تاثیر کافئین در دوران بارداری بر هیستولوژی، مورفومتری، ‌فلورسنت بافتی و بیان ژن PAX6 در شبکیه چشم نوزاد موش بزرگ آزمایشگاهی

نوع مقاله: علمی - پژوهشی

نویسندگان

دانشگاه تهران، دانشکده دامپزشکی، گروه علوم پایه، تهران، ایران

چکیده

هدف: در تحقیق حاضر، تاثیر بافت شناسی تجویز کافئین در دوران بارداری بر روی شبکیه چشم و بیان­ژن PAX6 در نوزادان موش بزرگ­آزمایشگاهی مورد ارزیابی قرار گرفت.
مواد و روش­ها: تعداد 24 سر موش­بزرگ ­آزمایشگاهی باردار به سه گروه مساوی تقسیم شدند. گروه کنترل سرم ­فیزیولوژی و دو گروه دیگر کافئین را با دوزهای 50 و 100  میلی­گرم بر کیلوگرم به­صورت داخل­­صفاقی از روز نهم تا بیستم آبستنی دریافت نمودند. نوزادان متولد شده در روزهای اول و پنجم آسان­کشی و ناحیه سر آن‏ها جداسازی و داخل فیکساتیو ثابــت شد. همچنین نوزادان از نظر ناهنجاری­های ظاهری نیز بررسی شدند. ارزیابی­های هیستولوژی و مورفومتری شبکیه، تغییرات فلورسنت بافت چشم و بیان ژن PAX6 با روش رونویسی معکوس واکنش زنجیره­ای پلیمراز (Real-time PCR) بررسی شد.
 نتایج: نتایج نشان داد که دریافت کافئین مادری بر شبکیه چشم نوزادان متولد شده با تغییرات آتروفیک همراه بوده و موجب کاهش معنی­دار (05/0>p) در تراکم سلول‏های لایه گانگلیونی، ضخامت شبکیه و ضخامت لایه شبکه داخلی شد. همچنین کافئین باعث تغییرات رفتاری در مادران و فلوروسنت بافتی شده و باعث افزایش معنی­دار (05/0>p) الگوی بیان­ژن PAX6 در گروه­های دریافت­کننده کافئین شد.
 نتیجه­گیری: دریافت کافئین در دوره بارداری تغییرات مشخص هیستولوژی و مورفومتری را در ارگانوژنز و اختلال بیان PAX6  در تنظیم تکوین چشم را سبب می­‫شود.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

کافئین ((C8H10N4O2 یکی از انواع متیل­گزانتین‏ها می­باشد که اغلب از طریق چای، قهوه، نوشابه­ و­ شکلات وارد بدن می‏شود. این ماده به‏عنوان عمومی­ترین داروی سایکواکتیو جهان، محرک سیستم اعصاب مرکزی، عضلات قلب و سیستم تنفس است، کمی دیورتیک بوده و خستگی را به تعویق می‏اندازد (1). تحقیقات نشان داده که کافئین اغلب اثرات مهاری آدنوزین را تغییر داده و فعالیت نورونی را تحریک می‏کند و روی دستگاه اعصاب مرکزی (CNS) از طریق مهار فعالیت فسفودی استراز و مهار گیرنده‏های GABA و افزایش فعالیت کلسیم داخل سلولی عمل می‏کند (2, 3). کافئین به‫سرعت در دستگاه گوارش جذب شده و تبدیل به پاراگزانتین، تئوبرومین و تئوفیلین با ساختار مشابه با کافئین می‏شود (4). کافئین یک آنتاگونیست آدنوزینی مهم است که باعث تحریک CNS می‌شود و پس از مصرف به‏طور گسترده در تمام بدن منتشر شده و از تمام غشاهای بیولوژیک شامل سد خونی­مغزی و جفت به‫علت مشخصات لیپوفیلیکی‌ به‏راحتی عبور می‌کند (5, 6).

ماه‏های اول بارداری دوران حساس شکل­گیری جنین می‏باشند و با توجه به این که بعضی از مادران دراین ماه‏ها از بارداری خود خبر نداشته و یا ناآگاهانه و یا بنابه ضرورت درمان بیماری‏ها، از داروها و یا برخی از ترکیبات غذایی استفاده می‏کنند، این امر می‏تواند موجب تاثیر بر ارگانوژنز و تکامل طبیعی جنین گردد. سیستم بینایی به­دلیل این که دریافت­کننده تحریکات بیرونی است اهمیت ویژه‏ای در حفظ حیات اکثر موجودات زنده دارد و دارای ساختاری پیچیده متشکل از چندین قسمت متنوع با منشا جنینی متفاوت است (7). یکی از ساختارهای اصلی و بسیار مهم در این سیستم، شبکیه می باشد که نقش مهمی در ادراک بصری بازی می‏کند و شامل اجزای اولیه مسیرهای بینایی است (8). این ساختار از بخش خارجی لوله عصبی که به‏عنوان وزیکول بینایی نامیده می‏شود، منشا می‏گیرد (9) و از اپی‫تلیوم رنگدانه­دار خارجی و شبکیه عصبی داخلی تشکیل شده است. شبکیه عصبی لایه حساس به نور است و شامل چند نوع سلول بنام گیرنده­های نوری (سلول‏های استوانه­ای و مخروطی)، نورون‏های هدایتی (سلول‏های دو قطبی و سلول‏های گانگلیونی شبکیه)، نورون‏های داخلی(سلول‏های افقی و آماکرین) و سلول‏های حمایتی(سلول­های مولر و میکروگلیال) است (10)، این سلول‏ها در سه لایه که از نظر بافت‏شناسی از هم مجزا هستند، مرتب شده­اند. تکامل صحیح شبکیه، نقش بسیار مهمی در عملکرد سیستم بینایی دارد که به‏وسیله فاکتورهای رونویسی و بیان دقیق ژن‏های ویژه تنظیم می‫‫شود. ایجاد نقص یا تاخیر در تکامل هر کدام از این قسمت‏ها می‏تواند منجر به اختلال در عملکرد سیستم بینایی شود (11).

بیان و عملکرد ژن‏های متعددی در انواع مختلفی از سلول‏ها با مراحل رشد و تکوین چشم مرتبط دانسته شده است، مقایسه بیان ژن‏ها، عملکرد و تنظیم آن‏ها در رشد ساختار چشم در بین مهره داران مختلف، حفاظت شگفت انگیزی از مکانیسم‏های مولکولی مرتبط را نشان می‏دهد، در این میان مطالعه فاکتور رونویسی PAX6 به‫عنوان یکی از ژن‏های اساسی و دخیل، دانسته های ما را از تکوین بخش‏های گوناگون سیستم بینایی بالا می‏برد. PAX6 برای رشد و تکامل طبیعی بسیاری از ارگان­ها مانند چشم، مغز و پانکراس ضروری است (12). مطالعات نشان داده است PAX6 به‫عنوان یک تنظیم­کننده کلیدی تکوین چشم نه­تنها در شکل‏گیری ساختار چشم مهره‏داران ضروری ‏است، بلکه برای القای چشم خارجی در حشرات نیز مورد نیاز است (13).

گزارش شده است مصرف کافئین در دوران بارداری با افزایش خطر محدودیت رشد دوران جنینی و سقط خود به‫خودی همراه بوده است (14, 15). همچنین اثرات تراتوژنیک مختلف مصرف کافئین در دوران بارداری، از جمله شکاف کام، ناهنجاری‏های اندامی و به‏هم چسبیدن انگشتان (16)، ناهنجاری‏های سر و صورت، کاهش استئوسیت‏ها (17)، عقب ماندگی رشد و کاهش توانایی یادگیری (18) به اثبات رسیده است. علاوه بر این کافئین بر عملکرد تطبیقی چشم تاثیر گذاشته (19) و منجر به افزایش مقاومت عروق خونی و کاهش جریان خون در عصب بینایی انسان و کوروئید اطراف شبکیه چشم می‫شود (20).

