بررسی فعالیت آنزیم های پراکسیداز و کاتالاز و میزان بیان ژن‌های رمزکنندۀ آنها در میوۀ سیب تحت تنش بیمارگر Penicillium expansum و عصارۀ پوست سبز گردو

نویسندگان

1 دانشجوی دکتری بیماری شناسی گیاهی، دانشکده کشاورزی، دانشگاه لرستان، خرم آباد، ایران

2 استادیار و دانشیار گروه گیاه‌پزشکی، دانشکده کشاورزی، دانشگاه لرستان، خرم آباد، ایران

چکیده

هدف: هدف از این مطالعه بررسی تاثیر عصاره پوست سبزگردو بر روی کاهش علایم بیماری کپک آبی سیب، تغییرات میزان فعالیت آنزیمهای دفاعی شامل پراکسیداز و کاتالاز و همچنین تغییرات میزان بیان ژن این دو آنزیم در میوه سیب بود.
مواد و روش­ها: در این پژوهش ابتدا از پوست سبزگردو عصاره­گیری شد، سپس این عصاره­های گیاهی جهت کنترل بیماری کپک آبی سیب با عامل Penicillium expansum، در آزمایشگاه و در انبار 4 درجه سانتی­گراد استفاده شدند. تاثیر عصاره آبی پوست سبز گردو بر میزان فعالیت و همچنین بیان ژن­های دو آنزیم پراکسیداز و کاتالاز در میوه سیب، نیزمورد ارزیابی قرار گرفت.
نتایج:بر اساس نتایج، در مورد آزمون اختلاط عصاره با محیط کشت و نیز عصاره­های آبی و متانولی پوست سبز گردو در غلظت 1000×6 با میزان 41/86 و 84/75 درصد ممانعت از رشد قارچ بیمارگر بهترتیب، نسبت به شاهد، بهترینکنترل­کنندگی را نشان داد. در آزمون انبار 4 درجه سانتی­گراد سطح لکه ایجاد شده در تیمار عصارههای آبی و متانولی با غلظت 1000×6 بهمیزان 50/94 و 69/81 درصد، بهترتیب، نسبت به تیمار شاهد کاهش یافت. فعالیت آنزیمهای پراکسیداز و کاتالاز در روز نهم به بیشترین مقدار خود در بین روزهای نمونه­برداری رسید. بررسی بیان ژنهای پراکسیداز و کاتالاز بهروش Real-time PCR نشان داد که بهترتیب 60/227 و 08/314 برابر میزان بیان دو ژن و در تیمار عصاره پوست گردو بههمراه بیمارگر، نسبتبهشاهد و در روز نهم،افزایش نشان داد.
نتیجه­گیری: با توجه به نتایج این تحقیق مشخص شد که عصاره پوست سبز گردو علاوه بر اثر مستقیم قارچکشی قادر به القا بیان ژن­های دفاعی و بهدنبال آن افزایش فعالیت آنزیمهای دفاعی در میوه سیب است.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

سیب یکی از مهم­ترین محصولات باغی در ایران و جهان محسوب می­شود. نظر به تولید زیاد این محصول در یک فصل بهخصوص از سال، نیاز این محصول به انبارداری امری اجتناب ناپذیر است. از طرف دیگر بهعلت کمبود انبارهای مجهز به تکنولوژی مناسب، این محصول همواره در معرض خسارات زیادی از جمله بیماریی­های قارچی است (1). میزان خسارت وارده به میوه­جات از مزرعه، انبار تا مصرف، بهدلیل فقدان امکانات انبارداری مناسب در کشورها توسعه یافته تا 25 درصد و در کشورهای در حال توسعه تا 50 درصد نیز می­رسد. یکی از مهم­ترین بیماریهایی که به این محصول در انبار خسارت وارد میکند بیماری کپک آبی سیب با عامل گونه­های مختلف جنس Penicillium است. در طول دهه 1950 میلادی بیماری­های بعداز برداشت سیب بیش از 80 تا 90 درصد خسارت به این محصول وارد کردند (2). Rosenberger  تخمین زد که در آمریکا سیب­های برداشت شده در حدود 4/4 میلیون دلار در اثر بیماریهای بعد از برداشت خسارت دیدند. گزارشی که در سال 2004 منتشر شد نشان داد که خسارت انباری در کلیه محصولاتی که بعد از برداشت در سردخانه یا انبار قرار می گیرند عددی بین 5 تا 25 درصد است (3). قارچ عامل کپک آبی سیب (P. expansum)، علاوه بر خسارت مستقیم و از بین بردن بافت میوه یکی از مهم­ترین منابع تولید پاتولین می­باشد، پاتولین مایکوتوکسینی است که اثرات سرطانزایی، سمی بودن و جهش زایی بالایی دارد و  در میوه­­های سیب و هلوآلوده به این بیمارگر وجود دارد (4). این بیماری یکی از بیماری­های مهم و کلیدی بر روی سیب در داخل انبار است (2). استفاده از قارچکش­های شیمیایی یکی از سریع­ترین راه­های مبارزه با بیمار­های گیاهی است، اما آسیب به محیط زیست و سلامت انسان از یکطرف و مقامت عوامل بیماری­زا به ترکیبات شیمیایی از طرف دیگر محققان را بر آن داشت که بهدنبال روشهای جایگزین جهت جلوگیری از آثار مخرب این ترکیبات باشند (5).

عصاره­های گیاهی ترکیباتی با منشا طبیعی هستند که آثار مخربی بر سلامت انسان ندارند، سریع تجزیه می­شوند و تا حالا گزارشی مبنی بر مقاومت بیمارگرها نسبت به اسانس­ها و عصاره­های گیاهی گزارش نشده است (6). عصاره­های گیاهی علاوه بر اینکه خاصیت ضدمیکروبی دارند قادرند بعضی از مکانیسم­های دفاعی گیاه را در برابر عوامل میکروبی از جمله قارچی فعال کنند. یکی از این مکانیسم­های دفاعی افزایش فعالیت آنزیم­های دفاعی از جمله آنزیم­های آنتی­اکسیدانت مانند پراکسیداز، کاتالاز، پلی­فنل­اکسیداز، فنیل­آلانین­آمونیالیاز و ترکیبات فنلی  است (7). القای ساخته شدن آنزیم­های دفاعی با افزایش بیان این ژن­ها صورت می­گیرد.

نظر به اینکه بیماری کپک آبی سیب یکی از مهم­ترین بیماری­های پس از برداشت سیب می­باشد و از طرفی تیمار سیب­ها در انبار با سموم قارچکش باعث تهدید سلامت انسان و محیط زیست می­شود، در نتیجه در این پژوهش تاثیر عصاره گیاهی گردو بر میزان علایم بیماری، القای تعدادی از آنزیمهای دفاعی گیاهی و همچنین ژن­های بیان­کننده این آنزیم­ها در سیب آلوده شده به این بیمارگر مورد مطالعه قرار گرفت.

 

مواد و روشها

رقم سیب: در این تحقیق  از رقم سیب زرد (Golden delicious)  استفاده شد. این رقم از باغهای سیب شهرستان سمیرم استان اصفهان که بهصورت ارگانیک و بدون مصرف آفتکش شیمیایی بودند تهیه شد.

 

تهیه زادمایه:ایزوله بیماریزای P1 قارچ P. expansum  از آزمایشگاه گروه گیاه­پزشکی پردیس ابوریحان دانشگاه تهران دریافت شدند. در شرایط سترون زیر هود لامینار مقداری از اسپور قارچ توسط یک اسکالپل استریل جمعآوری شده و در 10 میلی­لیتر آب مقطر استریل اضافه شد و سپس با استفاده از دستگاه شیکر لوله (ورتکس) سوسپانسیون اسپوری تهیه شد. جهت بهتر پخش شدن اسپورها در آب مقطر به مقدار 5/0 درصد،Tween 20  به آب مقطر قبل از اتوکلاو شدن اضافه شد.

مواد گیاهی: در این تحقیق، از عصاره پوست سبز گردو استفاده شد، این قسمت از گیاه گردو ابتدا شستشوی سطحی شده و سپس بهوسیله هیپوکلریت سدیم 2 درصد بهمدت 5 دقیقه ضدعفونی و سپس با آب مقطر سترون سه مرتبه شسته شدند (8). نمونه­های گیاهی در شرایط آزمایشگاه و دور از تابش مستقیم نور آفتاب خشک شدند. سپس پوست سبز گردوکه خشک شده بود، بهوسیله خردکن پودر شده و از الک یک مش عبور داده شدند (9).

