryonic Kidney) انتقال داده شدند. ویروس های ساخته شده برای آلوده سازی سلول های هدف استفاده شدند.
نتایج: برای اطمینان از درستی ساب‏کلونینگ از تست‏های آنزیمی و PCR استفاده شد. همچنین برای مشاهده بیان ژن Jred که نشان دهنده موفقیت ما در انتقال ژن می باشد، از میکروسکوپ فلورسانس استفاده شد. سپس برای مشاهده افزایش بیان ژن DJ1 در سلول های آلوده شده نسبت به سلول های طبیعی، از تست RT-PCR استفاده شد.
نتیجه گیری: این مطالعه کاربرد موفقیت آمیز ناقل‏های لنتی‏ویروسی در انتقال ژن به سلول‏های یوکاریوتی را نشان می‏دهد و روشن می‏سازد که این ناقل‏ها می‏توانند در درمان بیماری‏های سیستم عصبی مورد استفاده قرار گیرند.

کلیدواژه‌ها


مقدمه

بیماری پارکینسون در زمره بیماری‏های زوال نورونی است که با وجود ناشناخته بودن علت یا علل آن، بسیاری از زوایای تاریک مرتبط با زیست شناسی مولکولی این بیماری اکنون آشکار شده و پشتوانه قابل اطمینانی برای درمان‏های نوین پارکینسون به‏وجود آورده است. مطالعه روی برخی بیماران که شیوع خانوادگی پارکینسون در آن‏ها برجسته بوده است باعث شناسایی تعدادی از ژن‏های مهم و دخیل در شکل گیری این بیماری شده است. ژن PARK7 یا DJ1  سومین ژن شناخته شده مرتبط با بیماری پارکینسون می‏باشد که جهش در آن باعث فرم آتوزومال مغلوب از بیماری پارکینسون می‏شود و در ابتدا به‏عنوان یک انکوژن شناخته شد (1). همگام با آن مشخص شد که این ژن پروتئینی می‏سازد که در باروری رت‏های نر و دیگر پستانداران نقش دارد (2و3). با مشخص شدن نقش این ژن در نوعی از بیماری خانوادگی پارکینسون که به‏صورت اتوزومی مغلوب انتقال می‏یابد، مطالعه بر روی آن افزایش یافت (4). در بیماری پارکینسون، این ژن در پاسخ به استرس اکسیداتیو نقش دارد و جهش هایی که باعث از دست رفتن عمل‏کرد این ژن می‏شوند، باعث افزایش میزان این استرس اکسیداتیو می‏گردند (5،6 و 7). چندین مکانیسم برای عمل‏کرد این ژن در پاسخ به استرس اکسیداتیو گزارش شده است. از جمله اینکه محصول این ژن یک چپرون وابسته به حالت احیا می‏باشد(8). احتمالا نقش چپرونی محصول این ژن از تراکم آلفاسینوکلئین در سلول‏ها جلوگیری می‏کند (8 و9). این خصوصیت ژن می‏تواند بسیار مهم باشد. زیرا آلفا سینوکلئین و یوبی‏کوئیتین از فراوان‏ترین پروتئین‏هایی هستند که در سیتوپلاسم سلول‏های افراد پارکینسونی وجود دارند (10). از دیگر شیوه‏های فعالیت این ژن می‏توان به نقش این ژن در تنظیم منفی آپوپتوزیس در حالت احیا سلول‏ها اشاره کرد، که احتمالا از طریق فعال کردن مسیر سیگنالینگ PI3K/Akt عمل می‏کند (11 و12). همچنین نقش‏های محافظتی بیشتری نیز برای این ژن گزارش شده است (13).