با توجه به مصرف گسترده ترکیبات گزانتینی به‫عنوان عامل طعم­آور در انواع خوردنی­ها، آشامیدنی­ها و نیز کاربرد آن‏ها در مصارف دارویی، اثرات این ترکیبات بر سیستم‏های مختلف بدن مورد توجه محققین بوده است اما از آنجایی‫که تحقیقات چندانی در رابطه با اثرات کافئین بر سیستم بینایی به‫عمل نیامده، در این تحقیق اثرات جانبی و تراتوژنیک حاصل از کافئین بر سیستم بینایی موش‏های بزرگ آزمایشگاهی و نیز مورفولوژی جنین ارزیابی گردید.

 

مواد و روش‫ها

در این مطالعه تجربی تمامی آزمایشات و تجربیات صورت گرفته بر اساس دستورالعمل کمیته کار با حیوانات آزمایشگاهی دانشکده دامپزشکی دانشگاه تهران طراحی و به‏کار گرفته شد. موش‏های بزرگ آزمایشگاهی نر و ماده بالغ نژاد ویستار با میانگین وزنی20± 200 گرم از مرکز تکثیر حیوانات آزمایشگاهی دانشکده دامپزشکی دانشگاه تهران تهیه و در شرایط استاندارد با چرخه روشنایی (12 ساعت نور و 12 ساعت تاریکی)، دمای 1± 22 درجه سانتی‏گراد و رطوبت نسبی50 تا 60 درصد نگه‫داری شدند. حیوانات در شرایط آزمایشگاهی کنترل شده و قفس‏های پلی‏کربنات به مدت دو هفته سازگار شدند و به آن‫ها اجازه داده شد تا در طول مطالعه آزادانه از آب و پلت‏های غذایی استاندارد استفاده کنند، پس از سازگاری با شرایط محیط به‏منظور جفت‏گیری، دو سر موش ماده به‫همراه یک سر موش نر از همان گونه در یک قفس قرار داده شدند. رویت پلاک واژنینال و حضور اسپرم در اسمیر واژنی در صبح روز بعد، نشان دهنده وقوع جفت گیری و تایید بارداری به منزله روز نیم (GD 0.5) بود (21). موش‏های بزرگ آزمایشگاهی ماده باردار به‏طور اتفاقی به گروه‏های کنترل و تحت درمان (3 گروه مساوی و در هر گروه 8 سر موش) تقسیم شدند. در گروه کنترل به مقدار 3/0 میلی­لیتر سرم فیزیولوژی به‫روش داخل صفاقی روزانه تزریق شد و هر یک از گروه‏های آزمایشی کافئین (Sigma Aldrich) را در دوزهای 50 و 100 میلی‏گرم بر کیلوگرم وزن بدن به‏صورت روزانه دریافت کردند. تزریقات از روز نهم بارداری (GD 9) آغاز و تا روز بیستم بارداری (GD 20) ادامه داشت (22). به‏طور کلی زایمان موش‏های بزرگ آزمایشگاهی در روز 20 و 21 بارداری صورت گرفت. پودر کافئین از شرکت سیگما تهیه شد و از سرم فیزیولوژی (مطابق دستورالعمل) به‫عنوان حلال استفاده گردید.

 بلافاصله پس از زایمان، تعداد جنین‏ها، وزن بدن، طول سری- نشیمنگاهی، طول دم، فاصله گوش تا پوزه، عرض سر، وجود ناهنجاری ظاهری و جنین مرده در هرگروه محاسبه شد. تقریبا یک سوم رت های تازه متولد شده در هر زایمان ﺑﻪ‫ﺻﻮرت ﺗﺼﺎدﻓﯽ اﻧﺘﺨﺎب ﺷﺪه و پس از توزین توسط ترازوی دیجیتالی و اندازه‏گیری‏های مذکور، با دوز بالای ماده بیهوشی (کتامین+زایلازین) کشته شده و ناحیه سر آن‫ها جدا شد. سپس چشم‏ها برداشته و شماره‏گذاری شده و در فرمالدئید ده درصد تثبیت شد. بافت‏های ﻓﯿﮑﺲ ﺷﺪه در دﺳﺘﮕﺎه ﭘﺮدازش ﺑﺎﻓـﺖ ﻗـﺮار ﮔﺮﻓﺘـﻪ، پس از انجام مراحل آماده سازی و پاساژ بافتی، چشم‏ها درجهت عرضی در پارافین ﻣﺬاب قرار داده شده و قالب‏گیری شدند. از بافت‏های به‏دست آمده، برش­های سریال 5 میکرومتری تهیه شد و اسلاید‏ها به‏روش رنگ آمیزی هماتوکسیلین- ائوزین مورد رنگ آمیزی بافتی قرار گرفتند.

نوزادان باقی مانده از زایمان در هر گروه در کنار مادران بیولوژیک خود در قفس پرورش یافتند. این نوزادان در روز پنجم پس از تولد کشته شده و به‫روش مشابه، جهت

 

ارزیابی‫های ماکروسکوپی، بافت شناسی و مورفومتری مورد استفاده قرار گرفتند.

به‏منظور بررسی اثر کافئین بر مورفولوژی و وزن نوزادان در روزهای اول و پنجم پس از تولد، نمونه ها با استفاده از استریومیکروسکوپ از نظر ظاهری بررسی شدند. همچنین با کمک ترازوی دیجیتال با دقت یک هزارم، وزن جنین‏ها اندازه‏گیری شد. پارامترهای مورفومتری نیز مانند قد نوزادان براساس طول از فرق سر تا انتهای نشیمنگاه، فاصله گوش تا بینی، طول دم و عرض سر توسط کولیس دیجیتال با دﻗﺖ مورد اﻧﺪازه‫ﮔﯿﺮی قرار گرفت.

به‫منظور انجام مطالعات بافت شناسی و هیستومتری، پس از تثبیت چشم سمت راست، برش‏های مناسب و رنگ­آمیزی شده از بخش خلفی کره چشم با ضخامت 5 میکرون تهیه شد. هر برش شامل کل شبکیه چشم گسترده شده از اوراسراتا در نیمکره گیجگاهی تا اوراسراتا در نیمکره بویایی بود. برش‏ها به‏وسیله ی میکروسکوپ نوری متصل به رایانه مورد بررسی قرار گرفتند. به‏طور کلی در هر شبکیه سه مورد اندازه‏گیری­ زیر انجام شد. در ابتدا ضخامت کلی شبکیه برای هر چشم، به‫عنوان فاصله میان اپی‫تلیوم رنگدانه­دار تا غشا صورت پذیرفت. در ادامه تراکم سلولی خطی (تعداد سلول بر یک دهم میلی‏متر) در لایه سلول‏های گانگلیونی شبکیه، که با شمارش تعداد هسته سلول‏ها در عرض یک‏دهم میلی‏متر محاسبه شد و در‫ انتها ضخامت لایه شبکه داخلی که در واقع فاصله­ی بین لایه سلولی هسته­دار داخلی تا لایه سلول‏های گانگلیونی می‫باشد. اندازه‏ها توسط نرم افزار Dino Capture  برحسب میکرومتر در مقاطع عرضی شبکیه اندازه­گیری شده و میانگین آن‏ها برآورد شد (23). برای ارزیابی وضعیت هسته سلول‏های پیش­ساز عدسی از نظر تراکم از رنگ فلورسنت بافتی DAPI استفاده شد (24).