تهیه عصاره­های گیاهی به دو روش استفاده از متانول (10) و آب (11) انجام شد.در روش استفاده ازمتانول، پنج گرم از ماده خشک گیاهی در 100 میلیلیتر متانول خالص (شرکت Merck) خیسانده شد و بعد از 24 ساعت ماده گیاهی همراه متانول در یک هاون چینی ساییده شد. محلول حاصل توسط پارچه ململ صاف شده و در rpm 5000 بهمدت 10 دقیقه سانتریفوژ شد،75 میلی­لیتر از محلول رویی به یک استوانه مدرج منتقل شده، 25 میلیلیتر آب­مقطر سترون به آن اضافه شد تا حجم آن به 100 میلی­لیتر برسد، سپس هم حجم با آن هگزان اضافه شد. این مخلوط دو ساعت روی شیکر قرار داده شد، پس از این مرحله، بخش های مختلف به کمک دکانتور جدا شده و بخش متانولی جهت تبخیر متانول و استحصال عصاره در زیر هود قرار داده شد.

در روش دوم بعد ازضدعفونی سطحی نمونههای گیاهی پنج گرم از ماده خشک گیاهی در 100 میلی­لیتر آب مقطر سترون خیساندهشد وپس از 24 ساعت از پارچهململ عبور داده شد و سانتریفوژ شد. در این مرحله بهمنظور سترون کردن عصاره آبی از صافی میکروبیولوژیک دو میکرونی استفاده شد.

 

تاثیر عصاره­های گیاهی بر رشد قارچ بیمارگر با استفاده از روش اختلاط با محیط کشت: در هر ظرف پتری که حاوی 20میلیلیتر محیط­کشت PDA بود، عصاره پوست گردو در غلظت­های 0، 500، 1000، 1500 و 2000 پی­پی­ام (در حلال­های آبیو متانولی) به محیطکشت اضافه شد. پلاکی از حاشیهکشت هفت روزه قارچ بیمارگر در مرکز ظروف پتری قرار داده شد و تا روز پنجم قطر میسلیومی آن اندازه­گیری شد. تمامی مراحل در شرایط سترون و در سه تکرارصورت گرفت و همه آزمایشها دو بار انجام شد (4). درصد بازدارندگی رشد میسلیومی هر تیمار از فرمول زیر (1) محاسبه شد:

 

        فرمول (1)      

A: قطر کلنی در شاهد

B: قطر کلنی در تیمار

 

بررسی اثر عصاره ها در کنترل بیماری کپک آبی سیب در انبار 4 درجه سانتی­گراد: برای ضدعفونی سطحی، میوه­ها در هیپوکلریت­سدیم 2 درصد غوطه­ور و سپس دوبار با آب سترون شستشو داده شدند و در نهایت بهمدت 20 ثانیه در اتانول 70 درصد غوطه­ور شدند، سپس توسط یک میخ استریل سه سوراخ به قطرهای5/1 میلیمترو عمق 3 میلیمتردر هر سیب ایجاد شد. 20 میکرولیتر سوسپانسیون قارچ بیمارگر با غلظت 106 کنیدی در هر میلی لیتر آب مقطر سترون به محل زخم مایه­زنی شد. پس از خشک شدن زخم­ها میوه­ها بهوسیله محلول­های تهیه شده از عصاره­ها با غلطت­های یک، دو، چهار و شش در هزار (حلال­های آبی و متانولی) محلول پاشی و در ظروف یکبار مصرف بسته بندی شده و تا پایان آزمایش در انباربا دمای 4 درجه سانتی­گراد و رطوبت نسبی معمول در شرایط سترون نگهداری شد. بعد از طی دوره نگهداری زخم­ها از نظر ایجاد پوسیدگی هر هفت روز یکبار، بررسی شده و قطر لکه­ها با استفاده از کولیس اندازه­گیری شد. در این آزمایش برای هر تیمار چهار تکرار در نظر گرفته شد که هر تکرار شامل سه میوه بود. سیبهای محلول­پاشی شده با تویین 80 بدون اسپور قارچ به­عنوان شاهد سالم در نظر گرفته شد (5).

این آزمایش بهصورت آزمون فاکتوریل با دو فاکتور A و B در قالب طرح کاملا تصادفی در چهار تکرار انجام گرفت. فاکتور A شامل عصاره های مختلف و فاکتور B نیز شامل غلطت­های مختلف عصاره است، که در آزمون­های مختلف دارای تعداد سطوح مختلف است.

 

بررسی برخی مکانیسم­های دفاعی بیوشیمیایی گیاه: به­منظور بررسی تغییرات آنزیم پراکسیداز و کاتالاز میوه­های سیب تهیه شد و تیمارها و تمام مراحل دیگر این آزمایش مانند مایه زنی با عصاره آبی پوست سبز گردو و مایه­زنی قارچ، همانند آزمایشات مربوط به انبار انجام شد بر روی میوه ها اعمال شدند، دمای انبار در مورد بررسی فعالیت آنزیمی و همچنین بررسی میزان بیان ژن های دفاعی 15 درجه سانتی­گراد در نظر گرفته شد.

آزمایش در مورد عصاره های گیاهی بهصورت آزمون فاکتوریل با دو فاکتور A و B بر پایه طرح کاملا تصادفی در چهار تکرار  انجام گرفت. هرکدام از این آزمایشات با تیمارهای مختلف یعنی تیمار عصاره­های گیاهی تنها، عصارۀ گیاهی و قارچ بیمارگر، بیمارگر تنها و سیب سالم (فاکتورA)و در پنج روز (فاکتورB)که روزهای نمونه برداری شامل روزهای 3، 6، 9 ،12 و15 انجام شد. در ضمن نمونه برداری قطر لکه­های ایجاد شده روی میوه سیب در روزهای مختلف اندازهگیری شد و نیز میزان تغییرات آنزیم­های پراکسیداز و کاتالاز و نیز تغییرات میزان بیان ژن­های این دوآنزیم در روزهای نمونه­برداری به صورت مجزا بررسی شد.

 

ارزیابی میزان پروتئین کل قابل حل در عصاره (روش برادفورد): برای محاسبه فعالیت اختصاصی آنزیمهای مورد آزمون و تعمیم فعالیت آنزیم به میلی­گرم پروتئین موجود در بافت؛ میزان پروتئین تام موجود در نمونه­ها به روش برادفورد تعیین شد (12). این روش بر مبنای اتصال رنگ کوماسی بریلیانت­بلو موجود در معرف بردفورد به مولکول پروتئین استوار است.

 

تهیه محلول پایه پروتئین استاندارد: برایتهیه منحنی استاندارد ابتدا محلول پایه پروتئین تهیه شد. پنج میلی­گرم از پروتئین استاندارد (ساخت کارخانهFluka )در پنج میلی­لیتر بافر فسفات سدیم 50 میلی مولار با 7pH   حل کرده و در دمای 20- درجه سانتیگراد نگهداری شد. پروتئین استاندارد مورد استفاده آلبومین سرم گاوی  BSA فراکسیون پنج بود.

 

تهیه منحنی پروتئین استاندارد

مقادیر  5، 10، 25 ،30، 40، 50، 60 و 70 میکروگرم از محلول BSA در آب مقطر سترون بهطور جدا گانه به سه میلیلیتر معرف بردفورد در لوله آزمایش (5 میلیلیتری) اضافه و پس از مخلوط کردن کامل اجزای آزمایش، بلافاصله میزان جذب نور در طول موج  nm595= λ max با استفاده از دستگاه اسپکتروفتومتر (مدل CECIL 9500، ساخت انگلیس) اندازه­گیری شد. لوله­های حاوی صفرمیکرولیتر پروتئین استاندارد جهت صفر کردن دستگاه استفاده و هر کدام از تیمار ها در سه تکرار انجام گرفت و میانگین آن­ها جهت تهیه منحنی استاندارد استفاده شد (13). منحنی استاندارد و معادله رگرسیون بر اساس جذب نور هر کدام از غلظت­ها محاسبه و ترسیم شد. برای تعیین میزان پروتئین کل عصاره مورد آزمایش، مقدار پنج میکرولیتر از عصاره هر نمونه با سه میلی­لیتر محلول برادفورد کاملا مخلوط شد و تغییرات جذب نور در طول موج  515max= λ توسط دستگاه اسپکتروفتومتر اندازه گیری شد. برای هر نمونه سه تکرار در نظر گرفته شد (12). استخراج پروتئین از بافت گیاهی بهروش ریونی و همکاران انجام شد (14).