نقش DJ-1 در پیشگیری از بروز علائم پارکینسون به‏خصوص از نظر حفاظت نورون‏های دوپامین ساز در برابر آسیب‏های اکسیداتیو در سالیان اخیر مورد توجه قرار گرفته است. برای آنکه عمل‏کرد DJ-1 در مقابله با سیگنال‏های مرگ در این دسته نورون‏ها بهتر و بیشتر روشن شود، در مطالعه جاری و به‏عنوان گام نخست، یک سازه لنتی ویروسی ساخته شده که حامل توالی کد کننده DJ-1 بود. با انتقال این سازه به سلول‏های مولد ویروس، لنتی ویروس‏های نوترکیب ساخته شد که پس از آلوده کردن سلول‏های هدف قادر به هدایت بیان چشمگیر DJ-1 در این سلول‏ها بود. این سازه لنتی‏ویروسی اکنون می‏تواند به‏عنوان ابزاری مهم برای مطالعات عمل‏کردی DJ-1 به‏کار گرفته شود.

 

مواد و روشها

تهیه پلاسمیدهای ویروسی: ناقل‏های ویروسی شامل ناقل بسته بندی (∆∆∆pCD/NL-BH*) ناقل پوششی (LTR-G)  و ناقل ترانسفر (PLV-Jred) با استفاده از کیت Maxiprep از کیاژن خالص سازی شدند (14).

برش ناقل انتقالی برای وارد سازی قطعه هدف (Digestion):  برای وارد کردن ژن DJ-1 به‏درون ناقل انتقالی و بالادست ژن Jred، ابتدا با استفاده از آنزیم‏های EcoR1 و Sal1، پلاسمید ترانسفر لنتی‏ویروس را برش داده شد تا با از دست دادن قطعات اضافی به‏صورت یک پلاسمید خطی درآید. به این صورت که طبق دستورالعمل، پلاسمید مورد نظر همراه با آنزیم های مذکور و بافرهای مخصوص آنها به مدت دوساعت در دمای 37 درجه انکوبه کردیم. محصول هضم آنزیمی را با استفاده از ژل آگاروز، الکتروفورز و با استفاده از کیت استخراج از ژل (سیناژن) بازیابی گردید. به‏طور همزمان ژن DJ-1 با استفاده از دو آنزیم EcoR1 و Xho1 از داخل پلاسمیدpCDNA-DJ1  خارج و به‏طرز مشابه از روی ژل آگاروز استخراج شد.

وارد سازی ژن DJ-1 به درون ناقل انتقالی (Ligation): با توجه به سازگار بودن انتهاهای چسبنده حاصل از برش با آنزیم‏های Sal1 و Xho1، محصول این دو هضم آنزیمی به‏طور مستقیم و با استفاده از آنزیمDNA  T4  لیگاز و طی یک واکنش لیگاسیون بهم پیوند شد. محصول واکنش با ترانسفورماسیون به‏روش شوک حرارتی به باکتری‏های Eschrichia coli Top10 مستعد شده منتقل گردید. کولونی‏های حاصل از رشد این باکتری‏ها به‏طور تصادفی مورد غربالگری به‏روش  Cracking قرار گرفت. به این‏صورت که باکتری‏ها طبق پروتکل به‏صورت نسبی هضم شده و محلول رویی حاوی DNA روی ژل آگارز الکتروفورز گردید و سپس از نمونه‏های مشکوک DNA پلاسمیدی استخراج شده و روی آن‏ها تست آنزیمی و  PCR انجام شد و سرانجام نمونه مورد نظر شناسایی و  انتخاب گردید.

کشت سلول: سلول‏های HEK-293T به‏عنوان مولد ویروس در محیط DMEM+10% FBSشرکت Gibco در دمای 37 درجه و CO2 5 درصد کشت و پاساژ داده شدند. دو میلیون سلول در پتری دیش‏های 10 سانتی‏متری  مخصوص کشت سلول، 24 ساعت قبل از ترانسفکشن کشت داده شدند تادر روز بعد 50 تا 60 درصد پتری دیش را پر کنند. برای آلوده سازی ویروسی تعداد 50 هزار سلول HEK-293T در پلیت 24 خانه، 24 ساعت قبل از آلوده سازی کشت داده شدند.

