افزایش بیان ژن‏های Beclin1 و LC3 دخیل در فرآیند اتوفاژی در بیماران مبتلا به سرطان سلول‏های غیرکوچک ریه

نوع مقاله: علمی - پژوهشی

نویسندگان

1 کارشناس ارشد ژنتیک، گروه زیست‏شناسی، دانشکده علوم پایه، دانشگاه آزاد اسلامی واحد ورامین–پیشوا، تهران، ایران

2 دکترای ژنتیک مولکولی، گروه زیست‏شناسی، عضو هیئت علمی دانشگاه آزاد واحد ورامین-پیشوا، تهران، ایران

3 دکترای تخصصی بیوتکنولوژی پزشکی، عضو هیئت علمی انستیتو پاستور، تهران، ایران

چکیده

هدف: در مطالعه حاضر میزان بیان ژن‏های مذکور در 30 بیمار مبتلا به سرطان سلول‏های غیرکوچک ریه بررسی گردیده است.
مواد و روش‏-ها: استخراج RNA از بافت‏ توموری و بافت مجاور 30 بیمار مبتلا به سرطان سلول‏های غیرکوچک ریه انجام شد. پس از سنتزcDNA ، با روشReal time-PCR بیان ژن‏هایBeclin1  و LC3 ارزیابی گردید. همچنین میزان بیان این ژن‏ها با یافته‌های بالینی و پاتولوژی بیماران مقایسه شد.
نتایج: در مطالعه حاضر میزان بیان دو ژنBeclin1  (p<0.0001) و LC3 (p<0.0001) افزایش قابل توجهی داشت. همچنین ارتباط معنی‫داری بین افزایش بیانLC3 بانوع زیرگروه بافتی مشاهده شد (p=0.0171).
نتیجه‏گیری: افزایش بیان دو ژن  Beclin-1و LC3 ممکن است باعث افزایش فرآیند اتوفاژی شود و افزایش فرآیند اتوفاژی می‏تواند باعث توسعه‎ی تومورزایی گردد که تایید این نتیجه نیاز به تحقیقات بیش‏تر دارد.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

سرطان ریه علت اصلی مرگ در اثر سرطان در جهان است (1). در سال 2016، 224390 مورد جدید سرطان ریه (117920 مرد و 106470 زن) در ایالات متحده آمریکا شناسایی شده است. همچنین، تخمین زده شده است حدود 158080 (85920 مرد و 72160 زن) مورد مرگ ‏و میر در اثر این بیماری رخ داده است. پر اهمیت‏ترین سرطان‏ها در ایران سرطان معده، سرطان ریه و سرطان پستان هستند و در سال 2012 در ایران 4361 مرگ بر اثر سرطان ریه گزارش شده است (2). سازمان بهداشت جهانی  World Health Organization (WHO) سرطان ریه را از نظر بافت‏شناسی به دو کلاس بزرگ (سرطان سلول‏های کوچک ریه و سرطان سلول‏های غیرکوچک ریه) تقسیم می‏کند (3). در سرطان سلول‏های کوچک ریه (SCLC) (Small Cell Lung Cancer ) یاخته‌های سرطانی نوع کوچک در زیر میکروسکوپ به شکل جوی دو سر دیده می‌شوند و به‫همین دلیل به آن سرطان جو شکل (Oat-shaped) نیز گفته می‌شود. سرطان سلول‏های کوچک ریه حدود 13 درصد از سرطان‏های ریه را شامل می‏شود. SCLC یک بیماری منحصر به‫فرد است که از نظر گرایش برای متاستاز و حساسیت شدید به شروع شیمی‏درمانی از  NSCLC متمایز می‏شود (4). سرطان سلول‏های غیرکوچک ریه  (NSCLC) بیش از 85 درصد از سرطان‏های ریه را شامل می‏شود (5). سرطان سلول‏های غیرکوچک ریه از نظر بافت‏شناسی به سه نوع کارسینومای سلول‏های سنگفرشی (Squamous Cell Carcinoma)(SCC)، آدنوکارسینوما (Adenocarcinoma) (ADC) و کارسینومای سلول بزرگ تقسیم می‏شود (6). با وجود پیشرفت‏های قابل ‏توجه‏ در معرفی داروهای جدید و عمل جراحی، پیش‏آگاهی برای سرطان ریه هنوز ضعیف است و تنها 15 درصد از بیماران مبتلا به سرطان ریه 5 سال پس از تشخیص زنده می‏مانند، بنابراین تشخیص زودهنگام NSCLC اهمیت بسیاری دارد (7). در طول دوره شکل‏گیری و پیشرفتNSCLC  فاکتورهای زیادی از جمله غیرفعال شدن ژن‏های سرکوب‏گر تومور، اختلال در همئوستازی سلول، موانع حذف اندامک‏های سلولی آسیب دیده ، موانع آپوپتوزیس و اتوفاژی (Autophagy) درگیر هستند (8).