 

ارزیابی میزان فعالیت آنزیم کاتالاز (روش گنگ و همکاران): فعالیت آنزیم کاتالاز بر اساس روش ارائه شده توسط گنگ و همکاران (13) اقتباس شده از دو و برام لاگ (15) بهشرح زیر ارزیابی شد.

مقداری از عصاره  که دارای 40 میکروگرم پروتئین بود (این مقدار با استفاده از منحنی استاندارد محاسبه شد)، با مقداری از بافر فسفات سدیم 50 میلی مولار با 7 pH=  به حجم دو میلی­لیتر رسانده و سپس در دستگاه اسپکتروفتومتر قرار داده شد و دستگاه با آن کالیبره شد. سپس بهمیزان 100 میکرولیتر ازH2O23 درصدبه مخلوط واکنش اضافه و میزان جذب نور بهمدت 2 دقیقه اندازهگیری شد. میزان فعالیت آنزیم بر اساس مقدار تجزیه شدن H2O2اندازه گیری شد. جذب محلول ها در 240 نانومتر نسبت به آب با استفاده از دستگاه اسپکتوفوتومتر قرائت شد.

فعالیت کاتالاز بر اساس میلی­مولار پراکسید هیدروژن در دقیقه در میلی گرم پروتئین (ΔOD /Min./mg protein) در چهار تکرار اندازه گیری شد.

 

ارزیابی میزان فعالیت آنزیم پراکسیداز (روش ریونی و همکاران): دو میلی­لیتر مخلوط واکنش شامل مقداری از عصاره که دارای 50 میلی­گرم پروتئین باشد (این مقدار با استفاده از منحنی استاندارد محاسبه شد)، 5 میلی­مولار گوئیکول و مقدار کافی بافر فسفات 25 میلیمول 7 pH= تا به حجم نهایی دو میلی لیتر برسد، در یک لوله آزمایش ریخته و دستگاه اسپکتروفتومتر با استفاده از این مخلوط در طول موج 470 نانومتر صفر شد. سپس 5 میکرولیتر پراکسید هیدروژن  (H2O2)30 درصد به این مخلوط اضافه شد و سریعا تغییرات جذب نور بهفواصل 10 ثانیه، بهمدت یک دقیقه اندازه گیری شد. مقدار فعالیت آنزیم بر حسب تغییرات جذب نور بر دقیقه بر میلی­گرم پروتئین بیان شد (ΔOD /Min./mg. protein) (14).

 

بررسی بیان ژنها: تیمارها مانند قسمت بررسی اثر عصاره ها در کنترل بیماری کپک آبی سیب در انبار 15 درجه سانتی­گراد) اعمال شدند. در این آزمون فقط از غلظت 1000×6 عصاره پوست گردو استفاده شد.

در این تحقیق میزان بیان ژن دو آنزیم پراکسیداز و کاتالاز و ژن خانه­دار فاکتور طویل ترجمه 1 آلفا(Eukaryotic translation elongation factor 1 alpha) استفاده شد (جدول 1).

 

 

 

جدول 1: توالی آغازگرهای مربوط به ژن­های منتخب، مورد استفاده برای آزمون Real-time RT-PCR

نام ژن

توالی

دمای ذوب

اندازۀ نوار

کاتالاز

5' TGGAGAGCATAAGTTAATAGA  3'-F

55

171

5' AGTCGTGATGATGACTCTACT 3' -R

56

پراکسیداز

5' AGCTCAGAGGCCTCATCGCTGA 3'-F

60

170

5' TACCGGCAGAGTGCCATGCG -R

61

گلوتاتیون S ترانسفراز

5' GGGATCTCAAAGGCAAAACA 3'-F

59

165

5' AAAAGGGCTTGCGGAGTAAT -R

58

 

 

 

استخراج RNA: استخراج RNA از بافت میوه که در قسمت شرایط رشد و نمونه­برداری آن­ها توضیح داده شد، انجام گرفت. در این آزمون فقط از غلظت 1000×6 عصاره پوست سبز گردو استفاده شد. این غلظت در آزمون­های آزمایشگاهی و آزمون انبار بهترین نتایج را در برداشت. نمونه­های بافتی از فریزر70- سانتی­گراد خارج شدند و بلافاصله در داخل ظرف حاوی نیتروژن مایع قرار گرفتند و سپس در داخل هاون و نیتروژن مایع بهخوبی کوبیده شدند. استخراج RNA کل توسط کیت (RNXplus سیناژن، ایران) مطابق دستورالعمل شرکت سازنده انجام شد و RNA های استخراج شده در دمای20- سانتی­گرادنگهداری شدند.

برای ساخت cDNA از RNA استخراج شده از آنزیم رونویسی معکوس استفاده می­شود. برای این منظور با استفاده از کیت RevertAid Reverse Transcriptase  شرکت Thermo Scientific استفاده و با استفاده از دستورالعمل شرکت اقدام به ساخت cDNA می­شود.

 

 

بررسی الگوی بیان ژن های منتخب با روش Real time PCR: الگوی بیان دو ژن شامل ژن­های پراکسیداز و کاتالاز با استفاده از روش Real time -PCRبررسی شدند. ژن  TeF1α بهعنوان ژن خانه دار (House keeping gene) انتخاب شد. از RNA کل استخراج شد و بهعنوان الگو برای ساخت cDNA استفاده شد. پس از یکسان­سازی غلظت RNA های مختلف، واکنش ساخت cDNAبر طبق دستورالعمل کیتYTA SYBR Green qPCR Master Mix (2x) (یکتاتجهیزآزما، ایران) انجام گرفت. الگوی بیان ژن­ها با استفاده از دستگاه ترموسایکلر زمان واقعی(Corbett RG-6000)بررسی شد. برای تعیین میزان تغییرات بیان ژن­ها در طی نقاط زمانی از روش Livak  استفاده شد. در این روش فرض بر این است که بازده نمونه و کنترل داخلی برابر و 100 درصد است و از فرمول-∆∆CT2بهمنظور بررسی تغییر بیان ژن استفاده شد (16).

میزان بیان ژن­های دفاعی منتخب بر اساس (ژن TEF-1α ژن خانه دار) با بیان ثابت نرمال شده، سپس میزان تغییرات بیان ژن در همه تیمارها نسبت به شاهد سنجیده شد.

 

 

 

 

 

آنالیز آماری

نتایج بهدست آمده از Real time RT -PCR با استفاده از آزمون چند دامنه دانکن در سطح خطای 05/0و با استفاده از نرمافزار SAS  انجام گرفت.

 

نتایج

تاثیر عصاره­های گیاهی بر رشد قارچ بیمارگر با استفاده از روش اختلاط با محیط کشت

نتایج جدول2تجزیه واریانس را نشان می­دهد که به احتمال 99 درصد بین دو حلال مورد استفاده و غلظتهای مختلف آن­ها و همچنین بین اثرات متقابل این دو بر کاهش میزان رشد هاله قارچ، به روش آزمون اختلاط با محیط کشت اختلاف معنی­دار وجود دارد. در این آزمون، عصاره متانولی پوست گردو با غلظت­های  1500 و 2000 پی­پی­ام و با 41/86 و 65/81 درصد و عصاره آبی پوست گردو با غلظت 2000 پی­پی­ام و 84/72 درصد، ممانعت از قارچ بیمارگر نسبت به شاهد به ترتیب بهترین غلظت­ها بودند. کمترین درصد ممانعت از رشد قارچ بیمارگر نسبت به شاهد، مربوط به غلطت 500 پی­پی­ام عصارۀ آبی بود که میزان 12/44 درصد ممانعت از رشد نسبت به شاهد بود. د (نمودار 1).

 

 

جدول 2: تجزیه واریانس مربوط به آزمون تأثیر عصاره­های آبی و متانولی پوست گردو بر میزان رشد قارچ بیمارگر P.expansum به روش استفاده از اختلاط با محیط کشت

منبع تغییرات (S.O.V)

درجه آزادی (df)

میانگین مربعات

F

آبی

متانولی

 

نوع عصاره (فاکتور A)

1

10/167

**20/190

 

غلظت (فاکتورB)

3

79/480

**71/497

 

نوع عصاره× غلظت(فاکتور×AفاکتورB)

3

12/25

**26/56

 

   

 

خطای آزمایش

16

41/0

 

 

کل

23

 

 

             

** به احتمال 99/99 درصد (p≤0.01) اختلاف معنیدار است.22/5 درصدC.V=، داده­ها نرمال بودند.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار 1: تاثیر عصاره­های آبی و متانولی پوست گرو بر میزان ممانعت از رشد میسلیومی قارچ بیمارگر P. expansum به صورت درصد بازدارندگی در مقایسه با شاهد به روش اختلاط با محیط کشت. اعداد میانگین چهار تکرار است. عصاره­های مختلف در غلطت­های 0، 500، 1000 و 1500 و 2000 میلی­گرم در میلی­لیتر استفاده شدند.