تولید ویروس: برای تولید لنتی ویروس‏های نوترکیب وفعال، سلول‏های مولد ویروس را همزمان با سه ناقل لنتی‏ویروسی به مقدار 15 میکروگرم از ناقل ترانسفر و 10 میکروگرم از هریک از ناقلین بسته بندی و غشایی، با روش رسوب- DNA فسفات کلسیم ترانسفکت شد. برای تشکیل این رسوب،DNA های مذکور همراه با 50 میکرولیتر از کلرید کلسیم 5/2 میلی مولار، با آب استریل به حجم 500 میکرولیتر رسید و به این محلول در حالی‏که روی شیکر در حال چرخان بود هم حجم آن HEPES  به آرامی اضافه شد. محلول حاصل را 20 دقیقه در زیر هود انکوبه شد تا رسوب مطلوب به‏دست آید. سپس این رسوب به آرامی و قطره قطره به محیط سلول‏های هدف اضافه گشت. سلول‏ها به‏مدت 8 ساعت انکوبه شدند و سپس محیط آن‏ها با محیط جدید تعویض شد. پس از این مراحل سلول‏ها تا زمان تولید ویروس و رها سازی آن به محیط کشت، در شرایط انکوباتوری ذکر شده نگهداری شدند.

تغلیظ ویروس و آلوده سازی سلول‏های هدف: محیط کشت سلول‏های ترانسفکت شده پس از 24 و 48 ساعت جمع آوری و از فیلتر 45/0 میکرون عبور داده شد. سپس محیط فیلتر شده به‏درون ستون‏های آمیکون MW 100(شرکت کیاژن)  ریخته و مدت 10 دقیقه در دور rpm 4000 سانتریفیوژ گشت. محلول باقیمانده پشت فیلتر که تغلیظ شده و پر از ذرات ویریونی بود جمع آوری شد. حجم های مختلف از این محلول  برای آلوده سازی سلول‏های هدف استفاده شد. سپس سلول‏ها در شرایط انکوباتوری ذکر شده قرار داده شدند تا بیان ژن Jred موجود در ناقل انتقالی، در زیر میکروسکوپ فلورسنس مشاهده شود. پس از این مرحله با استفاده از تکنیک RT-PCR از افزایش بیان  ترانسژن DJ-1 اطمینان حاصل گردید.

استخراج RNA و آزمایش RT-PCR : همان‏طور که قبلا گزارش کرده ایم، 96 ساعت پس از ترانسدوکشن سلولی، کل RNA سلولی با استفاده از کیت مربوطه                                (High Pure RNA Isolation Kit, Roche) استخراج شده و پس از اطمینان از سلامت کامل آن در روی ژل، دو میکروگرم از آن برای سنتز cDNA تحت شرایط گزارش شده به‏کار برده شد (15). ساخت cDNA  به کمک ترانسکریپتاز معکوس از(Fermentas, Lithuania)  و در حضور هگزامرهای راندوم و RNase Inhibitor  صورت گرفت. برای تکثیر یک قطعه 185 جفت بازی از cDNA مربوط به DJ-1 انسانی، جفت پرایمر زیر بر اساس توالی کد کننده آن به‏شرح زیر طراحی و سنتز شد.

(NM_007262.4 GenBank accession no.):

Forward: 5'- CGGGGTGCAGGCTTGTAAA -3',

Reverse: 5'- ACCACATCACGGCTACACTG -3'.

مقادیر یکسان از هر نمونه cDNA برای آزمایش PCR مورد استفاده قرار گرفت. پس از 2 دقیقه دناتوراسیون نمونه‏ها در در دمای 95 درجه سانتی‏گراد واکنش PCR با 30 سیکل دناتوراسیون (94 درجه سانتی‏گراد 45 دقیقه                 Annealing در 59 ‏ درجه سانتی‏گراد 1 دقیقه و مرحله            Extension در 72 درجه سانتی‏گراد 45 ثانیه) به انجام رسید. محصولات PCR با استفاده از ژل آگاروز 2/1 درصد آنالیز و تصویر برداری شد. شدت باندهای این تصاویر با استفاده از نرم افزار US-Scan-It Gel Analysis Software (Skill Scientific Inc.  Orem, Utah)  اندازه گیری گردید.

 

نتایج

بازیابی قطعات DNA مورد نظر:

واکنش  Digestionروی ناقل لنتی‏ویروسی (شکل1) و همچنین روی ناقل حاوی ژن  DJ-1 (شکل 2) با موفقیت انجام شد.