اتوفاژی یک مسیر داخل سلولی عمده برای تخریب و بازیافت پروتئین‏هایی با عمر طولانی و اندامک‏های آسیب دیده است که از طریق مسیرهای مختلف شامل ماکرواتوفاژی، میکرواتوفاژی و اتوفاژی به‫واسطه‏ی چاپرون‏ها اتفاق می‏افتد (11،10،9). در ماکرواتوفاژی (که به‫عنوان اتوفاژی شناخته می‏شود) بخشی از سیتوپلاسم سلول داخل یک واکوئل تخصصی به نام اتوفاگوزوم فرو می‏رود که در نهایت با وزیکول‏های لیزوزوم برای تخریب مواد مصادره شده ادغام می‏شود (10). اتوفاژی در بسیاری از فرآیندهای فیزیولوژی مثل رشد سلول، پیری، مرگ‏ سلولی، پاسخ استرس و پاسخ ایمنی همچنین در سرطان درگیر است (12،10). تقریبا 30 ژن فرآیند اتوفاژی را تنظیم می‏کنند که همه‏ی آن‏ها در مخمر کشف شده‏اند و 16 همولوگ آن‏ها در انسان شناسایی شده‌اند (13). در این میان ژن‏هایBeclin-1 و LC3 نقش محوری در اتوفاژی دارند (10).

Beclin-1 هم در مسیرهای سیگنالینگ و هم در مرحله‏ی شروع تشکیل اتوفاگوزوم که در آن تعامل با PI3PK و hvp34 ضروری است درگیر است (15،14،10).

LC3 شامل یک فرم محلول LC3I (با وزن مولکولی18Kb) و فرم لیپیدی به نام LC3II (با وزن مولکولی 16Kb) است و به‫صورت 3 ایزوفرم (LC3A,LC3B,LC3C) در بافت پستانداران بیان می‏شود که از این میان LC3B با اتوفاژی مرتبط است (15،14). انواع مختلفی از عوامل استرس‏زا LC3 را به شدت تنظیم می‏کنند و آن را به فرم سیتوزولیک تبدیل می‏کنند و تعامل فرم سیتوزولیک (LC3I) را با فسفاتیدیل اتانول آمین برای تشکیل فرمLC3II  که به‫طور اختصاصی روی اتوفاگوزوم قرارمی‏گیرد افزایش می‏دهند، همچنین LC3II تاکنون به‫عنوان قابل اعتمادترین مارکر اتوفاژی نیز در نظر گرفته شده است (15،14).

بررسی بیان ژن‏های اتوفاژی در بافت‌های سرطان محدود و دارای نتایج بحث برانگیز است، اگرچه بیش‏تر مطالعات نشان داده‏اند که اتوفاژی به سرکوب تومور کمک می‏کند (12). در مطالعه حاضر بیان دو ژن Beclin-1 و LC3 در سطح mRNA در بافت توموری بیماران مبتلا به سرطان سلول‏های غیرکوچک ریه بررسی شده است.

 

مواد و روش‌ها

انتخاب نمونه: نمونه‌ها از بیماران با تشخیص ابتلا به سرطان سلول‏های غیرکوچک ریه که هیچ درمانی روی آن‌ها صورت نگرفته بود، توسط پاتولوژیست از بهمن 1394 لغایت مهر 1395 از بیمارستان مسیح دانشوری تهیه شدند و وارد مطالعه شده‌اند. از هر بیمار در اتاق عمل توسط جراح، نمونه توموری و مجاور توموری جدا شد و پس از قرار دادن در کرایوتیوب بلافاصله به تانک ازت منتقل شد و سپس در فریزر 70- درجه سانتی‫گراد ذخیره شد. تعداد نمونه بیماران در مطالعه حاضر، بر اساس روش pilot study (مطالعه با مقیاس کوچک) در نظر گرفته شد. بر این اساس، حدود 50 نمونه وارد این مطالعه شدند که 20 نمونه‏ در بررسی پاتولوژی، توموری بودن بافت ریه‏ی آن‏ها تایید نشد و از مطالعه خارج شدند و در نهایت با تایید پاتولوژیست 30 نمونه باقی ماند. همچنین از بیماران فرم رضایت نامه دریافت شده است و روند پژوهش نیز به تصویب بورد دانشگاه رسیده است.

استخراج RNA و سنتز cDNA : استخراج RNA توسط ترایزول (Qiagen, USA) از بافت براساس دستورالعمل شرکت انجام شد. سپس توسط دستگاه اسپکتروفوتومتر غلظت RNA با اندازه‏گیری میزان جذب آن در طول موج 260 نانومتر سنجیده شد. همچنین کیفیت RNA استخراج شده نیز توسط اندازه‏گیری نسبت جذب 280/260 سنجیده شد. سپس RNA تا زمان استفاده در فریزر 70- درجه سانتی‫گراد قرار داده شد.