 

 

 

بررسی اثر عصاره پوست گردو در کنترل بیماری کپک آبی سیب در انبار

نتایج جدول 3تجزیه واریانسنشان می­دهد که به احتمال 99 درصد بین دو حلال آبی و متانولی مورد بررسی و غلظت­های مختلف آن­ها و همچنین بین اثرات متقابل این دو بر میزان بیماری و کاهش درصد سطح لکه ایجاد شده بر روی سیب نسبت به شاهداختلاف معنی­دار وجود دارد. در این آزمون، سطح لکه ایجاد شده در تیمار عصاره متانولی پوست گردو با غلظت­ شش در 1000 به میزان 50/94 درصد در مقایسه با شاهد کاهش نشان دادند، بهعبارت دیگر این غلظت از عصاره متانولی پوست گردو بیشترین کنترل کنندگی را در انبار از خود نشان دادند. کمترین درصد کنترل­کنندگی سطح لکه نسبت به شاهد مربوط به تیمار 1000×5/1 عصاره آبی پوست گردو

بهمیزان 68/59 درصد مربع در انبار بود. بیشترین میزان کنترل کنندگی سطح لکه سیب در بین غلظت­های مختلف عصاره آبی پوست گردو از آن غلظت 1000×6 با میزان عددی 69/81 درصد نسبت به شاهد بود که این مقدار نیز از غلظت 5/4 در هزار عصاره متانولی پوست گردو کمتر بود (نمودار 2).

 

 

 

 

جدول 3: تجزیه واریانس مربوط به آزمون تاثیر عصاره­های آبی و متانولی پوست گردو بر میزان بیماری­زایی قارچ بیمارگر P. expansum در انبار با دمای 4 درجه سانتیگراد

منبع تغییرات (S.O.V)

درجه آزادی (df)

میانگین مربعات

F

آبی

الکلی

 

نوع عصاره (فاکتور A)

1

10/167

**20/190

 

غلظت (فاکتورB)

3

79/480

**71/497

 

نوع عصاره× غلظت(فاکتور×AفاکتورB)

3

12/25

**26/56

 

   

 

خطای آزمایش

16

41/0

 

 

کل

23

 

 

             

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار 2: تاثیر عصاره­های آبی و متانولی پوست گردو بر کاهش میزان خسارت قارچ بیمارگر P.expansum به صورت کاهش میزان مساحت ناحیه آلودگی در انبار (سانتی­متر مربع) ؛ اعداد میانگین چهار تکرار است. عصاره­های مختلف در غلطت­های  1000×5/1، 1000×3، 1000×5/4 و 1000×5  آب مقطر استفاده شدند.

 

 

بررسی فعالیت آنزیم­های پراکسیداز و کاتالاز در سیب­های تیمار شده در دمای 15 درجه سانتی­گراد

با توجه به جدول 4تجزیه واریانسمربوط به اثر غلظتهای مختلف عصاره پوست گردو بر روی فعالیت آنزیم­های پراکسیداز و کاتالاز طی روزهای مختلف نمونهبرداری نشان داد که بین پنج نقطه زمانی نمونهبرداری (فاکتورA)، سطوح مختلف غلظت­های عصاره پوست گردو (فاکتورB)و اثرات متقابل زمان­های مختلف نمونه­برداری و غلظت­های مختلف عصاره پوست گردو (فاکتور×AفاکتورB) در مورد هر دو آنزیمپراکسیداز وکاتالازتفاوت معنی­دار وجود دارد. مقایسه میانگین تیمارها بهصورت زیر است:

بر اساس اطلاعات نمودار 3 بیشترین فعالیت آنزیم پراکسیداز مربوط به تیمار سیب آلودۀ تیمار شده با غلظت 6 در هزار عصاره گیاه پوست گردو بوده که در نهمین روز بعد از آلوده­سازی با بیمارگر این میزان فعالیت با میزان عددی 70/2 مشاهده شد، روند فعالیت این آنزیم تا روز نهم افزایشی و سپس کاهشی بود به این صورت که در روز پانزدهم بعد از آلوده سازی سیب ها با قارچ بیمارگر، میزان فعالیت این آنزیم در تیمار 6 در هزار عصاره به کمترین میزان خود در بین روزهای نمونه برداری با میزان 90/1 رسید. تیمار غلظت 6 در هزار همراه در تمام روزهای نمونه برداری (بهجز روز پانزدهم بعد از نمونه برداری) نسبت به همه تیمارهای دیگر دارای اختلاف معنی­دار از  نظر سطح فعالیت آنزیم بود. در کلیه روزهای نمونه­برداری، فعالیت آنزیم در تیمار بیمارگر تنها بهصورت معنی­داری بیشتر از شاهد بود. بهغیر از روز دوازدهم در بقیه روزها میزان فعالیت آنزیم در تیمار بیمارگر تنها بیشتر از تیمار غلظت 5/1 در هزار عصاره پوست گردوبود و این اختلاف بهصورت معنی­دار بروز پیدا کرد این مطلب نشان­دهنده این موضوع است که تیمار 1000×5/1 قادر به افزایش فعالیت آنزیم ­پراکسیداز در مقایسه با بیمارگر تنها نیست (نمودار 4).

با توجه به نمودار 4 میزان فعالیت آنزیم کاتالاز روندی مشابه با فعالیت آنزیم پراکسیداز را طی نمود. بیشترین فعالیت آنزیم ­کاتالاز مربوط به تیمار سیب آلوده تیمار شده با غلظت 6 در هزار عصاره گیاه پوست گردو بوده که در نهمین روز بعد از آلوده­سازی با بیمارگر این میزان فعالیت با میزان عددی 56/4 مشاهده شد، روند فعالیت این آنزیم نیز افزایشی و کاهشی بود به این صورت که تا روز نهم میزان فعالیت آنزیم افزایش یافت و در روزهای دوازدهم و پانزدهم بعد از آلوده سازی سیب ها با قارچ بیمارگر، میزان فعالیت آنزیم ها در کلیه تیمارها کاهش پیدا کرد. تیمار غلظت 6 در هزار همواره در تمام روزهای نمونه برداری نسبت به همه تیمارهای دیگر دارای اختلاف معنی­دار از  نظر سطح فعالیت آنزیم بود. در کلیه روزهای نمونه­برداری، فعالیت آنزیم در تیمار بیمارگر تنها بهصورت معنی­داری بیشتر از شاهد بود. به غیر از روز نهم و دوازدهم اختلاف معنیداری بین غلظت 5/1 در هزار عصاره پوست گردو و تیمار بیمارگر تنها از نظر فعالیت آنزیم وجود نداشت،که نشان می­دهد تیمار 1000×5/1 قادر به افزایش فعالیت آنزیم کاتالاز در مقایسه با بیمارگر تنها به صورت معنی­دار نیست (نمودار 4).

 

 

 

جدول 4: تجزیه واریانس مربوط بهمیزان فعالیت آنزیم­های پراکسیداز و کاتالاز (تغییرات جذب در دقیقه در میلیگرم پروتئین) در میوه سیب، مایه کوبی شده با غلظتهای مختلف عصاره گیاه پوست گردو و قارچ عامل بیماری P.expansum

منبع تغییرات (S.O.V)

درجه آزادی (df)

کاتالاز

پراکسیداز

F

روزهای نمونه برداری (فاکتور A)

4

**76/326

**9/657

غلظت­های مختلف (فاکتور B)

5

**55/1977

**71/3118

غلظت­های مختلف × روز های نمونه برداری(فاکتورA×B)

20

**64/16

**65/24

خطای آزمایش

60

 

 

کل

89

 

           

** به احتمال 99/99 درصد (p≤0.01) اختلاف معنیدار است. 19/3  درصدC.V=، دادهها نرمال بودند.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار 3: مقایسه میانگین فعالیت آنزیم­های پراکسیداز (الف) و کاتالاز (ب) در تیمارهای مختلف (غلظت­های مختلف عصاره پوست گردو 1000×5/1، 1000×3، 1000×5/4 و 1000×6) ، در میوه سیب، اعداد (تغییرات جذب در دقیقه در میلیگرم پروتئین) میانگین چهار تکرار هستند، و حروف مختلف نشان دهنده سطوح مختلف معنی­داری هستند.