استخراج قطعات مورد نظر از روی ژل آگاروز:

قطعه‏ی حدود12کیلو بازی وکتور خطی شده و قطعه ی 850 جفت بازیDJ-1 با استفاده از کیت استخراج از ژل، از روی ژل آگاروز استخراج شده و به‏منظور تعیین غلظت، به‏طور همزمان روی ژل آگاروز، الکتروفورز گردیدند (شکل3).

تست کرکینگ:

پس از انجام واکنش Ligation تعدادی از کلونی‏ها به صورت اتفاقی انتخاب شده و روی آن‏ها تست کرکینگ انجام شد و نمونه‏هایی که روی ژل کمتر از بقیه حرکت کرده بودند انتخاب گردید (شکل4).

 

 

 

 

شکل 1: خطی شدن ناقل لنتی ویروسی pLV-Jred

شکل 2: برش ناقلpcDNA-DJ1  و خروج ژن DJ1

 

 

 

 

شکل3: بازیابی قطعات از ژل

 

 

 

شکل4: تست کرکینگ

 

 

تست Digestion:

به‏منظور اطمینان از صحت نمونه‏های انتخاب شده، این نمونه‏ها با آنزیم های   EcoR1و Sal1 بریده شدند که در یکی از دو نمونه، قطعات به‏دست آمده نشان از صحت کلنی‏ها در این مرحله داشت (شکل 5).

تست PCR:

برای اطمینان کامل از درستی کلون به‏دست آمده، با استفاده از پرایمرهای موجود، برای نمونه مثبت واکنش PCR انجام گردید و نتیجه‏ی آن نشان دهنده‏ صحت این کلونی بود (شکل6).

 

 

 

شکل5: تست آنزیمی کلون مورد نظر و به‏دست آمدن قطعات مورد انتظار

 

شکل6: واکنش PCR بر روی نمونه مثبت و نمونه مورد نظر برای ژن DJ1

 

 

موفقیت مرحله ترانسفکشن:

مشاهده سلول‏ها با میکروسکوپ فلورسنس در فواصل زمانی متوالی پس از ترانسفکشن، آغاز بیان ژن Jred را در سلول‏های HEK-293T، 9 ساعت  پس از ترانسفکشن نشان داند و در ساعات بعدی بیان این ژن  تشدید گردید (شکل7).

 

ترانسداکشن سلول‏های هدف و بیان ژن گزارشگر:

حدود 36 ساعت پس از افزودن استوک ویروسی به سلول‏های هدف اولین نشانه های بیان Jred با استفاده از میکروسکوپ فلورسنس مشاهده شد و موفقیت آمیز بودن ترانسدوکشن را به اثبات رساند. بیان Jred در فاصله زمانی 72 ساعت به حداکثر خود رسید (شکل 8).

 

 

شکل7: بیان ژن Jred در زیر میکروسکوپ فلورسنس. الف) سلول های HEK-293T قبل از ترانسفکشن، ب) سلول های HEK-293T ، 24 ساعت پس از ترانسفکشن. (بزرگنمائی: ×100)

 

 

شکل8: بیان ژن Jred در زیر میکروسکوپ فلورسنس. الف)سلول های HEK-293T قبل از ترانسدوکشن، ب) سلول های HEK293T، 72 ساعت پس از ترانسدوکشن. (بزرگنمائی: ×200)

 

افزایش بیان ژن DJ-1:

یک هفته پس از آلوده شدن سلول‏های HEK-293T با ویروس‏های هدف و اطمینان از بیان ترانسژن گزارشگر،  RNA این سلول‏ها استخراج شد و با استفاده از تکنیک RT-PCR میزان بیان ژن DJ-1 قبل و بعد از ترانسداکسیون مشاهده گردید (شکل9). این آزمایشات نشان داد که میزان بیان DJ-1 در سلول‏های آلوده شده به ویروس pLV-DJ-1 نسبت به سلول‏های کنترل افزایش یافته است.

 

 

 

شکل9: تصویر ژل الکتروفورز از واکنش RT-PCR بر روی ژن DJ-1.