به‫منظور استخراج RNA سلولی جهت انجام Real Time PCR از کیت استخراج RNA (Vivantis,GF-TR-025) استفاده شد و طبق دستورالعمل آن عمل شد. برای تولید cDNA نیز از کیت (vivantis,2steps RT_PCR) استفاده گردید و مطابق پروتکل آن cDNA سنتز شده با دورg  200 ( rpm1200- 130) و به‫مدت 1 دقیقه سانتریفوژ شده و ذخیره شد. برای بررسی بیان ژن  PAX6از پرایمرهای جدول شماره 1 استفاده شد (25) و بیان ژن بتا اکتین به‫عنوان کنترل داخلی اندازه­گیری شد (جدول 1).

 

 

 

 

 

جدول شماره 1: مشخصات پرایمرهای استفاده شده برای Real-time PCR

توالی

نام الیگونوکلئوتید

نام ژن

5´-CTGGAGAAAGAGTTTGAGAGG  - 3´

Forward primer

PAX6-F

5´-CTGCTGCTGATAGGAATGTG - 3´

Reverse primer

PAX6-R

5´- GCACCACACTTTCTACAATGAG  - 3´

Forward primer

ACTINB

5´- GGCATACAGGGACAACACAG  - 3´

Reverse primer

ACTINB

 

 

 

 

 

 

 

 

 

 

جهت آنالیز آماری داده­های مربوط به بیان ژن PAX6 نرم افزارهای دستگاه Corbett، LinReg PCR استفاده شد.  Efficiencyداده­ها بررسی شدند و بیان ژن PAX6 مورد ارزیابی قرار گرفت.

 

آنالیز آماری

داده‏های به‏دست آمده از اندازه‏گیری شاخص‏های رشد و نیز داده‏های کمی به‏دست آمده با میکروسکوپ نوری با روش آماری آنالیز واریانس یک طرفه و تست تعقیبی توکی در نرم افزار SPSS نسخه 20 مورد بررسی قرار گرفتند. نتایج به صورت میانگین ± انحراف معیار ارائه گردید و تفاوت میانگین‏ها در سطح 05/0>p  معنی‏دار در نظر گرفته شد.

 

نتایج

بررسی‏هایماکروسکوپی

نتایج ماکروسکوپی تجویز کافئین آشکار ساخت که سمیت مادری، سقط و مرگ مادران باردار در هیچ گروهی مشاهده نشد. متوسط تعداد زایمان­ها در گروه کنترل و گروه­های آزمایش مشابه بود. مشاهدات ماکروسکوپی در نوزادان روز اول و پنجم حاکی از تشکیل کره کامل چشم و پلک‏های فوقانی و تحتانی در گروه کنترل و گروه‏های آزمایشی است و آنوفتالمی یا عدم تشکیل کره چشم در هیچ‏یک از گروه‏ها مشاهده نشد. همچنین مطالعات ریخت­شناسی و ماکروسکوپی نشان داد در گروه کنترل و گروه موش‏های باردار دریافت کننده دوز 50 میلی‏گرم کافئین، همگی نوزادان زنده به‫دنیا آمدند. در حالی‏که در گروه دریافت کننده 100 میلی‏گرم کافئین، دربین نوزادان تازه به‏دنیا آمده دو سر نوزاد مرده نیز در زایمان دو مادر باردار مشاهده شد، همچنین چند مورد چروکیدگی پوست و خونریزی موضعی در زیر پوست دیده شد. در هیچ‏کدام از گروه‏‏های آزمایشی و کنترل ناهنجاری‏های اعضایی مانند گوش، گردن و دم مشاهده نشد (شکل 1).

 

 

 

 

 

 

 

 

 

 

 

 

شکل 1:  یافته­های ماکروسکوپی. A) حضور نوزاد مرده (مشخص شده با پیکان قرمز) در بین نوزادان که در دو زایمان مشاهده شد و تشکیل چشم در نوزادان تازه به‫دنیا آمده (مشخص شده با پیکان آبی). B) نوزادان تازه به‫دنیا آمده از گروه دریافت کننده 100 میلی­گرم بر کیلوگرم کافئین که چروکیدگی پوست و خونریزی موضعی در برخی از آن‫ها دیده شد.

 

 

بررسی­های مورفومتری

بررسی‏های مورفومتری نشان داد که وزن نوزادان روز اول و پنجم از موش‏های باردار دریافت کننده کافئین به‫مقدار 50 و 100 میلی‏گرم بر کیلوگرم وزن بدن در مقایسه با گروه کنترل کاهش معنی‏دار داشت (05/0>p). در این مقایسه میانگین وزن نوزادان روز اول بین گروه‏های50 و 100 میلی‏گرم بر کیلوگرم به لحاظ آماری معنی‏دار نبود. همچنین تحلیل آماری داده‏های کمی حاصل از اندازه‏گیری طول فرق­سری-نشیمنگاهی نوزادان روز اول و پنجم حاصل از موش‏های باردار در دو گروه آزمایشی 50 و 100 میلی‏گرم بر کیلوگرم وزن بدن در مقایسه با گروه کنترل کاهش معنی­دار نشان داد (05/0>p). اندازه‏گیری‏های مربوط به عرض سر (فاصله بین دو گوش)، فاصله گوش تا بینی و طول دم نیز به‫شکل مشابه تفاوت معنی­داری در بین نوزادان گروه‏ کنترل با نوزادان روز اول و پنجم گروه­های آزمایشی نشان داد (05/0>p). اندازه عرض سر در بین نوزادان روز اول گروه 50 میلی‏گرم بر کیلوگرم با گروه کنترل به لحاظ آماری اختلاف معنی‫دار (05/0>p) نداشت (جدول 2).

 

 

جدول شماره 2: تاثیر دوزهای مختلف کافئین بر وزن، طول سری-نشیمنگاهی، عرض سر، فاصله گوش تا پوزه و طول دم در روزهای اول و پنجم پس از تولد.

پارامترها

گروه­ها

کنترل

50 میلی­گرم

100 میلی­گرم

وزن (گرم)

روز 1 تولد

a  64/0 ±03/8

b 81/0 ±29/6

b 81/0 ±76/5

روز 5 تولد

a  02/1 ±74/12

b 22/1 ±21/10

c 05/2 ±05/7

طول سری-نشیمنگاهی (سانتی­متر)

روز 1 تولد

a  08/0 ±80/4

b 15/0 ±10/4

c 08/0 ±80/3

روز 5 تولد

a  04/0 ±44/5

b 03/0 ±95/4

c 06/0 ±82/4

عرض سر

(سانتی­متر)

روز 1 تولد

a  03/0 ±23/1

a  01/0 ±20/1

c 02/0 ±03/1

روز 5 تولد

a  02/0 ±46/1

b 02/0 ±32/1

c 04/0 ±10/1

فاصله گوش تا بینی (سانتی­متر)

روز 1 تولد

a  05/0 ±10/2

b 02/0 ±91/1

c 03/0 ±75/1

روز 5 تولد

a  11/0 ±44/2

b 16/0 ±71/1

b 13/0 ±66/1

طول دم

(سانتی­متر)

روز 1 تولد

a  05/0 ±15/2

b 02/0 ±86/1

c 02/0 ±77/1

روز 5 تولد

a  01/0 ±90/2

b 02/0 ±69/2

c 02/0 ±21/2

 

سطح معنی­داری (05/0>p) می­باشد. حروف انگلیسی نامشابه در یک ردیف نشان­دهنده معنی­دار بودن است. نتایج به‫صورت Mean±SD بیان شده است.