سنتز cDNA توسط کیت فرمنتاز انجام شد. بر این اساس ابتدا با توجه به غلظت RNA استخراج شده مقدار 1000 نانوگرم از آن وارد واکنش شد. سپس مقدار 1 میکرولیتر پرایمر رندوم هگزامر (120ul) (Fermentas, USA) اضافه شد و باDEPC-treated water  (Fermentas, USA) به حجم 13 میکرولیتر رسانده شد. به‫مدت 5 دقیقه در 65 سانتی‫گراد انکوبه شد و روی یخ سرد شد. در مرحله بعد میزان 4 میکرولیتر بافر5X  و 5/0 میکرو لیترآنزیم Ribo Lock RNAse inhibitor (10000u) (Fermentas, USA)، 2 میکرولیتر  (Fermentas, USA) dNTP Mix 10mM  و 5/0 میکرولیتر (Fermentas,USA) RevertAidReverse Transcriptase (2500u) اضافه شد و به‫مدت 5 دقیقه در دمای 25 درجه سلسیوس و بعد 60 دقیقه در دمای 45 درجه سانتی‫گراد و سپس 5 دقیقه در دمای 70 درجه سانتی‫گراد انکوبه شد. در نهایت، cDNA سنتز شده در دمای 20- درجه سانتی‫گراد ذخیره شد.

واکنش real- timePCR کمی: مطالعه میزان بیان ژن‏های  Beclin-1و LC3 با استفاده از روش real-time PCR نسبی و مسترمیکس سایبرگرین 2X (شرکت امپیلیکون) انجام شد. در مطالعه حاضر از ژن GAPDH به‫عنوان ژن مرجع استفاده شد. اطلاعات مربوط به پرایمرها در

 

 

جدول 1 آورده شده است، در این مطالعه طراحی پرایمر نیز توسط نرم افزار Gene runner انجام گرفته است.

 

 

جدول 1: توالی پرایمرها برای تکثیر ژن‫های هدف

اندازه محصول(bp)

دما

 ( )

محل توالی

5´                      3´

ژن‏های هدف

شماره شناسایی

190

39/59

298-279

CAAGATCCTGGACCGTGTCA

Forward

Beclin1

NM_003766.4

58/59

468-445

GGCACTTTCTGTGGACATCATC

Reverse

193

62/59

196-177

TACAGCAGATACGCGACCAG

Forward

LC3

NM_181509.2

25/60

369-350

TTCACCAGCAGGAAGAAGGC

Reverse

112

4/68

1109-1087

ACACCCACTCCTCCACCTTTG

Forward

GAPDH

NM_001256799.2

4/68

1200-1178

TCCACCACCCTGTTGCTGTAG

Reverse

 

 

 

حجم کلی واکنش 20 میکرولیتر شامل مسترمیکس سایبرگرین2X، پرایمرها (5 پیکومول)،cDNA  و آب تزریقی جهت به حجم رساندن، است. تمام نمونه‏ها به‫صورت دوپلیکیت گذاشته شدند. برنامه‏ی دمایی سیستم شامل دو مرحله بود، در مرحله‏ی آغاز دمای 95 درجه سانتی‫گراد به‫مدت 15 دقیقه برای فعال شدن آنزیم، سپس 40 سیکل شامل دناتوره شدن در دمای 95 درجه سانتی‫گراد به‫مدت 30-15ثانیه و اتصال پرایمرها در دمای 60 درجه سانتی‫گراد به‫مدت 1 دقیقه استفاده شد. بعد از تکثیر از آنالیز منحنی ذوب نیز برای تعیین اختصاصیت تکثیر انجام شده، استفاده شد. واکنش real- time PCR در دستگاه  StepOnePlus(Applied Biosystems, USA) انجام شد. پس از تعیین کارایی تکثیر هر یک از پرایمرها توسط نمودار استاندارد، بیان ژن‫های مورد نظر سنجیده شد.

 

آنالیز آماری

میزان تغییرات بیان ژن‏ها نیز بر اساس فرمول  سنجیده شد. جهت آنالیز آماری داده‏ها از نرم‏افزار Graphpad Prism5 استفاده شد. همچنین معنادار بودن داده‏‏ها براساس آزمون t-test (p ≤ 0.05) ارزیابی شد.

 

نتایج

در

 

نمودار 1 و نمودار2 میزان تغییرات بیان هر یک از ژن‏ها در هر یک از نمونه‏های توموری به‫صورت جداگانه ارائه شده است. همان‏طور که مشاهده می‏شود بیان ژن Beclin1 در تمامی نمونه‏ها از حدود 2 تا 587 برابر افزایش بیان معنی‫داری (p<0.0001) داشته است و بیان ژن LC3 نیز در تمام نمونه‏ها به‫جز 1 نمونه از 3 تا حدود 1545 برابر افزایش بیان معنی‫داری (p<0.0001) را نشان می‏دهد. همچنین، بر اساس آنالیز داده‏ها ارتباط معنی‫داری بین میزان افزایش بیان دو ژن،Beclin1  و LC3 با همدیگر در بافت توموری NSCLC یافت شد (p<0.05) (نمودار).