 

 

بحث

امروزه انتقال ژن یکی از مهم ترین تکنیک‏ها در رابطه با تشخیص، پیشگیری و درمان بسیاری از بیماری‏ها از جمله بیماری پارکینسون تحت عنوان ژن درمانی به‏شمار می‏رود. ناقلین مختلف و متعددی برای انتقال ژن مورد استفاده قرار می‏گیرند که می‏توان آن‏ها را به دو گروه ناقلین ویروسی و ناقلین غیر ویروسی دسته بندی کرد (16). از بین ناقلین ویروسی، لنتی ویروس‏ها به‏دلیل داشتن خصوصیات برجسته در سال‏های اخیر مورد توجه قرار گرفته‏اند.  این ویروس‏ها متعلق به خانواده‏ رترو ویریده بوده و همانند رترو ویروس‏ها قادرند پس از ورود به سلول میزبان ژنوم خود را به داخل ژنوم میزبان وارد سازند. رترو ویروس‏ها زمانی قادرند این کار را انجام دهند که سلول در حال تقسیم باشد ولی لنتی‏ویروس ها می‏توانند بدون نیاز به تقسیم سلولی وارد هسته سلول میزبان شده و ژنوم خود را به‏داخل ژنوم میزبان متصل کنند (17). حذف برخی از ژن‏های اصلی، فرعی و تنظیمی و همچنین جهش‏های حذفی (حذف 400 نوکلئوتید از ناحیه U3) در نواحی ضروری 3’LTR که مربوط به افزاینده (Enhancer) و پروموتر (Promoter) می‏باشد، منجر به غیر فعال سازی نسخه برداری از پروویروس شده و ناقلین حاصل از این جهش‏ها تحت عنوان ناقلین SIN (Self inactivating vectors) نامیده می‏شوند (18).

در این حامل‏ها به منظور افزایش ایمنی زیستی، تعـداد زیادی از

ژن‏های غیر ضروری و بیماریزای ویروسی حذف شده و دارای نقص در سیستم همانند سازی می‏باشند. حاملین لنتی ویروسی نسل سوم از 4 حامل مجزای لنتی‏ویروسی تشکیل شده‏اند که یکی از آن‏ها حامل انتقال و بقیه حاملین کمکی برای بسته بندی لنتی‏ویروس‏ها می باشند. به دلیل عدم وجود همولوژی بین این 4 حامل، امکان نوترکیبی و قرار گرفتن ژن های لنتی‏ویروسی در مجاور هم کاهش یافته و ایمنی آن‏ها افزایش پیدا کرده است (19). یکی از مهم‏ترین معایب حاملین لنتی‏ویروسی، ورود اتفاقی آن‏ها به داخل ژنوم میزبان و احتمال ایجاد جهش زایی دخولی آن هاست (20). در این مطالعه ما توانستیم لنتی‏ویروس‏های نوترکیب ناقل ژن DJ1 را با موفقیت تولید کنیم که می‏توانند در مطالعات بعدی به‏منظور بررسی افزایش بیان این ژن در مقابله با عوامل گوناگون از جمله رادیکال‏های آزاد مورد بررسی قرار گیرند.

 

نتیجه گیری

نتیجه این مطالعه کاربرد موفقیت آمیز ناقل‏های لنتی‏ویروسی در انتقال ژن به سلول‏های یوکاریوتی را نشان می‏دهد و روشن می‏سازد که این ناقل‏ها می‏توانند در درمان بیماری‏های سیستم عصبی از قبیل پارکینسون و آلزایمر مورد استفاده قرار گیرند، همان گونه که امروزه به طور وسیعی از آن‏ها در سراسر دنیا استفاده می‏شود.

تشکر و قدردانی

 از همکاری تکنیکی آقای عباس رحیمی  در تهیه این مقاله سپاسگزاری می‏شود. هزینه انجام این پژوهش از طریق طرح شماره 420 مصوب پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری تامین شده است.

1. Nagakubo D, Taira T, Kiatura H, Ikeda M, et al. DJ-1, a novel oncogene which transforms mouse NIH3T3 cells in cooperation with ras. Biochem Biophys Res Commun. 1997;  231(2): 509–513.