 

بررسی بیان ژن­ها در برهمکنش میوه های سیب با عصاره پوست گردو و بیمارگر P. expansum

الگوی بیانی دو ژن کاتالاز و پراکسیداز با استفاده از روش کمی PCR زمان واقعی بررسی شد. میزان بیان ژن­ها در این تحقیق با استفاده از  روش کمیت سنجی نسبی و با کمک پرایمرها انجام شد (جدول 1). در محاسبات، ژن خانه­دار (House keeping)، (Tef1α) Translation Elongation factor  بهعنوان مرجع در نظر گرفته شد. نتایج حاصل از بررسی بیان این دو ژن در نقاط زمانی مختلف نشان داد که این ژن­­ها در زمان­های مختلف و همچنین تحت تیمارهای مختلف تغییرات بیان نشان دادند.  

برای تعیین میزان تغییرات بیان ژن­ها در طی نقاط زمانی از روش Livak استفاده شد. در این روش فرض بر این است که بازده نمونه و کنترل داخلی برابر و 100 درصد است و از فرمول  CT∆∆-2 بهمنظور بررسی تغییر بیان ژن استفاده شد (16).

میزان بیان دو ژن بهصورت مقایسه سه تیمار عصاره تنها، بیمارگر تنها و ترکیب قارچ بیمارگر با عصاره گیاهی با با تیمار سیب­های سالم تلقیح شده با آب مقطر بهتنهایی بیان شدند. به بیان دیگر میزان بیان ژن در این سه تیمار مذکور با سیب­های سالم به تنهایی مقایسه شد. خلاصه داده­ها (میانگین مربعات) مربوط به تجزیه واریانس میزان بیان ژن­ها در جدول 5 نشان داده شده است. پس از تجزیه واریانس برای هر ژن، میانگین مربوط بههر ژن با استفاده از روش دانکن مورد مقایسه قرار گرفت. نتایج حاصل از مقایسه میانگین­ها بهصورت نمودار بیان شده است.

بر اساس نتایج بهدست آمده از آزمون ­ ارزیابی بیماری در تقابل با عصاره پوست گردو بر روی میوه سیب از غلظت 5/4 در هزار عصاره پوست گردو در این آزمون استفاده شد.

جدول 5: خلاصه تجزیه واریانس میزان تغییرات بیان ژن­های مورد بررسی درگیر در برهمکنش سیب، تحت تیمار های مختلف عصاره پوست گردو و بیمارگر P. expansum؛ میزان بیان ژن­ها از تقسیم عدد تیرگی لکه­ها مربوط به هر ژن بر عدد تیرگی ژن خانه­دار بهدست آمده است.

منبع تغییرات (S.O.V)

درجه آزادی (df)

کاتالاز

پراکسیداز

F

روزهای نمونه برداری (فاکتور A)

4

**10/532

**32/469

تیمارها (فاکتور B)

2

**18/2263

**18/2963

غلظت­های مختلف × روز های نمونه برداری(فاکتورA×B)

8

**32/17

**98/19

خطای آزمایش

30

 

 

کل

44

 

           

 

 

بر اساس نمودار 5- الف میزان بیان ژن رمز کننده آنزیم کاتالاز در طول پانزده روز نمونه برداری، تا روز نهم افزایش در همه تیمارها نشان داد. بهعبارت دیگر روند تغییرات این آنزیم بهصورت افزایشی و کاهشی بود. بیشترین میزان بیان ژن آنزیم در تمام روزهای نمونهبرداری مربوط به تیمار ترکیب عصاره با بیمارگر بود و میزان این افزایش همواره در تمام روزهای نمونه برداری دارای اختلاف معنی­دار با بقیه تیمارها بود. میزان بیان این ژن در تیمار بیمارگر تنها نیز همواره بیشتر از تیمار عصاره تنها بود و این اختلاف نیز در تمام روزهای نمونه­برداری

 

معنی­دار بود. در مورد میزان بیان ژن این آنزیم­ها مشاهده می­شود که این آنزیم با بیمارگر بیشتر از عصاره گیاهی در میوه سیب القا شده است. بر اساس نمودار 5 – ب میزان بیان ژن رمز کننده آنزیم پراکسیداز روندی مانند میزان بیان ژن کاتالاز داشت که در این پژوهش مورد مطالعه قرار گرفته بود. بیشترین میزان بیان ژن پراکسیداز را تیمار کاربرد توام بیمارگر و عصاره پوست گردو نشان داد و این تیمار همواره با بقیه تیمارها فاصله معنی­داری داشت. بعد از این تیمار، تیمار کاربرد بیمارگر تنها قرار داشت و در رتبه سوم هم تیمار کاربرد عصاره تنها قرار

 

داشت. در مورد این آنزیم هم القا به­وسیله عصاره بهتنهایی صورت گرفت ولی مانند ژن­های بررسی شده قبلی باز این بیمارگر بود که در عمل القای ژن‫های دفاعی موفق­تر از عصاره عمل نمود. نتایج به‫دست آمده در این تحقیق نیز موید همین مطالب است.

 

 

 

 

 

 

نمودار 5: الگوی بیان ژن رمزکننده آنزیم ژن کاتالاز (الف) و پراکسیداز (ب) در میوه سیب تحت غلظت‫های متفاوت عصاره پوست گردو روزهای مختلف پس از مایه­زنی با بیمارگر. در حضور قارچ بیمارگر، در حضور عصاره گیاهی، و در حضور عصاره گیاهی و قارچ بیمارگر تواماا.

 

 

 

 

بحث

سموم شیمیایی خطرات انکارناپذیری را بر سلامت انسان و سایر موجودات زنده دارند. این ترکیبات به آسانی در محیط زیست تجزیه نمی­شوند، و برای مدت طولانی موجودات زنده ای که در معرض این ترکیبات قرار می­گیرند را تحت تاثیر خود قرار میدهند. محققان بهدلیل مخاطرات بالایی که این گونه ترکیبات دارند همواره بهدنبال ترکیبات کم خطری هستند که دارای دوام کمی نیز در محیط زیست باشند. خاصیت تجزیه­پذیری عصاره­های گیاهی در طبیعت و سمیت پایین آن­ها برای انسان و سایر موجودات زنده و همچنین نداشتن اثرات مخرب کمتر آن­ها بر محیط­زیست، این ترکیبات را بهعنوان ترکیبات جایگزین سموم شیمیایی مطرح کرده است. عصاره­های گیاهی با داشتن مواد و عناصر غذایی در افزایش رشد گیاه مفید بوده و برای انسان و محیط زیست بی­خطر هستند (17). با توجه به نتایج بهدست آمده از آزمون اختلاط عصاره­ها با محیط کشت مشخص شد که به طورکلی با افزایش غلظت عصارهها، میزان فعالیت ضدقارچی افزایش پیدا میکند. بیشترین میزان فعالیت قارچ­کشی در آزمون اختلاط با محیط کشت مربوط به غلظت 2000 پیپی­ام عصاره متانولی  است. هر چه بر میزان غلظت

عصاره پوست گردو افزوده می­شود، میزان فعالیت قارچکشی آن نیز افزوده می­­شد. در مورد عصاره­های آبی نیز بیشترین میزان فعالیت ضد قارچی مربوط به غلظت 2000پی­پی­ام بود، که این موضوع را می­توان با تغییر در نوع حلال مرتبط دانست. زمانیکه از عصاره متانولی استفاده می­شود احتمالا مواد ضدقارچی بیشتری از پوست گردو قابل استحصال خواهد بود، البته بهعلت خاصیت آبگیری که الکل دارد، خود الکل بهتنهایی نیز خاصیت ضدمیکروبی و قارچکشی دارد. کمترین میزان فعالیت ضد قارچی در مورد هر دو آزمون و همچنین هر دو نوع عصاره آبی و الکلی مربوط به غلظت 500 پی­پی­ام بود. در مطالعه ای که بهوسیله غلام­نژاد (18) با عنوان بررسی تاثیر عصاره­های گیاهی بر علیه قارچ بیماری کپک خاکستری سیب با عاملBotrytis cinereaانجام شد نتایج نشان داد که به طورکلی با افزایش غلظت عصاره­ها، میزان فعالیت ضدقارچی افزایش پیدا میکند. بیشترین میزان فعالیت قارچکشی مربوط به عصاره گیاه اسطوخودوس بود. عصاره این گیاه همراه با گیاه رازیانه و اکالیپتوس بیشترین اثر قارچکشی را  بر قارچ بیمارگر B. cinerea از خود نشان دادند و هر چه بر میزان غلظت این ترکیب افزوده می­شد، میزان فعالیت قارچکشی در هر دو آزمون در آزمایشگاه، یعنی استفاده از دیسک­های کاغذی و روش اختلاط عصاره با محیط کشت، افزوده می­­شد.