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار 1: میزان بیان ژن Beclin1 در هر یک از نمونه‏های توموری، همان‌طور که در نمودار نشان داده شده است بیان ژن Beclin1 در همه‌ی نمونه‏های توموری افزایش یافته است.

 

 

نمودار2: میزان بیان ژن LC3 در هر یک از نمونه‏های توموری؛ همان‌طور که در نمودار نشان داده شده است بیان ژن LC3 در همه‌ی نمونه‏های توموری به جز یک نمونه افزایش یافته است.

 

 

 

نمودار3: ارتباط بین میزان افزایش بیان ژن‏هایBeclin1  و LC3 در نمونه‏های توموری؛ ارتباط معنا‏داری (p<0.05) بین میزان افزایش بیان دو ژن،Beclin1  و LC3 باهمدیگر در بافت توموری NSCLC وجود دارد. این ارتباط بدین معنا است که افزایش بیانBeclin1  روی بیانLC3  نیز تاثیر می‏گذارد و باعث افزایش بیان آن نیز می‏شود.

 

در این مطالعه ارتباط بین میزان بیان هر یک از ژن‏ها با علائم بالینی و پاتولوژیکی بیماران از جمله: نوع زیرگروه بافتی، استعمال یا عدم استعمال دخانیات، مرحله‏ی بیماری و میزان درگیر شدن غدد لنفاوی نیز بررسی شده است (جدول2).

 

 

 

جدول2: علائم بالینی و پاتولوژیکی بیماران، دسته‫بندی علائم بالینی و پاتولوژیکی بیماران و درصد بیماران موجود در هر گروه.

علائم بالینی و پاتولوژیکی بیماران

زیر گروه

زیرگروه بافتی

57% بیماران مبتلا به آدنوکارسینوما

43% مبتلا به سرطان سلول سنگفرشی

مرحله‏ی بیماری

66% بیماران، بیماری آن‏ها در مرحله‏ی I و II

34% بیماران، بیماری آن‏ها در مرحله III

جنسیت

27% زن

73% مرد

سن

3% زیر 40 سال

3% بین 40 تا 50 سال

47% بین50 تا 60 سال

47% بالای 60 سال

استعمال دخانیات

73% غیرسیگاری

27% سیگاری

 

 

 

 

بیماران مبتلا به سرطان سلول‏های غیرکوچک ریه از نظر مرحله‏ی بیماری به چهار گروه I، II، III و IV تقسیم بندی می‏شوند. در مطالعه حاضر بیماران مرحله‏ی IV مورد بررسی قرار نگرفتند، زیرا این بیماران معمولا دارای متاستاز به نقاط دور مانند مغز، کبد و استخوان بوده و جراحی نمی‏شوند. علاوه بر این به‫دلیل تعداد کم نمونه‏ها، نمونه بیمارانی که در مراحل I و II بودند در یک گروه و بیمارانی که در مرحله III بودند در گروه دیگر قرار داده شدند. بر طبق نتایج آزمون t-test تفاوت معنی‫داری بین میزان بیان ژن‏های Beclin1 (p=0.3753) وLC3  (p=0.7248) با مرحله‏ی بیماری یافت نشد (جدول2).

 

 

 

 

 

 

همچنین در مطالعه حاضر افرادی که گره‏های لنفاوی آن‏ها درگیر نشده‏اند در یک گروه (negative lymph node) و بیمارانی که گره‏های لنفاوی آن‏ها چه در یک سمت و چه در دو سمت درگیر شده‏اند در یک گروه (positive lymph node) قرار داده شدند. بر طبق نتایج حاصل از آزمون t-test تفاوت معنی‫داری بین میزان بیان

ژن‏های Beclin1 (p=0.5630) وLC3  (p=0.9982) با درگیری غددلنفاوی یافت نشد (جدول2).

تفاوت معنی‫داری بین میزان بیان ژن‏Beclin1  با نوع زیرگروه بافتی نیز یافت نشد (p=0.8318) ولی در مقابل تفاوت معناداری (p=0.0171) بین میزان بیان ژن LC3 با زیر گروه بافتی یافت شد (

 

نمودار ) (جدول2).

 

 

 

 

 

 

 

 

نمودار 4: ارتباط میزان بیان ژن‏هایBeclin1  وLC3 با زیرگروه بافتی، تفاوت معنی‫داری بین میزان بیان ژن‏Beclin1  با نوع زیرگروه بافتی نیز یافت نشد (p=0.8318) ولی در مقابل تفاوت معناداری (p=0.0171) بین میزان بیان ژن LC3 با زیر گروه بافتی یافت شد.