2. Wagenfeld A, Gromoll J, Cooper TG. Molecular cloning and expression of rat contraception associated protein 1 (CAP1), a protein putatively involved in fertilization. Biochem Biophys Res Commun. 1998; 251(2): 545–549.

3. Welch JE, Barbee RR, Roberts NL, Suarez JD, et al. SP22: a novel fertility protein from a highly conserved gene family. J Andrology. 1998; 19(4): 385–393.

4. Bonifati V, Rizzu P, van Baren MJ, et al. (18 co-authors). Mutation in the Dj-1 gene associated with autosomal recessive early-onset parkinsonism. Science. 2003; 299(4): 256–259.

5. Yokota T, Sugawara K, Ito K, Takahashi R, et al. Down regulation of DJ-1 enhances cell death by oxidative stress, ER stress, and proteasome inhibition. Biochem Biophys Res Commun. 2003; 312(4): 1342–1348.

6. Canet-Aviles RM, Wilson MA, Miller DW, Ahmad R, et al. The Parkinson’s disease protein DJ-1 is neuroprotective due to cysteine-sulfinic acid-driven mitochondrial localization. Proc Natl Acad Sci USA. 2004; 101(24): 9103–9108.

7. Martinat C, Shendelman S, Jonason A, Leete T, et al. Sensitivity to oxidative stress in DJ-1-deficient dopamine neurons: an ES-derived cell model of primary parkinsonism. PLoS Biol. 2004; 2(4): 1754–1763.

8. Shendelman S, Jonason A, Martinat C, Leete T, et al. DJ-1 is a redox-dependent molecular chaperone that inhibits a-synuclein aggregate formation. PLoS Biol. 2004; 2(4): 1764–1773.

9. Zhou W, Freed CR. DJ-1 up-regulates glutathioine synthesis during oxidative stress and inhibits A53T a-synuclein toxicity. J Biol Chem. 2005;  280(52): 43150–43158.

10. Abou-Sleiman PM, Muqit MMK, Wood NW. Expanding insights of mitochondrial dysfunction in Parkinson’s disease. Nat Rev Neurosci. 2006; 7(3): 207–219.

11. Kim RH, Peters M, Jang YJ, et al. (16 co-authors). Dj-1, a novel regulator of the tumor supressor PTEN. Cancer Cell. 2005; 7(3): 263–273.

12. Yang Y, Gehrke S, Haque ME, et al. (12 co-authors). Inactivation Of  Drosophila DJ-1 leads to impairments of oxidative stress response and phosphatidylinositol 3-kinase/Akt signaling. Proc Natl Acad Sci USA. 2005; 102(3): 13670–13675.

13. Xu J, Zhong N, Wang H, Elias JE, et al. The Parkinson’s diseaseassociated DJ-1 protein is a transcriptional co-activator that protects against neuronal apoptosis. Hum Mol Genet. 2005; 14(9): 1231–1241.

14. Esmaeilzadeh E, Gardaneh M, Vaziri HR. The Concomitant Effect of Shikonin and Glutathione Peroxidase-1 on Enhanced Survival of Dopaminergic Neurons against Parkinsonian Toxicity. JCT. 2012; 3(2): 153-160.

15. Quinonez R, Sutton RE. Lentiviral vectors for gene delivery into cells. DNA Cell Biol. 2002; 21(12): 937-51. Review.

16. Neeltje A, Verma KM. Gene therapy with viral vector. Ann Rev Toxicol. 2003; 43(7): 413-439.

17. Esmaeilzadeh E, Gardaneh M, Gharib E, Sabouni F. Shikonin Protects Dopaminergic Cell Line PC12 Against 6-Hydroxydopamine-Mediated Neurotoxicity Via Both Glutathione-Dependent and Independent Pathways and by Inhibiting Apoptosis. Neurochem res. 2013;  38(8): 1590-604.

18. Lever AML, Strappe PM, Zhao J. Lentiviral vectors, J Biomed Sci. 2004; 11(3): 439-449.

19. Pawliuk R, Bachelot T, Raftopoulos MH, et al. Retroviral vectors aimed at gene therapy of human a-globin gene disorders. Proc.Natl. Acad. Sci. USA. 1998; 850: 151-162.