در مورد آزمون انباری هر دو نوع حلال تاثیر معنیداری در کاهش این بیماری در مقایسه با شاهد داشتند. عصاره متانولی در این آزمون نیز قادر به کنترل بیشتر بیماری نسبت به عصاره آبی بود،  که این مورد را میتوان هم به حلالیت بیشتر ترکیبات قارچکش در الکل مرتبط دانست و هم به خاصیت قارچ­کشی خود الکل به تنهایی. در مطالعه­ای تاثیر اسانس سه گیاه دارویی  ریحان، مرزه و آویشن شیرازی در مهار پوسیدگی بعد از برداشت سیب ناشی از قارچ P. expansum مورد بررسی قرار گرفت. در آزمایش اول با مخلوط کردن غلظت‌های مختلف اسانس با محیط کشتPDA ، تاثیر آنها بر رشد قارچ بررسی شد. در این آزمایش هر سه اسانس بیشترین و کمترین بازدارندگی از رشد را بهترتیب در غلظتهای 200 و 25 پی پی ام نشان داده و حداقل در غلظت 200 پی پی ام نسبت به نمونه شاهد دارای اختلاف معنی‌دار بودند. در آزمایش دوم تاثیر آغشته کردن سطح میوه سیب با اسانس ها بر کاهش بیماری بررسی شد. نتایج نشان داد که تمامی غلظت‌ها باعث جلوگیری ازگسترش آلودگی در مقایسه با شاهد شدند و اسانس ریحان با غلظت 200 پی پی ام و بهدنبال آن بقیه اسانس‌ها در همین غلظت، بیشترین نقش را داشتند. در نهایت تاثیر بخار حاصل از اسانس روی گسترش آلودگی در میوه سیب بررسی شد و نتایجی همانند روش آغشته سازی حاصل شد (19).

با توجه به مطالعات انجام شده قبلی (20، 21) و بررسی اجزا و ترکیبات شرکت کننده در عصاره­های گیاهی، نشان داده شد که فعالیت ضد قارچی عصارههای گیاهی به اجزای تشکیل دهنده آن­ها بستگی دارد، بهطوری­که یک ترکیب ممکن است به تنهایی یا بهصورت هم­افزایی با سایر ترکیبات فعالیت ضدقارچی عصاره را باعث شود تا در غلظت معینی تاثیر قابل قبولی داشته باشد و از طرفی دیگر نوع عصاره و غلطت­های مختلف آن در میزان بازدارندگی از رشد میسلیومی قارچ و خاصیت قارچکشی آن نقشی کلیدی دارد (22). در مطالعه فرزانه وهمکاران (20) با عنوان فعالیت ترکیبات شیمیایی ضد قارچی اسانس سه گونه از گیاه Artemisia بر روی عوامل بیماری زای خاکزاد نشان داد شد که گونههای A. aucheriوA. sieberiاثر قارچکشی قویتری دارند. در مطالعه­ای تاثیر فعالیت قارچ­کشی 12 عصاره گیاهی را در برابر قارچ­هایPenecillium digitatum ، P. italicum وB. cinerea  بررسی شد. میوه های پرتقال با اسپور P. digitatum مایه زنی و با محلول 0، 75، 150 و250 میلی­گرم در لیتر روغن آوبشن اسپری شدند. نتایج نشان داد هیچ تفاوت معنی­داری بین این تیمار و میوه­ها با قارچ­کش تیابندازول با غلظت 2000 میلیگرم بر لیترنداشت (23).

بر اساس نتایج مطالعه سجادی و همکاران (24) در عصاره کرفس کوهی(kelussiaodoratissima) ترکیباتی مانند تیمول، آنتولترانس، آنیسول نوننال و کارواکرول وجود دارد. کارواکرول موجب از بین رفتن غشا سلول میشود. بنابراین احتمالا اثر ضدمیکروبی این عصاره را میتوان به این خصوصیت نسبت داد. دامنه وسیعی از آنزیم­های آنتی­اکسیدانت در انواع ترکیبات سلولی مربوط به گیاهان مختلف شناسایی شده است (25). فعالیتهمزمان آنزیمهای کاتالاز (CAT آسکوربات پراکسیداز (APX) مونودهیدروآسکوربات ردوکتاز (MDHAR)، دهیدرو آسکوربات ردوکتاز (DHAR) و گلوتاتیونS  ترانسفراز (GR) بهعنوان قسمتی از سامانه آنتیاکسیدانتی میتواند سلول را در مقابل گونههای فعال اکسیژن (ROS)حفاظت کند. (26). 

دو آنزیم کاتالاز و پراکسیداز از مهم­ترین آنتی­ اکسیدانت­ها هستند که باعث شکسته شدن پراکسید هیدروژن (H2O2) به آب و مولکول اکسیژن میشوند (27). در کلروپلاست آسکوربات پراکسیداز H2O2 تولید شده را از طریق چرخه آسکوربات  گلوتاتیون سم­زدایی می کند. در حقیقت APX با قدرت چسبندگی زیادی که با H2O2 دارد می­تواند در رفع مسمومی به گیاه کمک کند (28). با توجه به پیشرفت­های گذشته متاسفانه هنوز سازوکارهای مولکولی و بیوشیمیایی درگیر در تحمل به شوری اغلب مورد شناسایی قرار نگرفته است. بنابراین نیاز به دستیابی اطلاعات کافی در زمینه اساس مولکولی و ژنتیکی مقاومت به تنش احساس می­شود. این اطلاعات استراتژی­های مناسبی را جهت دستکاری گیاهان و اصلاح آنها با استفاده از روش­های مولکولی و اصلاح نباتات سنتی ایجاد خواهد کرد (29).

از نتایج آزمایش مربوط به میزان فعالیت آنزیم کاتالاز در میوه سیب چنین استنباط می­شود که عصاره­های گیاهی  فعالیت آنزیم کاتالاز را در میوه سیب هم در حضور و هم در عدم حضور بیمارگر افزایش می­دهد. حضور قارچ بیمارگر در کنار عصاره­های گیاهی باعث افزایش بیشتر فعالیت آنزیم در مقایسه با کاربرد عصاره گیاهی بهتنهایی است. بهعبارت دیگر، قارچ بیمارگر باعث افزایش فعالیت آنزیم در سیب میشود و میزان این افزایش فعالیت آنزیم در مقایسه با عصاره تنها بیشتر است. نتایج این آزمایش نشان داد که تیمار میوههای سیب با عصاره پوست گردو بر متابولیسم H2O2 تاثیر گذاشت و مقاومت را در گیاه میوه سیب القا کرد(30). مخصوصا در شروع پیری فعالیت آنزیمهای آنتی اکسیدانت مانند کاتالاز کاهش می­یابد و سوپراکسید یا پراکسید هیدروژن تا سطح سمیت افزایش مییابند (31). کاتالاز همچنین الکترون­هایی که می­توانند منجر به تولید رادیکال آزاد سوپر اکسید آنیون شوند را از بین می­برد (32). در پژوهشی، تاثیر اسانس­های گیاهان آویشن باغی، مورد و مرزه خوزستانی بر میزان فعالیت آنزیم پراکسیداز در عصاره برخی میوهها مورد مطالعه قرار گرفت. عصاره میوههای موز، شلیل، گلابی، انگور، آلو، هلو، سیب لبنانی زرد و سیب لبنانی قرمز بهعنوان منبع آنزیم پراکسیداز بهکار برده شدند. نتایج نشان داد که اختلاف معنیداری در فعالیت آنزیم پراکسیداز در میوههای مورد مطالعه در هر دو مرحله وجود دارد. در پژوهش حاضر، به­طور کلی غلظت­های بالاتر اسانس مرزه خوزستانی نسبت به اسانس آویشن باغی و مورد، فعالیت ضد اکسایشی بالاتری را در مراحل قبل و بعد از عصاره­گیری نشان داد که احتمالا بهدلیل وجود کارواکرول بهعنوان مهم ترین ترکیب فعال بیولوژیکی موجود در اسانس مرزه خوزستانی است که دارای فعالیت آنتی اکسیدانتی قابل توجهی است (33). در پژوهشی القا مقاومت به باکتری سوختگی برنج پس از تیمار این گیاه با عصارههای مختلف گیاهی، از طریق اندازهگیری فعالیت های پلی فنل اکسیداز، پراکسیداز، β-1،3-گلوکاناز و پروتئین مرتبط با پاتوژن (PR) مورد بررسی قرار گرفت. عصارههای چهار گیاه Azardirachta indica، Ages mermelos، Cassiaauriculata و Vitex negundo علیه این باکتری در این بررسی استفاده شدند. بیماری سوختگی باکتریایی زمانی که در معرض عصاره گیاه قرار می گیرد، در مقایسه با عصاره گیاهان دیگر بیشترکنترل می­شود. عصارهها آنزیمهای مربوط به دفاع مانند PPO، PO و β-1،3-گلوکاناز را در قبل و بعد از تلقیح با Xanthomonas oryzae القا کردند. عصارهها باعث القای آنزیمهای مرتبط با سیستم دفاعی گیاه، مانند پلی­فنل­اکسیداز، پراکسیداز و بتا 1 و 3 گلوکاناز در هر دو حالت قبل و بعد از مایه زنی با باکتری می­شوند. بالا رفتن سطوح فعالیت آنزیم­ها و پروتئین­های وابسته به مرحله دوم اهمیت بستگی دارد. در این مطالعه عصاره آبی ومتانولی گیاه V.  negundo بهترتیب 76 درصد و 73 درصد بیماری را کنترل کرد. به عبارت دیگر عصاره این گیاه هم تحت شرایط آزمایشگاهی و هم شرایط محیطی قادر به کنترل این بیماری می­باشد (34).