 

 

بررسی­های میکروسکوپی هیستومتری و بافتشناسی

 در مطالعات میکروسکوپی ناحیه شبکیه چشم، اندازه کلی و ضخامت لایه‏های مختلف شبکیه و نیز تعداد سلول‏های لایه گانگلیونی مورد ارزیابی قرار گرفت (شکل 2).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل2: بررسی هیستومورفومتریک شبکیه چشم. A) تصویر برش عرضی شبکیه چشم. ساختار لایه­های مختلف شبکیه در گروه کنترل (از راست به چپ تصویر)،NFL : لایه فیبر عصبی، GCL: لایه سلولهای گانگلیونی،IPL : لایه شبکه داخلی، INL: لایه هسته داخلی، OPL: لایه شبکه خارجی،ONL : لایه هسته‏ای خارجی، IS: لایه داخلی فتورسپتور، OS: لایه خارجی فتورسپتور،PE : لایه اپیتلیوم رنگدانه دار. (رنگ آمیزی هماتوکسیلین – ائوزین، بزرگنمایی x400). B) تصویر برش عرضی شبکیه چشم a: ضخامت کلی شبکیهRT (retinal thickness) ، b: ضخامت لایه شبکه داخلی (IPL)، c: تراکم سلولهای لایه گانگلیونی در یک‏دهم میلی‏متر. (رنگ آمیزی هماتوکسیلین – ائوزین، بزرگنمایی x400).

 

 

 

یافته‏های هیستومورفومتری شبکیه در گروه‏های آزمایشی روز اول و پنجم تحت تیمار با کافئین50 و 100 میلی‏گرم بر کیلوگرم، تغییرات معنی­دار هیستوپاتولوژی در مقایسه با گروه کنترل نشان داد (05/0>p). تعداد سلول‏های گانگلیونی و ضخامت لایه شبکه داخلی در گروه‏های آزمایشی روز اول و پنجم تحت تیمار با کافئین50 و 100

 

 

 

میلی‏گرم بر کیلوگرم به شکل معنی‫داری نسبت به گروه کنترل کاهش داشت (05/0>p). یافته‏های کمی تاثیر کافئین نشان داد که میانگین ضخامت کل شبکیه (RT) در گروه‏های تحت تیمار با میزان 50 و 100 میلی‏گرم کافئین در نوزادان روز اول و پنجم به­صورت معنی­داری کمتر از گروه کنترل بود (05/0>p)، که بخش عمده این کاهش به دلیل کمتر شدن ضخامت لایه شبکه داخلی (IPL) است (نمودار 1).

 

 

 

 

 

 

 

 

 

 

 

 

نمودار 1: مقایسه میانگین ضخامت کلی شبکیه (RT) بر حسب میلی متر، مربوط به نوزادان روز اول (ستون­های آبی رنگ) و روز پنجم پس ازتولد (ستون‏های سبز رنگ) در گروه کنترل و گروه‏های آزمایشی 50 و 100 میلی­گرم بر کیلوگرم کافئین. سطح معنی­داری (05/0>p) می­باشد.حروف انگلیسی نامشابه در یک ردیف نشان­دهنده معنی­دار بودن است.نتایج به‫صورت Mean±SD بیان شده است.

 

 

میانگین اندازه‏ لایه شبکه داخلی نیز نشان داد که کاهش ضخامت این لایه در گروه‏های آزمایشی روز اول و پنجم

 

در گروه‏های دریافت کننده 50 و 100 میلی‏گرم کافئین نسبت به گروه کنترل معنی­دار بود (05/0>p) (نمودار 2).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار 2: مقایسه میانگین اندازه لایه شبکه داخلی (IPL) بر حسب میلی­متر، مربوط به نوزادان روز اول (ستون­های آبی رنگ) و روز پنجم پس ازتولد (ستون‏های سبز رنگ) در گروه کنترل و گروه‏های آزمایشی 50 و 100 میلی­گرم بر کیلوگرم کافئین. سطح معنی­داری (05/0>p) می­باشد.حروف انگلیسی نامشابه در یک ردیف نشان­دهنده معنی­دار بودن است.نتایج به صورت Mean±SD بیان شده است.

 

 

لازم به ذکر است که لایه شبکه داخلی (IPL) یک ساختار غیر سلولی دارد. در عین حال ما تعداد سلول‏های گانگلیونی را در لایه سلول­های گانگلیونی (GCL) شمارش شد، نتایج نشان داد تعداد سلول‏های گانگلیونی در گروه کنترل نسبت به گروه‏های آزمایشی روز اول و پنجم دریافت کننده 50 و 100 میلی‏گرم کافئین کاهش معنی­دارداشت (05/0>p) (نمودار 3).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار 2: مقایسه میانگین اندازه لایه شبکه داخلی (IPL) بر حسب میلی­متر، مربوط به نوزادان روز اول (ستون­های آبی رنگ) و روز پنجم پس ازتولد (ستون‏های سبز رنگ) در گروه کنترل و گروه‏های آزمایشی 50 و 100 میلی­گرم بر کیلوگرم کافئین. سطح معنی­داری (05/0>p) می­باشد. حروف انگلیسی نامشابه در یک ردیف نشان­دهنده معنی­دار بودن است. نتایج به صورت Mean±SD بیان شده است.

 

 

 

 

 

همچنین مشاهدات بافت شناسی مشخص نمود که لایه‫های مختلف تشکیل دهنده شبکیه در گروه‏های آزمایشی روز اول و پنجم و گروه کنترل به‫خوبی شکل گرفته بود با این‫حال لایه فیبر عصبی (NFL)  دستخوش تغییرات هیستولوژیکی شده و تغییراتی مانند کاهش و آتروفی لایه فیبر عصبی (NFL) در گروه‏های آزمایشی روز اول و پنجم دریافت کننده 50 و 100 میلی‏گرم کافئین مشاهده شد (شکل 3).

 

 

شکل 3:  تغییرات مشاهده شده در لایه فیبرهای عصبی در شبکیه چشم. ضخامت لایه فیبر عصبی در گروه کنترل (A) و گروه­های آزمایش تحت تیمار با دوز 50 (B) و 100 (C) میلی­گرم بر کیلوگرم کافئین. کاهش ضخامت و آتروفی لایه فیبر عصبی در تصاویر A و B مربوط به گروه­های 50 و 100 میلی­گرم بر کیلوگرم کافئین مشهود می­باشد (رنگ آمیزی هماتوکسیلین – ائوزین، بزرگنمایی x400).

 

 

بررسی تاثیر کافئین بر تغییرات رفتاری و شناختی

در مادران باردار دریافت کافئین در طی روزهای نهم تا بیستم بارداری با میزان 50 و 100 میلی­گرم بر کیلوگرم وزن بدن تغییراتی را در رفتار مادران نشان داد، نتایج مشاهدات حاکی از آن بود که با تزریق مقادیر مربوطه به موش‏های باردار، فعالیت حرکتی آن‏ها در پاسخ به تزریق افزایش می‏یافت. به‏طوری­که تا یک ساعت پس از تزریق، این تغییر رفتار در گروه دریافت کننده 100 میلی­گرم بر کیلوگرم وزن بدن کافئین قابل مشاهده بود. شایان ذکر است یک همبستگی مثبت بین میزان کافئین در دوره پره­ناتال و میزان این تغییرات رفتاری وجود داشت و این تغییرات در گروه دریافت کننده 50 میلی­گرم بر کیلوگرم وزن بدن کافئین، مدت زمان کمتری اتفاق می‏افتاد اما موش‏ها حالت تهاجمی بیشتری داشتند و در گروه دریافت کننده 100 میلی­گرم بر کیلوگرم وزن بدن کافئین با حرکات چرخشی رو به عقب و دور قفس همراه بود.

 

 

 

به‏علاوه با افزایش مدت زمان بارداری و سنگین‏تر شدن وزن مادران، تغییر الگوی رفتاری در گروه دریافت کننده 100 میلی­گرم بر کیلوگرم وزن بدن کافئین به‏صورت واضح‏تری آشکار گردید.