 

 

در مطالعه حاضر ارتباط بین میزان بیان ژن‏هایBeclin1  وLC3  با سیگاری بودن یا نبودن بیماران بررسی شد که ارتباط معنی‫داری بین میزان بیان ژن‏هایBeclin1  (p=0.7268) وLC3   (p=0.8293)با سیگاری بودن یا نبودن بیماران یافت نشد(جدول2).

 

بحث

NSCLC بیش از 85 درصد از سرطان‏های ریه را شامل می‏شود و شیمی‏درمانی، گزینه درمانی مناسب برای بیماران NSCLC است. با این‫حال، حتی در بهترین شرایط نرخ پاسخ تنها 30 تا 50 درصد است. این پاسخ ضعیف در شیمی‏درمانی به شکست در درمان سرطان ریه منجر می‏شود. یکی از عوامل موثر در ایجاد سرطان ریه اختلال در فرآیندهای سلولی مثل اتوفاژی است. اتوفاژی در سلول‏های سرطانی دارای دو عملکرد است، هم به‫عنوان سرکوب کننده تومور نقش ایفا می‏کند و هم از بقای سلول‏های توموری حمایت می‏کند. قبل از پیشرفت تومور، اتوفاژی پیشرفت تومور را سرکوب می‏کند. در حالی‫که، زمانی که تومور شروع به پیشرفت می‌کند، اتوفاژی از بقای سلول توموری حمایت می‏کند (15).

مطالعات نشان داده‏اند اتوفاژی در پاسخ به درمان‏ سرطان توسط کمک به افزایش مقاومت به درمان از سلول‏های

توموری حمایت می‏کند. اتوفاژی می‏تواند هدف درمانی برای سلول‏های تومور باشد. ژن‏های انتخاب شده ژ‏ن‏هایی هستند که در مسیر اتوفاژی نقش کلیدی دارند و اختلال در بیان آن‏ها در بسیاری از سرطان‏ها دیده شده است. بنابراین دانستن الگوی بیان این ژن‏ها در سلول‏های سرطانی ریه، با توجه به اهمیت بالای این سرطان، می‏تواند زمینه‏ای را برای انجام سایر تحقیقات در جهت رسیدن به درمان‏های هدفمند فراهم کند. بدین‫منظور در تحقیق حاضر بیان دوژن‏ دخیل در مسیر اتوفاژی شاملBeclin-1 و LC3 در نمونه‏ها‏ی توموری 30 بیمار مبتلا به NSCLC بررسی شد.

Beclin-1 اولین ژن اتوفاژی پستانداری است که کشف شده و به‫طور مستقیم با پروتئین  BCL2تعامل دارد (16). Beclin-1 به طور مثبت اتوفاژی را توسط همکاری با PI3KCIII/Vps34 و دیگر کوفاکتورهای مثبت و منفی مثل Vps15، ATG14L/Barkor، UVRAG، Bif-1، Rubicon، Ambra1، HMGB1، Survivin، Akt و Bcl-2/Bcl-Xl تنظیم می‏کند (16).

در تحقیق حاضر مشاهده شد که میزان بیان Beclin-1 در بافت سرطان سلول‏های غیرکوچک ریه در مقایسه با بافت نرمال مجاور آن افزایش پیدا کرده است. همچنین در تحقیق حاضر هیچ ارتباط معنی‫داری بین میزان افزایش بیان Beclin-1 با علائم بالینی و پاتولوژیکی بیماران از جمله نوع زیرگروه بافتی (آدنوکارسینوما یا سلول‏های سنگفرشی)، استعمال یا عدم استعمال دخانیات (مثل سیگار)، مرحله‏ی سرطان (مرحله I، II و III) و درگیر شدن غدد لنفاوی بیماران یافت نشد که نتیجه‏ی حاصل بدین معنا است که در نمونه‏های مورد بررسی وجود این علائم باعث افزایش میزان بیان ژن Beclin-1 نشده است. سایر محققین نیز در این زمینه مطالعاتی داشته‏اند. Masuda  و همکاران (17) با روش ایمونوهیستوشیمی میزان بیان ژن Beclin-1 را در510 نمونه توموری معده بررسی کردند و مشاهده کردند که میزان بیان Beclin-1 در 126 نمونه از 510 نمونه افزایش پیدا می‏کند و بیان نمودند این افزایش بیان ارتباط معنی‫داری با متاستاز غدد لنفاوی، تهاجم عروقی و متاستاز کبدی دارد. Wu  و همکاران (18) نیز با روش ایمونوهیستوشیمی میزان بیان ژن Beclin-1 را در 242 نمونه توموری روده‏ی بزرگ بررسی و مشاهده کردند که میزان بیان Beclin-1 در 50 درصد نمونه‏ها افزایش پیدا کرده است که ارتباط معنی‫داری با علائم بالینی نیز ندارد. طبق این مطالعه می‏توان افزایش بیان Beclin-1 را به چند روش تفسیر کرد: در طول توسعه و پیشرفت سرطان‏ها، سلول‏های سرطانی اغلب در معرض استرس متابولیک مثل کمبود مواد مغذی یا اکسیژن به‫دلیل نرخ تکثیر بالا و کمبود عروق هستند، درنتیجه افزایش بیان Beclin-1 ممکن است اتوفاژی را تحریک کند، درنتیجه بقای سلول‏ها را از طریق ترویج عروق افزایش می‏دهد و از سلول‏‏های سرطانی در برابر مداخله‏های درمانی حفاظت می‏کند. البته در بعضی مطالعات سرطان ریه، کاهش بیان ژن Beclin-1 مشاهده شده است. Jiang و همکاران (19) با روش‏های ایمونوهیستوشیمی، وسترن بلات و Real-time PCR میزان بیان ژن Beclin-1 را در بافت NSCLC در 142 نمونه توموری بررسی کردند و مشاهده کردند که میزان بیان Beclin-1 در سطح پروتئین و mRNA کاهش پیدا کرده است و این کاهش بیان ارتباط معنی‫داری با بافت شناسی و تمایز دارد. همچنین Zhou و همکاران (20) نیز با روش ایمونوهیستوشیمی میزان بیان ژن Beclin-1 را در NSCLC در 244 نمونه توموری بررسی کردند و مشاهده کردند که میزان بیان Beclin-1 کاهش پیدا کرده و این کاهش بیان با افزایش تومورزایی نیز ارتباط دارد.