تولید گیاهان مقاوم بـه عوامـل بیمـاریزای گیاهی، از طریق انتقال ژنهـای رمزکننـده مواد ضد میکروبـی، روشی نویدبخش برای مبارزه بـا بیمـاری هـای گیـاهی اسـت (35). با تولید گیاهان تراریخته که میزان بیان ژنهای کاتالاز، پراکسیداز، کیتیناز وگلوکاناز می­توان ارقام مقاومی تولید کرد که نسبت به بیماری­های گیاهی مقاوم هستند (36). بیان همزمان دو یا چند ژن PR پروتئین اثر سینرژیستی بر روی یکدیگر داشته و باعث افزایش مقاومت گیاه و در نتیجه کنترل بهتر بیماری می­شوند (37). پیش نیاز تولید ارقام مقاوم شناسایی مکانیسم­های گیاهی درگیر در واکنش به عوامل بیماری­زا می باشد که منجر به ظهور مقاومت در ارقام مقاوم و حساسیت در ارقام حساس می­شود. تحقیقات دیگر محققین نیز بر القاء سیستم دفاعی بهوسیله عصاره گیاهی و افزایش فعالیت آنزیمهای دفاعی از جمله پراکسیداز اشاره می کند (38).

 

یک سری از پروتئینها و پپتیدها در گیاه بعد از تماس با بیمارگر بیان می­شوند که تعداد بیشتری از این ترکیبات مستقیما خاصیت ضد میکروبی دارند. چنین پروتئین­هایی با اثر بر روی غشای سلولی بیمارگرها، حفاظت بر علیه باکتریها، قارچ­ها و ویروس­ها را فراهم می­کنند (39). این پروتئین­ها هم بهصورت سیستمیک و هم بهصورت موضعی در طی حمله عوامل بیماریزا در غلظت­های بالاتری تولید می­شوند و نقش مهمی در حفاظت گیاه بر عهده دارند (40). چنین پروتئین­های مرتبط با بیماریزایی، پروتئین­های PR خوانده می­شوند که شامل گروه مختلفی از پروتئینهای گیاهی­اند. وجود پروتئین­های مرتبط با بیماریزایی با مقاومت القایی ارتباط دارد (41). در حال حاضر راه­کار بیان­پروتئین­های ضد قارچی، مانند پروتئین شبه توماتین از طریق مهندسی ژنتیک که باعث اختلال در غشای سلولی بیمارگر می­شود و همچنین پروتئین­هایی که اثر سمی مستقیم روی عوامل بیماریزا یا کاهش رشد آنها دارند روز به روز در حال افزایش است (43،42).

عصارۀ آبی گیاهی از تیرۀ نعناعیان (Ocimum gratissimum)، در غلظت­های 10، 25، 40 و 50 درصد باعث القای تولید فیتوآلکسین در کوتیلدونهای سویا و مزوکوتیل­های سورگوم می­­شود. عصاره آبی همچنین باعث القای سیستمیک مقاومت در گیاه خیار نسبت به قارچ Colletotrichum lagenarium میشود، که این القا با کاهش ظهور بیماری و افزایش تولید کیتیناز همراه خواهد بود.

آنالیز و مقایسۀ الگوی بیان ژن­های پاسخ دهنده به عصاره گیاهی مانند پوست گردو بهعنوان ماده القاگر احتمالی سیستم دفاعی و تنش قارچ بیمارگر P. expansum هم در سطح (نسخه­برداری) ترانسکریپتئومیکس و هم در سطح پروتئومیکس میتواند اطلاعات با ارزشی برای اصلاح گیاهان زراعی و باغی در اختیار اصلاح­گران قرار بدهد. هدف از انجام این تحقیق بررسی تغییرات بیان ژن­های درگیر در فرایند دفاعی در میوه سیب در برهمکنش با بیمارگر و عصاره پوست گردو است تا در مطالعات آینده با بررسی بیان ژن­های القاشونده با تنش این بیمارگر و نیز عصاره گیاهی پایه­های فیزیولوژیکی واکنش به این تنش بیشتر مورد شناسایی و ارزیابی قرار گیرد (44).

با توجه به بالا رفتن بسیار زیاد بیان این ژن در میوهسیب بعد از اعمال تیمارهای موردنظر، این نکته تاکید می­شود که اولا باید میزان اکسیژن­های فعال در گیاه باید افزایش یابد تا میزان کاتالاز و پراکسیداز هم بالا رود و ثانیا میزان القا بسیار زیاد این ژنها نشان دهنده نقش موثر آن در مکانیسم­های دفاعی بر علیه بیمارگرهاست.

 

نتیجه گیری

پدیده القای مقاومت در گیاهان با افزایش فعالیت آنزیمهای دفاعی گیاهی همراه خواهد بود که نمود بیرونی این برهمکنش کاهش شدت بیماری در گیاه می­باشد. افزایش فعالیت پروتئینهای دفاعی به افزایش بیان ژن های متناظر این پروتئین­ها صورت می­گیرد. بهعبارت دیگر ژن های درگیر در واکنشهای دفاعی بهوسیله ترکیبات القاکننده، افزایش بیان پیدا می­کنند. محققان معتقدند هدف نهایی از کاربرد القاکنندههای سیستم دفاعی گیاهمهار کامل بیماری نیست وتنها کاهش خسارت ناشی از بیماریهای گیاهی با حداقل خسارت به منابع زیستی مورد نظر است. از اینرومیتوان ادعا نمود که القای مقاومت در گیاه یک فرایند امیدوارکننده در علم مدیریت بیماریهای گیاهی می­باشد، به بیان دیگر القای مکانیسم های دفاعی در گیاهان، از طریق القاکنندهها، یک استراتژی جدید برای حفاظت از گیاه در برابر تنش­های زیستی و غیرزیستی می­باشد. کاربرد عصارههای گیاهی بهعنوان القاکننده و یا قارچکش هنوز در مراحل ابتدایی پیشرفت خود میباشد، و باید تلاش محققان به سمت تجاری سازی و رساندن آن به‫دست زارعین به جای سموم شیمیایی باشد.

1.Janisiewicz, WJ, Korestent L. Biological control of postharvest disease of fruits. Annu. Rev. Phytophatol. 2002: 40(1): 411-441.

2. Gholamnejad J, Etebarian HR, Sahebani NA, and Roustaee A. Characterization of biocontrol activity of two yeast strains from Iran against blue mould of apple in order to reduce the environmental pollution. . Journal of International Environmental Application and Science. 2009; 4(1): 28-36.

3. Gholamnejad J, Etebarian HR, Sahebani N. Biological control of apple blue mold with Candida membranifaciens and Rhodotorula mucilaginosa. African Journal of Food Science, 2010; 4: 001-007.

4. Gholamnezhad J, Sanjarian F, Mohammadi goltapeh E, Safaei N,Razavi Kh. Effect of salicylic acid on enzyme activity in wheat in immediate early time after infection with Mycosphaerella graminicola. Scientia agriculturae bohemica, 2016; 47(1): 1-8.

5. Gholamnezhad J, Sanjarian F, Mohammadi Goltapeh E, Safaei N, et al. The evaluation of salicylic acid effect on septorios disease by Mycospharella graminicola. Researches plant pathology. 2012; 2(2): 35-46. (in Persian).

6. Bakkali F, Averbeck S, Averbeck D, Idaomar M. Biological effects of essential oilsA review. Food Chemistry Toxicology. 2008; 46(2): 446–475.