نتایج رنگ­آمیزی فلورسنت بافتی DAPI

یافته‏های به‏دست آمده از رنگ­آمیزی فلورسنت نیز تاییدی بر مشاهدات میکروسکوپی و رنگ­آمیزی هماتوکسیلین ائوزین بود، نتایج ما نشان داد که هسته سلول‏های پیش­ساز عدسی در گروه دریافت کننده 100 میلی­گرم بر کیلوگرم وزن بدن کافئین که به‏وسیله رنگ DAPI رنگ­آمیزی شده بود، با ­تاخیر از بین رفته و تراکم غیرطبیعی هسته سلول‏ها در بخش‏های مرکزی‏تر عدسی مشاهده شد که اشاره به مهاجرت و ناپدید شدن کندتر سلول‏های پیش­ساز نسبت به گروه کنترل دارد، همچنین حضور سلول­های اپی‫تلیالی در بخش قدامی و خلفی عدسی در گروه دریافت کننده 100 میلی­گرم بر کیلوگرم وزن بدن کافئین در مقایسه با گروه کنترل مشاهده شد (شکل 4).

 

 

 

 

 

 

 

 

 

 

 

 

شکل 4: رنگ‏آمیزی فلورسنت بافتی DAPI در مقطع عرضی چشم نوزاد یک روزه موش صحرایی.

A) تصویر مربوط به گروه کنترل، هسته سلول‏های اپیتلیالی در بخش قدامی ساختار عدسی دیده می‏شود (پیکان های قرمز رنگ). L: عدسی، C: قرنیه

B) تصویر مربوط به گروه مواجه شده با دوز 100 میلی­گرم بر کیلوگرم کافئین در چشم نوزاد یک روزه موش صحرایی، تاخیر در ناپدید شدن هسته سلول‏ها در بخش مرکزی ساختار عدسی. پیکان ها نشان دهنده حضور هسته سلول­ها در بخش‏های مرکزی عدسی هستند. به‏علاوه سلول‏های اپی‫تلیالی در بخش قدامی و خلفی عدسی (پیکان‫های قرمز رنگ) دیده می‏شود.

 

 

 

بررسی تغییرات الگوی بیان ژن PAX6 در بافت چشم

بررسی تاثیر کافئین بر بیان ژن PAX6 نشان داد که بافت چشم در وضعیتBase line  مقادیری ثابتی از ژن را بیان می‏کنند که در اثر تیمار با کافئین، تفاوت در روند بیان را شاهد بودیم. همان‫طور که نشان داده شده است ژن PAX6 در هر دو گروه آزمایشی دریافت کننده 50 و 100 میلی­گرم بر کیلوگرم وزن بدن کافئین افزایش بیان معنی داری را نشان می‏دهند (05/0>p).

این در‏حالی است که افزایش میزان بیان PAX6 در گروه دریافت کننده 100 میلی‏گرم بر کیلوگرم از کافئین نسبت به گروه کنترل 39/11 برابر بوده و این افزایش معنی‫دار بود (05/0>p). میزان بیان  PAX6در گروه دریافت کننده 50 میلی­گرم بر کیلوگرم وزن بدن کافئین نیز نسبت به گروه کنترل افزایش داشته و این افزایش66/4 برابر بود (05/0>p). میزان بیان ژن PAX6 در گروه 100 میلی‏گرم نسبت به 50 میلی‏گرم نیز افزایشی برابر 03/2 بود (نمودار 4).

 

 

 

 

 

 

 

 

 

نمودار 4: (A) نمودار بیان نسبی ژن PAX6 در گروه‏های آزمایش  تحت تیمار با دوز 50 و (B) 100 میلی­گرم بر کیلوگرم کافئین در مقایسه با گروه کنترل، (C) نمودار بیان نسبی PAX6در گروه100 میلی­گرم بر کیلوگرم کافئین نسبت به 50 میلی­گرم بر کیلوگرم کافئین.

 

 

به‫علاوه محصولات حاصل از  Real-time PCRروی ژل آگارز برده شد، بـا توجـه بـه‫وجود تنها یک پیـک بـرای هـر قطعـه ژن در دمـای ذوب منحصــر بــه خــودش،

 

اختصاصــی بــودن محصــول PCR  مشخص شد. جهت تاییـد نتـایج منحنـی ذوب قطعـات تکثیری، محصول Real-time PCR  با ژل الکتروفورز آنـالیز شده و نتایج تایید شد (شکل 5).

 

 

 

 

شکل 5: آنالیز ژل الکتروفورز محصولات حاصل از  Real-time PCR، باند چاهک‏های PC1 و PC2 بیانگر محصول تکثیری PAX6 در گروه کنترل ،چاهک‏های 2-1 گروه50 میلی­گرم بر کیلوگرم کافئین و چاهک‏های 4-3مربوط به گروه 100 میلی­گرم بر کیلوگرم کافئین، باند چاهک NC مربوط به کنترل منفی واکنش‏ها بوده و باند چاهک M سایز مارکر می‏باشد.

 

 

بحث

چشم به­عنوان یک عضو پیچیده و بسیار تکامل یافته حساس به نور بوده و قادر است برآورد دقیقی از شکل، شدت نور و رنگی که از اجسام مختلف منعکس می‏شود را به‏عمل آورد. بنابراین اهمیت ویژه­ای در حفظ حیات اکثر موجودات ایفا می‏کند. مصرف کافئین توسط مادران در دوره بارداری، نوزادان آن‫ها را در معرض این نوع ترکیبات متیل گزانتین قرار می‏دهد که با اثرات مضر و تراتوژن متعدد همراه است. در مطالعه حاضر دوز متوسط و زیاد کافئین مورد استفاده قرار گرفت، دوزهای مورد استفاده شامل 50 و 100 میلی‫گرم بر کیلوگرم بودند. کافئین به‫راحتی از جفت عبور کرده و مقادیر زیادی از آن به مایع آمنیوتیک و بند­ناف رسیده و در ادرار و پلاسمای نوزادان پدیدار می‏شود. علاوه بر این دفع کافئین در جنین و نوزاد تازه متولد شده آهسته است (26)، با توجه به حساسیت شکل­گیری جنین در ماه­های اولیه، مواجهه جنین با مقادیر زیاد ترکیبات کافئین‫دار ممکن ‏است به افزایش اثرات زیان­آور منجر شده و موجب تاثیر منفی بر ارگانوژنز و تکامل طبیعی جنین شد. از سوی دیگر شایان ذکر است که امروزه در سراسر جهان قهوه و چای به‫عنوان نوشیدنی فراگیر و اصلی مردم جایگاه خود را دارا می­باشد.

مطالعه ما تائیدی بر گزارش‏هایی است که محققان در رابطه با مصرف کافئین و ایجاد اختلال و تاثیر بر رشد داخل رحمی، منتشر نموده­اند. تایر و همکارانش (22)، افزایش در میزان ناهنجاری‏هایی ازجمله شکاف کام و فقدان یک یا چند انگشت در موش‏هایی که دوز 100 میلی‫گرم بر کیلوگرم را به‏صورت روزانه دریافت می‏کردند را نشان دادند. علاوه بر این مصرف کافئین در موش‏های باردار، به‏صورت وابسته به دوز، موجب کاهش وزن بدن و وزن بیضه، کوچک‫تر شدن بیضه‏ها و در­نهایت کاهش توانایی تولید اسپرم نوزادان متولد شده در هنگام بلوغ می‏شود (27). در پژوهشی که فرناندز و همکاران (28) انجام دادند افزایش معنی‏دار آماری در خطر سقط خودبه‫خودی و وزن کم هنگام تولد نوزادان در زنان بارداری که بیش از 150 میلی‏گرم کافئین در روز مصرف می‏کنند، نشان داده شده است. با توجه به نتایج به‏دست آمده از بخش تکوینی پژوهش حاضر که اشاره به کاهش وزن، طول سری-نشیمنگاهی، عرض سر و برخی از شاخص‏های رشد به‏صورت وابسته به دوز دارد، چنین تصور می‏‫شود که ترکیبات متیل گزانتینی ازجمله کافئین بر اندام‏های حرکتی تاثیر منفی داشته که طی آن مهاجرت سلولی با اشکال روبرو شده و در نتیجه رشد و نمو اندام‏ها با اختلال همراه شده و این ترکیب پورینی که به­خوبی از مادر به جنین در حال تکوین انتقال می‏یابد، با اثرات منفی خود مانع از رشد بافت‏های جنین خواهد شد که یکی از موارد آن کاهش وزن و کوتاهی طول سری-نشیمنگاهی است.