تناقض بین نتایج مطالعه حاضر و مطالعات فوق‏الذکر می‏تواند به‫دلیل جامعه‏ی کوچک مورد بررسی در تحقیق حاضر و نوع روش مورد استفاده‏ در تحقیقات فوق‏‏الذکر باشد. زیرا در روش ایمونوهیستوشیمی میزان بیان پروتئین بررسی می‏‫شود و این احتمال وجود دارد که با اینکه میزان بیان mRNA افزایش یافته است ولی تمامی این mRNAها به‫دلیل وجود عوامل مهارکننده به پروتئین تبدیل نشده‎‏اند، در نتیجه میزان بیان ژن مورد نظر در سطح پروتئین با کاهش مواجه شده است. جالب توجه است که در سرطان روده‏ی بزرگ، در دو مطالعه‏ی جداگانه هم کاهش بیان و هم افزایش بیان در Beclin-1 گزارش شده است (21).

چندین مکانیسم وجود دارد که توضیح می‎‏دهد چگونه تحریک اتوفاژی توسط Beclin-1 از سرطان جلوگیری می‏کند.

  1. مرگ سلولی که به واسطه‏ی اتوفاژی رخ می‏دهد.
  2. اتوفاژی می‏تواند ارگان‏های آسیب دیده را حذف کند بدین وسیله منابع تولید کننده مواد سمی مثل محصولات حاصل از آسیب DNA حذف می‏شوند. درنتیجه این عملکرد از استرس اکسیداتیو حاصل از آسیب ارگان‏ها جلوگیری می‏کند (21).

LC3 شامل یک فرم محلول LC3I و فرم لیپیدی LC3II است (22). زمانی که اتوفاژی رخ می‏دهد فرم سیتوپلاسمی LC3 (LC3I) به‫فرم غشایی اتوفاژیک LC3 (LC3II) که روی اتوفاگوزوم قرار می‏گیرد، تبدیل می‏شود. این تبدیل به‫نظر می‏رسد با فعالیت اتوفاژی مرتبط باشد، در واقع LC3 در مرحله‏ی طویل سازی تشکیل اتوفاگوزوم نقش دارد (23). تغییرات در بیان LC3 در سرطان‏های مختلف با نوع تومور و مرحله‏ی سرطان مرتبط است (24). در تحقیق حاضر مشاهده شد که میزان بیان LC3 در بافت سرطان سلول‏های غیرکوچک ریه در مقایسه با بافت نرمال مجاور آن افزایش پیدا کرده است. ارتباط معنی‫داری (p=0.0171) بین میزان افزایش بیان LC3 با نوع زیرگروه بافتی (آدنوکارسینوما یا سلول‏های سنگفرشی) یافت شد که این بدین معنی است که بیان LC3 در نمونه‏هایی با NSCLC نوع آدنوکارسینوما نسبت به نوع سلول سنگفرشی افزایش بیش‏تری می‏یابد. گروهی از محققین بیان نموده‏اند که افزایش بیان LC3 با متاستاز غدد لنفاوی، رگ‏زایی ومتاستاز کبدی در ارتباط است و افزایش بیان LC3 باعث پیش‏آگهی ضعیف در سرطان پانکراس و ملانوما بوده‏ است (25). سایر محققین نیز در این زمینه مطالعاتی داشته‏اند از جمله: Masuda و همکاران (17) با روش ایمونوهیستوشیمی میزان بیان ژن LC3 را در 510 نمونه تومورری معده بررسی کردند و مشاهده کردند که میزان بیان این ژن در 79 نمونه از 510 نمونه افزایش یافته است و همچنین دریافتند که این افزایش بیان با متاستاز غدد لنفاوی، تهاجم عروقی و متاستاز کبدی مرتبط است. Huang  و همکاران (26) با روش ایمونوهیستوشیمی میزان بیان ژن LC3 را در کارسینومای غدد بزاقی در 74 بیمار مبتلا به کارسینوم غدد لنفاوی و 12 آدنومای پلئومورفیک و 18 نمونه ترمال بررسی کردند و افزایش بیان قابل توجهی را در این ژن مشاهده کردند و همچنین مشاهده کردند که این افزایش بیان با سرطان زایی و پیشرفت سرطان مرتبط است. Wu  و همکاران (18) نیز با روش ایمونوهیستوشیمی میزان بیان ژن LC3 را در سرطان روده‏ی بزرگ در 242 نمونه مورد بررسی قرار دادند و مشاهده کردند که میزان بیان این ژن در 20 درصد نمونه افزایش می‏یابد. این افزایش بیان با تمایز سلولی مرتبط است.