7. Daayf F, Platt  HW, Mahuku G, Peters RD. Relationships between RAPDs, Gpiallozyme patterns, mating types, and resistance to metalaxyl of Phytophthora infestans in Canada in 1997. Am. J. PotatoRes. 1997; 78: 129–13.

 

8. Gholamnezhad J. 2018. Effect of plant extracts on activity of some defense enzymes of apple fruit in interaction with Botrytis cinerea. Journal of Integrative Agriculture.2018. 17(0): 1-10.

 

9. Abdulaziz A, Al-Askar Y, Rashad M. Efficacy of some plant extracts against Rhizoctonia solani on Pea. Journal of Plant Protection Research. 2010; 50(3): 239-243.

10. Bahraminejad S, Asenstorfer RE, Riley IT.  Schultz CJ.  Analysis of the antimicrobial activity of flavonoids and saponins isolated from the shoots oats (Avena sativa L.). Journal of Phytopathology. 2008; 156: 1 - 7.

11. Azimi AA, Delnavaz HB, Mansour GA. Antifungal effect of aqueous alcoholic and phenolic extracts of seed and leaves of Sorghum bicoloragainst Fusarium solani, Fusarium poa in Persian. Journal of Medicinal Plants. 2006; 6(1): 26- 32.

12. Bradford MM. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Analytical Biochemistry. 1976;72: 248-254.

13. Gong M, Li Y, Dai X, Tian M, et al. Involvment of calcium and calmodulin in the acquisition of  HS inuced thermotolerance in maize seeding, Journal of Plant Physiology. 1997;150: 615-621.

14. Reuveni, R. Biochemical marker of disease resistance. In: Singh, R. P., and Singh, U. S.(Ed.) Molecular Methods in Plant Pathology. 1995: (pp. 99-114).

15. Du Z, Bramlage WJ. Peroxidative activity of apples peel in relation to development of poststorage disorders. HortScience. 1995; 30: 205-208.

16. Livak KL, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 ∆∆-CT T.   METHODS. 2001; 25(4): 402–408.

 

 

 

17. Wilkins KA, Bancroft J, Bosch M, Ings J, et al. Reactive oxygen species and nitric oxide mediate actin reorganization and programmed cell death in the self incompatibilityresponse of  Papaver.  Plant Physiology. 2011; 156(1): 404–416. 

18. Gholamnezhad J. Effect of plant extracts against apple gray mold caused by Botrytis cinerea. Applied Microbiology in Food Industry. 2017; 3(4): 41-54.

19. Gholamnejad  J, Etebarian HR,  Roustaee, A. Sahebani  N.  Biological  control  of  apple  blue mold  by   isolates of Saccharomyces  cerevisiae.  Journal  of  Plant Protection  research, 2009;  49:270-275.

20. Carson CF, Hammer KA, Riley TV. Melaleuca alternifolia (Tea Tree) Oil: a Review of Antimicrobial and Other Medicinal Properties, Clinical Microbiology Reviews. 2006; 19(1): 150-62.

21. Farzaneh M, Ahmadzadeh M, Hadian J, Tehrani AS. 2010. Chemical composition and antifungal activity of the essential oils of three species of Artemisia on some soilborne phytopathogens. Communication of Agriculture Appllied Biology Science. 2010:; 71(3b): 1327-1333.

22. Chaieb K, Hajlaoui H, Zmantar T, Kahla-Nakbi AB, et al. The chemical composition and biological activity of clove essential oil Eugenia caryophyllata (Syzigium aromaticum L. Myrtaceae): a short review. Phytotherapy Research. 2012; 21(6): 501-506.

23. Arras G, Vsai M. Fungitoxic activity of 12 essential oils against four postharvest citrus pathogens: chemical analysis of thymus capitates oil and its effectin subatomospheric pressure condition. Journal of Food Protection. 2001;  64(7):1025-1029.

24. Sajjadi SE, Shokoohinia Y, Moayedi N. Isolation and identification of ferulic acid from aerial parts of kelussia odoratissima Mozaff. Jundishapur Journal of Natural Pharmaceutical Products. 2012; 7(4): 159-62.

25. Gill SS, Tuteja N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010; 48(12): 909–930.

26. Mirzaee M, Moieni A, Ghanati F. Effects of drought stress on the lipid peroxidation and antioxidant enzyme activities in two Canola (Brassica napus L.) cultivars Tabacco. Agricultural Science Technology. 2013; 15(3): 593-602.

27. Yang T,PoovalahBW. Hydrogen Proxide homeostasis: Activation of plant catalase by calcium-calmodulin. PENAS. 2002; 99(6): 4097-4102.

28. Tewari RK, Hadacek F, Sassmann S, Lang I. Iron deprivation-induced reactive oxygen species generation leads to non-autolytic PCD in Brassica napus leaves. Environmental and Experimental Botany. 2013; 91(100):74–83.

29. Razavi, K, Mohsen-zadeh, S,  Malbiibi, MA. molecular aspects of osmotic stresses. International Symposium on prospect of saline agriculture in the GCC countries, 18-20th of March, Dobai.Sairam RK, Tyagi, A. 2004. Physiology and molecular biology of salinity stress tolerance in plants. Current Science. 2001; 86(3): pp. 407-421.

30. Kim YH, Khan AL, Waqas M, Shim JK, et al. Silicon application to rice root zone influenced the phytohormonal and antioxidant responses under salinity stress. Plant Growth Regul. 2014; 33: 137- 149.

31. Kiani SP, Maury P, Sarrafi A, Grieu P. QTL analysis of chlorophyll fluorescence parameters in sunflower (Helianthus annuus L.) under wellwatered and water-stressed conditions. Plant Sci. 2008; 175(4):565- 573.

32. Mittler R, Vanderauwera S, Gollery M, Van Breusegem F. Reactive oxygen gene network of plants. Trends Plant Sci. 2004: 9(10):490-498.

33. Ehteshamnia A, Rezaeinejhad AH, Musavizadeh SJ, Alikhani koopaei M. 2002. Investigation of Peroxidase Enzyme Activity in Some Fruits by Application of Thyme , Myrtle and Savoury Essential Oils. Plant production technology. 2002; 11(2): 33-42. 

34. Nisha S, RevathiK,Chandrasekaran R,  ArunachalamKirubakaran S,Michael S., Stout, M., Senthil-Nathan, S.Net al. Effect of plant compounds on induced activities of defense-related enzymes and pathogenesis related protein in bacterial blight disease susceptible rice plant. Physiological and Molecular Plant Pathology. 2012;80: 1-9.

35. Qin GZ, Tian SP, Chan, ZL, Li BQ. Crucial role of antioxidant proteins and hydrolytic enzymes in pathogenicity of Penicillium Expansum. Molecular and Cellular Proteomics. 2007; 6(3): 425–438.

36. Mackintosh CA, Lewis J, Radmer LE, Shin S, et al Overeexprssion of defense response genes in transgenic wheat enhances resistance to Fusarium Head Blight. Plant Cell Report. 2007; 26:479–488.

37. Zhu Z. Molecular basis for jasmonate and ethylene signal interactions in Arabidopsis.  Journal of Experimental Botany, 2014: 65(20): 5743-5748.

38. Tian SP, Qin GZ, Xu Y. Survival of antagonistic yeasts under field conditions and their biocontrol ability against postharvest diseases of sweet cherry. Postharvest Biology and Technology. 2004; 33: 327–331.

39. Butler JE, Hamilton WC, Sasser RG, Ruder CA, et al. Detection and partial characterization of two bovine pregnancy-specific proteins. Biol Reprod. 1982: 26(5):925–933.

41. Okushima Y, Koizumi N, Kusano T, Sano H. Secreted proteins of tobacco cultured BY2 cells:identification of a new member of pathogenesis-related proteins. Plant Mol. Biol. 2000: 42(3):479-488.

42.Gholamnezhad J, Sanjarian F, Mohammadi goltapeh E, Safaei N. Razavi Kh. Study of defense genes expression profile pattern of wheat in response to infection by Mycosphaerella graminicola, Iranian Journal of Plant Biology. 2016a; 8(30): 43-55.

43. Gholamnezhad, J.  Transcriptomics and useful techniques of defense gene expression evalution of plant. Appllied biology. 2016b; 6(24): 21-42.

44. Colpas T. Freitas Schwan-Estrada,K.R.,  Stangarlin, J.R., Ferrarese, M.R., Scapim, C.R. Induction of plant defense responses by Ocimum gratissimum L. (Lamiaceae) leaf extracts Flávia. 2009; 35(3): 191-195.