این مطالعه نشان داد که مصرف کافئین در دوران بارداری می‏تواند علاوه بر القاء ناهنجاری‏های معمول منتسب به آن، اختلالات چشمی نیز ایجاد نماید. گروهی از محققین  نشان دادند که مواجهه موش‏های باردار با کافئین سبب ایجاد تغییراتی در قرنیه چشم ازجمله افزایش ضخامت، افزایش فعالیت میتوزی استرومای قرنیه، فقدان سلول‏های اندوتلیال و سلول‏های اندوتلیال واکوئله همراه هایپرکروماتینی هسته و پلی مورفیسم می‏شود (26). همچنین اورکلی­اوغلو و همکاران (21) به ارزیابی بافت‫شناسی تاثیر کافئین در طول دوران بارداری بر لنز کریستالی پرداختند و یافته‏های آن‏ها‫، آثار کاتاراکتوژنزیز (دژنراسیون ائوزینوفیلیک، تورم سلول‫های عدسی و تجمع مایع) را نشان داد. همچنین در تحقیق دیگری که توسط نویسندگان مقاله انجام شده حضور سلول‏های اپی‫تلیالی در بخش خلفی در عدسی نوزادان یک‏روزه، اشکال درتغییر ماهیت عدسی و شفاف شدن آن در طی تکامل و تراکم غیرطبیعی سلول‏ها در بخش‏های میانی عدسی مشاهده شد (29).

یافته‏های مطالعه حاضر نشان داد که اثر تیمار کافئین مادری اختلالات هیستومورفومتری و آتروفیک را در شبکیه چشم در نوزادان تازه متولد شده ایجاد می‏کند که این تغییرات به‏صورت وابسته به دوز در گروه‏های تحت تیمار همراه بود، به‏علاوه تغییرات دژنراتیو در لایه شبکه داخلی (IPL) نیز به‏صورت وابسته به دوز در مقایسه با گروه کنترل مشاهده شد. نتایج نشان داد که بیشتر تغییرات در بخش شبکه داخلی که توسط مویرگ‏های مشتق از شریان مرکزی عروق­دهی می‏شوند اتفاق افتاده و بخش شبکه خارجی (ONL) که فاقد رگ بوده و اکسیژن و مواد مغذی را توسط عروق کروئید دریافت می‏کند، کمتر تحت تاثیر قرار گرفته است. این یافته‏ها پیشنهاد می‏کند که بخشی از این اختلالات به‫دلیل انقباض عروقی ناشی از کافئین در عروق جفتی و کاهش جریان خون مویرگی در طول بارداری رخ می‏دهد.

بسیاری از مطالعات اثر کافئین بر ارگان‏های مختلف را بررسی کرده‫اند و برخی از مکانیسم‏های ممکن برای اثرات مضر آن را به عنوان فرضیه ارائه داده اند.کافئین سطح آدنوزین منوفسفات حلقوی (cAMP) را به‫وسیله مهار فسفو دی­استراز افزایش می‏دهد، بنابراین افزایش cAMP ممکن است با رشد و نمو سلول‏های جنینی تداخل داشته باشد (15, 30). کافئین به‫عنوان آنتاگونیست آدنوزینی و مهار گیرنده آدنوزین سبب انقباض عروقی و کاهش اکسیژن رسانی می‏‫شود، انقباض عروقی مصرف کافئین در بارداری باعث کاهش جریان خون جفت و کاهش جریان خونی مغزی می‏شود (31, 32). به‏طور مشابه جریان خون در شریان مزانتریک در افراد بالغ و نوزادان تازه متولد شده را کاهش می‏دهد (33). علاوه بر این گروهی از محققین نشان دادند کافئین سبب کاهش جریان خون ماکولا (34) و شبکیه (35)، یک‏ساعت پس از تجویز خوراکی آن، در مقایسه با مقدار پایه می‏شود. همچنین گروهی نشان دادند کافئین مقاومت عروقی را افزایش و جریان خون را در عصب بینایی و کروئید شبکیه انسان، کاهش می‏دهد (36). بنابراین این یافته‏ها پیشنهاد می‏کند کاهش فشار خون چشمی ممکن ‏است در تاثیر نامطلوب کافئین به‏وسیله نکروز ایسکمی-هیپوکسی بافت دخیل بوده و آثاری همچون تاخیر رشد سیستم بینایی ازجمله شبکیه را به‫دنبال داشته باشد. در تحقیق حاضر نیز احتمال این‏که عوامل مذکور باعث بروز تغییرات ناشی از کافئین بر ضخامت لایه‏های مختلف شبکیه و نیز سلول‏های لایه گانگلیونی شده باشد، دور از ذهن نیست. علاوه بر این یکی دیگر از مکانیسم­هایی که می‏توان به آن اشاره کرد آپوپتوزیس سلول‏های شبکیه به‏واسطه تغییر بیان ژن‏ها می‏باشد، در شکل‏گیری سیستم بینایی بیان صحیح ژن‏های موثر اهمیت ویژه­ای دارد، برخی از مهم‫ترین این ژن‏ها شاملSIX3 ,RX ,Otx2 ,Lhx2 ,Pax6 می‏باشند. بیان صحیح Pax6 در شکل‏گیری عدسی و شبکیه اهمیت ویژه ای دارد. بنابراین ایجاد اختلال در بیان این ژن‏ها و پروتئین‏ها می‏تواند منجر به ایجاد اختلال در شکل‏گیری و تکامل سیستم بینایی شود (11, 37). ممکن است کافئین با اثر بر بیان این ژن‏ها و تغییر الگوی بیان آن، تاثیر خود را بر تکوین ناقص شبکیه القا کرده باشد. میزان صحیح فعالیت PAX6 جهت تکوین ساختار نرمال چشم اهمیت قابل توجهی دارد، پژوهش‏ها نشان داده­اند افزایش بیان PAX6 در موش منجر به شکل‏گیری فنوتیپ‏های شدیدی در چشم آن‏ها شده است (38). در­حالی‏که از سوی دیگر کاهش فعالیت PAX6 در موتاسیون‏های هتروزیگوت PAX6، برخی دیگر از فنوتیپ‎‏ها از جمله آنیریدیا (فقدان چشم) را در انسان (39) و فنوتیپ چشم کوچک را در موش و رت به‫دنبال داشته است (40). الگوی بیان حفظ شده PAX6 در طی تکوین و نیز مطالعات کاربردی در این زمینه با ایجاد مدل‏های دارای موتاسیون، در سالیان اخیر، اشاره به دخالت این فاکتور در طیف گسترده ای از وقایع رشد و نمو نرمال ساختار چشم دارد. در این تحقیق حاضر نیز، نتایج Real time PCR نشان داد که بیان ژن PAX6 در گروه مواجه شده با کافئین نسبت به گروه کنترل افزایش داشته است.