در واقع زمانی که بیان ژن Beclin-1 افزایش می‏یابد، به‫عنوان شروع کننده‏ی فرآیند اتوفاژی، باعث افزایش فرآیند اتوفاژی و همچنین افزایش بیان سایر ژن‏های موجود در این مسیر ازجمله LC3 می‏شود. از سویی دیگر در شرایط کمبود مواد مغذی و استرس، mTOR غیرفعال می‏شود، درنتیجه اثر مهاری آن از روی ULK1 برداشته شده و درنتیجه فعالیت ULK1 افزایش می‏یابد و باعث افزایش فرآیند اتوفاژی و افزایش بیان سایر ژن‏های موجود در این مسیر ازجمله LC3 می‏شود. همچنین ULK1 با تاثیری که به‫طور غیرمستقیم بر LC3 دارد باعث افزایش تبدیل LC3I به LC3II شده و درنتیجه باعث افزایش فرآیند اتوفاژی می‏شود. به‫همین دلیل افزایش فرآیند اتوفاژی و افزایش بیان ژن‏های درگیر در این مسیر در بافت‎های سرطانی به جهت تامین نیاز سلول در شرایط بحرانی قابل توجیه است (27).

همچنین همان‏طور که گفته شد براساس آنالیز داده‏ها ارتباط معنی‫‏داری (p<0.05) بین میزان افزایش بیان دو ژن،Beclin1  و LC3 باهمدیگر در بافت توموری NSCLC یافت شد (نمودار). این ارتباط بدین معنا است که افزایش بیانBeclin1  روی بیانLC3 نیز تاثیر می‏گذارد و باعث افزایش بیان آن نیز می‏شود، به این دلیل کهBeclin1  شروع کننده‏ی مسیر اتوفاژی است در نتیجه زمانی‏ که میزان بیان آن افزایش می‏یابد، فرآیند اتوفاژی آغاز می‏شود. انتظار می‏رود میزان بیانLC3  نیز به‫عنوان یکی از مهره‏های کلیدی در میانه‏ی این مسیر افزایش یابد.

درنهایت، با استفاده از بررسی میزان بیان سایر ژن‏هایی که در این مسیر فعالیت می‏کنند. بررسی عوامل موثر مانند microRNAها بر این ژن‏ها می‏توان زمینه را برای درمان‏های هدفمند فراهم کرد. همچنین با بررسی میزان بیان Beclin-1 و LC3 در سطح پروتئین می‏توان به‫طور قطع بیان کرد که بیان آن‏ها در فرآیند اتوفاژی افزایش یا کاهش می‏یابد.

 

 

نتیجه‫‫گیری

در تحقیق حاضر مشاهده گردید که میزان بیان دو ژن  Beclin-1 و LC3 در بافت سرطان سلول‏های غیرکوچک ریه نسبت به بافت نرمال مجاور آن افزایش قابل توجهی می‏یابند. این افزایش بیان ممکن است باعث افزایش فرآیند اتوفاژی شود و افزایش فرآیند اتوفاژی می‏تواند باعث توسعه‎ ی تومورزایی گردد که تایید این نتایج نیاز به تحقیقات بیش‏تر در این زمینه دارد.

 

تشکر و قدردانی

این مقاله بخشی از پایان‏نامه دانشجویی در مقطع کارشناسی ارشد می‏باشد که با حمایت دانشگاه آزاد اسلامی واحد ورامین-پیشوا به انجام رسیده است، بدین وسیله از کلیه‏ی افرادی که ما را در انجام این تحقیق یاری کردند تشکر و قدردانی می‏‫شود.