ژنگ و همکاران (41) به بررسی بیان پروتئین PAX6 در جنین جوجه پرداختند که در این بررسی تخم مرغ­های لقاح یافته را در معرض مقادیر 5، 10 و 15 میکرومول کافئین در هر تخم مرغ قرار داده و تاثیر کافئین را در رشد نمو بخش بینایی جنین اولیه جوجه، مورفولوژی چشم و بیان پروتئین‏های PAX6 و نوروفیلامنت به‫روش ایمنوهیستوشیمی بررسی کردند. آن‏ها دریافتند مقادیر زیاد کافئین نه‏تنها شکل‏گیری و رشد وزیکول بینایی به شبکیه را تحت تاثیر قرار می‏دهد، بلکه رشد عدسی چشم را نیز تحت تاثیر قرار داده و همچنین باعث تشکیل چشم نامتقارن شده و رشد استخوان Orbit که یکی از ساختارهای جانبی چشم است را نیز در جوجه‏های تیمار شده با کافئین دچار اختلال می­کند. نتایج تحقیق این گروه نشان داد که بیان پروتئین PAX6 در وزیکول بینایی و اکتودرم عدسی در گروه تیمار با کافئین در مقایسه با گروه کنترل مختل شده و ایجاد کننده دیسپلازی در جنین های 9، 12 و 13 روزه است. به‏طوری­که مواجهه با کافئین سبب توزیع گسترده‫تر بیان پروتئین PAX6 در وزیکول بینایی شده و موفوژنز آن را دچار اختلال می‏نماید.

نتایج مطالعات نشان دهنده اهمیت دوز و الگوی صحیح بیان PAX6 در شکل‏گیری صحیح سیستم بینایی دارد. مطالعه دورا و همکاران (42) در سال بیانگر تاثیر دوز PAX6 بر رشد ،ترمیم زخم و تکوین قرنیه می‏باشد.

گروهی از محققین به سرپرستی دیویز، به بررسی افزایش بیان ژن PAX6 در قرنیه چشم در مدل موش دارای جهش در این ژن پرداختند و نشان دادند که بیان بالای PAX6 در قرنیه، منجر به شکل‏گیری غیرطبیعی آن، همراه با تغییر مورفولوژی سلول‏های اپیتلیالی، نورگ­زایی (Neovascularization) و تهاجم سلول‏های ایمنی می‫شود و در واقع تغییرات عمده این افزایش بیان، در عملکرد سیستم ایمنی، ایجاد عروق و تمایز سلول‫های اپیتلیالی در موش ترانس­ژن می­باشد (43).

به‏طور مشابه برخی دیگر از مطالعات نیز تاثیر افزایش بیان را حائز اهمیت دانسته­اند، به‏طوری‫که با ایجاد یک مدل موشی ترانس­ژن، اثرات دوز بیان ژن PAX6 را بر روی تکامل ساختار چشم بررسی نمودند و نتایج تحقیق آن‏ها منجر به آشکار شدن اهمیت سطح بیان PAX6 در شکل‏گیری نرمال بافت چشم شد. ارزیابی نتیجه تحقیق آن‏ها نشان داد که میزان بیان کم و یا زیاد ژن PAX6، به تشکیل چشم‏های غیر طبیعی منجر می‏شود. لذا این امر به حساسیت قابل توجه دوز این ژن روی تکامل صحیح اشاره می‏کند و بیانگر این موضوع است که به‏طور جالب توجه، چشم تنها ارگانی است که توسط اثرات دوز این ژن تحت تاثیر قرار می‏گیرد، همچنین آن‏ها با بیان این نتایج پیشنهاد کردند که عملکرد PAX6 در این بافت احتمالا مکانیسم متفاوتی دارد و یا تکوین صحیح این ساختار در صورت تغییر الگوی بیان، نیازمند زمان بیشتری خواهد بود . به‏علاوه موتاسیون در ژن PAX6 به تشکیل آنیدریدیا در انسان و چشم کوچک در موش منتج می‏شود (38).

نتایج مطالعه حاضر نیز با گزارشات فوق که بیانگر اهمیت دوز ژن PAX6 هستند، مطابقت دارد. این تحقیق نشان داده است که نه تنها بیان کم این ژن، بلکه افزایش بیان آن نیز می‏تواند تکوین صحیح ساختار بینایی را با اختلال مواجه نماید. به‏طوری‫که در نتایج به آن اشاره شد، تیمار با کافئین با میزان 50 میلی‏گرم بر کیلوگرم وزن بدن سبب افزایش الگوی بیان PAX6 نسبت به گروه کنترل شده است. بعلاوه نتایج حاصل از این مطالعه نشان می‏دهد که این تغییرات بیان در شرایطی که موش‏های باردار در معرض میزان 100 میلی‏گرم بر کیلوگرم از کافئین قرار گرفتند نیز الگوی افزایشی داشته است.

تخریب بافتی به‏وسیله استرس­اکسیداتیو می‏تواند به تولید رادیکال‏های آزاد منتج شود که به‫دلیل غلبه رادیکال آزاد بر مهار دفاع آنتی­اکسیدانتی بدن در آسیب‏ها می‏باشد. شبکیه عصبی که شامل غشایی با محتوای اسید­چرب غیر­اشباع می‏باشد، میزان مصرف اکسیژن بالایی را در میان بافت‏های بدن دارد و به‫ همین دلیل بسیار مستعد به استرس­اکسیداتیو است، لذا برخی از اثرات سو کافئین ممکن ‏است به‫دلیل آسیب‏های اکسیدانت باشد، با استناد به نتایج به‏دست آمده از پژوهش‏های محققین که از یک­سو اشاره به مستعد بودن چشم خصوصا شبکیه عصبی به استرس­اکسیداتیو و معرفی این ساختار به‫عنوان یکی از بافت‏های پرمصرف اکسیژن دارد و نیز از سوی دیگر ارتباط افزایش قابل توجه اکسیژن فعال (ROS) در بافت‏ها در شرایط حضور کافئین، می‏توان اثر محافظتی ویتامین C را به عنوان آنتی­اکسیدانت در جلوگیری از اختلال کافئین بر سیستم بینایی مورد توجه قرار داد.

 

نتیجه‫گیری

نتایج مطالعه ما نشان داد که کافئین در طی دوران ارگانوژنز نه­تنها می‏تواند سبب کاهش وزن تولد، کاهش رشد، کاهش طول سری- دمی و کاهش عرض سر (تاثیر رشد داخل رحمی جنین) در موش شود، بلکه ناهنجاری‏های چشمی را نیز سبب می‏شود. آزمایش حاصل نشان داد که مصرف کافئین در زمان بارداری باعث ایجاد تاخیر و نقص در تکامل سیستم بینایی از جمله شبکیه می‏شود و کافئین این اثرات را می‏تواند به‏وسیله چندین مکانیسم اعمال کند که از جمله این مکانیسم­ها می‏توان به اختلاف افزایشی بیان PAX6 در شرایط تحت تیمار با کافئین اشاره کرد، البته شناخت کامل­تر این مکانیسم‏ها به تحقیقات بیشتری نیاز دارد. البته جهت بررسی مکانیسم‏های مولکولی، مطالعات تکمیلی دقیق‏تری نیز توصیه می‏شود.

 

تشکر و قدردانی

بدین وسیله مراتب قدردانی و سپاس خود را از همکاری و مساعدت­های خانم رضوان باقری و آقای همایون چهری ابراز داشته و از بخش بافت شناسی دانشکده دامپزشکی تشکر می‏نماییم.

1. Fisone G, Borgkvist A, Usiello A. Caffeine as a psychomotor stimulant: mechanism of action. Cell Mol Life Sci. 2004; 61(7-8): 857-72.

2. Garrett BE, Griffiths RR. The role of dopamine in the behavioral effects of caffeine in animals and humans. Pharmacol Biochem Behav. 1997; 57(3): 533-41.

3. Gervitz LM, Lutherer LO, Davies DG, Pirch JH, Fowler JC. Adenosine induces initial hypoxic-ischemic depression of synaptic transmission in the rat hippocampus in vivo. Am J Physiol Regul Integr Comp Physiol. 2001; 280(3): R639-45.

4. Safranow K, Machoy Z. Methylated purines in urinary stones. Clin Chem. 2005; 51(8): 1493-8.

5. Fredholm BB, Battig K, Holmen J, Nehlig A, Zvartau EE. Actions of caffeine in the brain with special reference to factors that contribute to its widespread use. Pharmacol Rev. 1999; 51(1): 83-133.

6. Davis JM, Zhao Z, Stock HS, Mehl KA, Buggy J, Hand GA. Central nervous system effects of caffeine and adenosine on fatigue. Am J Physiol Regul Integr Comp Physiol. 2003; 284(2): R399-404

7. Kardong KV. Vertebrates: comparative anatomy, function, evolution. 12th Ed. New York: Mc Graw-Hill; 2002.

8. Masland RH. Cell populations of the retina: the Proctor lecture. Invest Ophthalmol Vis Sci. 2011; 52(7): 4581-91.

9. Moore KL, Persaud TVN, Torchia MG. The Developing Human: Clinically Oriented Embryology. 9th Ed. Philadelphia, PA: Elsevier/Saunders; 2013.

10. Masland RH. The neuronal organization of the retina. Neuron. 2012; 76(2): 266-80.

11. Janet Rossant  PTT. Mouse Development: Patterning, Morphogenesis, and Organogenesis. 1st Ed. London: Academic Press; 2002.

12. Callaerts P, Halder G, Gehring WJ. PAX-6 in development and evolution. Annu Rev Neurosci. 1997; 20(1): 483-532.

13. Chow RL, Altmann CR, Lang RA, Hemmati-Brivanlou A. Pax6 induces ectopic eyes in a vertebrate. Development. 1999; 126(19): 4213-22.

14. Matijasevich A, Barros FC, Santos IS, Yemini A. Maternal caffeine consumption and fetal death: a case-control study in Uruguay. Paediatr Perinat Epidemiol. 2006; 20(2): 100-9.

15. Christian MS, Brent RL. Teratogen update: evaluation of the reproductive and developmental risks of caffeine. Teratology. 2001; 64(1): 51-78.

16. Scott WJ, Jr. Caffeine-induced limb malformations: description of malformations and quantitation of placental transfer. Teratology. 1983; 28(335-427).

17. Wink CS, Rossowska MJ, Nakamoto T. Effects of caffeine on bone cells and bone development in fast-growing rats. Anat Rec. 1996; 246(1): 30-8.

18. Yin W, Li H, Peng L. [Behavioral-teratological effects of caffeine on mice]. Wei Sheng Yan Jiu. 1998; 27(2): 116-118.

19. Zhai H, Goss DA, Hammond RW. The effect of caffeine on the accommodative response/accommodative stimulus function and on the response AC/A ratio. Curr Eye Res. 1993; 12(6): 489-99.

20. Okuno T, Sugiyama T, Tominaga M, Kojima S, Ikeda T. Effects of caffeine on microcirculation of the human ocular fundus. Jpn J Ophthalmol. 2002; 46(2): 170-6.

21. Evereklioglu C, Alasehirli B, Sari I, Cengiz B, Bagci C. Effect of nicotine exposure during gestation on neonatal rat crystalline lenses. Eye (Lond). 2004; 18(1): 67-73.

22. Thayer PS, Palm PE. A current assessment of the mutagenic and teratogenic effects of caffeine. CRC Crit Rev Toxicol. 1975; 3(3): 345-69.

23. Anbara H, Shahrooz R, Shalizar Jalali A, Touni S. Protective Effect of Royal Jelly and

 

Vitamin C Against Phenylhydrazine-Induced  Nephropathy in Mice: Histological Study. Journal of Cell & Tissue. 2016; 7(4): 417-28.

24. Andrade NM, Arismendi NL. DAPI staining and fluorescence microscopy techniques for phytoplasmas. Methods in molecular biology (Clifton, NJ). 2013; 938: 115-21.

25. La Torre A, Lamba DA, Jayabalu A, Reh TA. Production and transplantation of retinal cells from human and mouse embryonic stem cells. Methods in molecular biology (Clifton, NJ). 2012; 884: 229-46.

26. Evereklioglu C, Sari I, Alasehirli B, Guldur E, Cengiz B, Balat Z, et al. High dose of caffeine administered to pregnant rats causes histopathological changes in the cornea of newborn pups. Med Sci Monit. 2003; 9(5): BR168-73.

27. Mehran Dorostghoal AAM, Parvaneh Nooraei. Effects of Caffeine Consumption during Lactation on Postnatal Development of Testis in Offspring Wistar Rats. Journal of Isfahan Medical School. 2010: 1223-30.

28. Fernandes O, Sabharwal M, Smiley T, Pastuszak A, Koren G, Einarson T. Moderate to heavy caffeine consumption during pregnancy and relationship to spontaneous abortion and abnormal fetal growth: a meta-analysis. Reprod Toxicol. 1998; 12(4): 435-44.

29. Morovvati H, Eini L, Adibmoradi M. Evaluate the effect of caffeine consumption during pregnancy on lens development of the neonate rat. Iranian Veterinary Journal. 2016; 12(1): 88-96.

30. Minelli A, Bellezza I. Methylxanthines and reproduction. Handb Exp Pharmacol. 2011(200): 349-72.

31. Cameron OG, Modell JG, Hariharan M. Caffeine and human cerebral blood flow: a positron emission tomography study. Life Sci. 1990; 47(13): 1141-6.

32. Kirkinen P, Jouppila P, Koivula A, Vuori J, Puukka M. The effect of caffeine on placental and fetal blood flow in human pregnancy. Am J Obstet Gynecol. 1983; 147(8): 939-942.

33. Lane AJ, Coombs RC, Evans DH, Levin RJ. Effect of caffeine on neonatal splanchnic blood flow. Arch Dis Child Fetal Neonatal Ed. 1999; 80(2): F128-9.

34. Ajayi OB, Ukwade MT. Caffeine and intraocular pressure in a Nigerian population. J Glaucoma. 2001; 10(1): 25-31.

35. Terai N, Spoerl E, Pillunat LE, Stodtmeister R. The effect of caffeine on retinal vessel diameter in young healthy subjects. Acta Ophthalmol. 2012; 90(7): e524-8.

36. Okuno T, Sugiyama T, Tominaga M, Kojima S, Ikeda T. Effects of caffeine on microcirculation of the human ocular fundus. Jpn J Ophthalmol. 2002; 46(2): 170-6.

37. Kozmik Z. The role of Pax genes in eye evolution. Brain Research Bulletin. 2008; 75(2–4): 335-9.

38. Schedl A, Ross A, Lee M, Engelkamp D, Rashbass P, van Heyningen V, et al. Influence of PAX6 gene dosage on development: overexpression causes severe eye abnormalities. Cell. 1996; 86(1): 71-82.

39. Martha A, Strong LC, Ferrell RE, Saunders GF. Three novel aniridia mutations in the human PAX6 gene. Hum Mutat. 1995; 6(1): 44-9.

40. Hill RE, Favor J, Hogan BL, Ton CC, Saunders GF, Hanson IM, et al. Mouse Small eye results from mutations in a paired-like homeobox-containing gene. Nature. 1992; 355(6362):750.

41. Ma ZL, Wang G, Cheng X, Chuai M, Kurihara H, Lee KK, et al. Excess caffeine exposure impairs eye development during chick embryogenesis. J Cell Mol Med. 2014; 18(6): 1134-43.

42. Dora N, Ou J, Kucerova R, Parisi I, West JD, Collinson JM. PAX6 dosage effects on corneal development, growth, and wound healing. Dev Dyn. 2008; 237(5): 1295-306.

43. Davis J, Piatigorsky J. Overexpression of Pax6 in mouse cornea directly alters corneal epithelial cells: changes in immune function, vascularization, and differentiation. Invest Ophthalmol Vis Sci. 2011; 52(7): 4158-68.