  1. Boolell V, Alamgeer M, David N, Ganju V. The Evolution of Thrapies in Non-Small Cell Lung Cancer. Cancer (Basel). 2015; 7(3): 1815-1846.
  2. Ettinger DS, Wood DE, Akerley W, Bazhenova LA, etal. . NCCN Guidelines Insights: Non-Small Lung Cancer, Version 4.2016 JNCCN 2016; 14(3): 255-264.
  3. Travis D, Brambilla E, Noguchi M, Nicholson A, etal. International Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society International Multidisciplinary Classification of Lung Adenocarcinoma.JTO. 2011; 6 (2): 244–285.
  4. Pillai RN, Owonikoko TK. Small Cell Lung Cancer: Therapies and Targets. SeminOncol .2014; 41(1): 133-142.
  5. Boolell V, Alamgeer M, David N, Ganju V. The Evolution of Thrapies in Non-Small Cell Lung Cancer. Cancer. 2015; 7(3): 1815-1846.
    1. Larsen JE, Minna, JD. Molecular Biology of Lung Cancer: Clinical Implications. Clin Chest Med. 2011; 32(4): 730-740
  6. Wang A, Kubo J, Luo J, Desai M, etal. ACtive and passive smoking in relation to lung cancer incidence in the women’s health initiative observational study prospeCtive cohort. Ann Oncol. 2015; 26(1): 221–30.
  7. Aita VM, Liang XH, Murty VV, Pincus DL, etal. Cloning and genomic organization of beclin 1, acandidate tumorsuppressor gene on chromosome 17q21. Genomics. 1999; 59(1): 59-65.
  8. Toton E, Lisiak N, Sawick M, Rybczynska M. Beclin-1 and it’s role as a target for anticancer therapy. J Physiol Pharmacol. 2014; 65(4): 459-467.

10.Eskelinen EL, Saftig P. Autophagy: a lysosomal degradation pathwaywith a central role in health and disease. BiochimBiophysActa. 2009; 1793(4): 664-73.

11. Yu L, Strandberg L, Lenardo MJ. The selectivity of autophagy and itsrole in cell death and survival. Autophagy .2008; 4(5): 567-73.

12. Bialik S, Kimchi A. Autophagy and tumor suppression: recentadvances in understanding the link between autophagic cell deathpathways and tumor development. AdvExp Med Biol. 2008; 615: 177-200.

13. Bialik S, Kimchi A. Autophagy and tumor suppression: recentadvances in understanding the link between autophagic cell deathpathways and tumor development. AdvExp Med Biol. 2008; 615: 177-200.

14. Kabeya Y, Mizushima N, Ueno T, etal. LC3, a mammalianhomologue of yeast Apg8p, is localized in autophagosome membranes after processing. Embo J. 2000; 19(21): 5720-8.

15. Klionsky DJ, Abeliovich H, Agostinis P, Agrawal DK, etal. Guidelines for the useand interpretation of assays for monitoring autophagy in highereukaryotes. Autophagy. 2008; 4(2): 151-75.

 

16. Yang Sun, MD, Zhi-Lan Peng. Autophagy, Beclin 1, and Their Relation To Oncogenesis. LABMEDICIN. 2008; 39(5): 287–290

17. Masouda G, Yashiro M, Kitayama K, Miki Y, etal. ClinicopathologicalCorrelations of Autophagyrelated Proteins LC3, Beclin 1 and p62 in GastricCancer. Anticancer Res. 2016; 36 (1): 129-136

18. Wu S, Sun C, Tian D, Li Y,Gao X, etal. Expression and clinical significances of Beclin-1, LC3 and mTOR in coloreCtal cancer. Int J ClinExp Pathol. 2015; 8(4): 3882-3891

19. Jiang L, Liang X, Liu M, Wang W, etal. Reduced expression of liver kinase B1 and Beclin-1 is associated with the poor survival of patients with non-small cell lung cancer. oncology reports .2014; 32(5): 1931-1938.

20. Zhou S, Zhao S, Kuang M, Zhang B, etal. Autophagy in tumorigenesis and cancer therapy: Dr. Jekyll or Mr. Hyde?. Cancer Lett. 2012; 323(2): 115–127.

21. Won KY, Kim GY, Lim SJ, Kim YW. Decreased Beclin-1 expression is correlated with the growth of the primary tumor in patients with squamous cell carcinoma and adenocarcinoma of the lung. Human pathology. 2012; 43:62-68.

22. Kabeya Y, Mizushima N, Ueno T, Yamamoto A, etal. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. The EMBO Journal. 2000; 19(21): 5720-5728.

23. Mathew R, Kongara S, Beaudoin B, Karp CM, etal. Autophagy suppresses tumorprogression by limiting chromosomal instability. Genes Dev. 2007; 21(11): 1367–1381.

24. Marino G, Salvador-Montoliu N, Fueyo A, Knecht E, etal. Tissue-specific autophagy alterations and increased tumorigenesis in mice deficient in atg4c/autophagin-3. JBiolChem. 2007; 282(25): 18573–18583.

25. Cao Q, Liu F, Yang Z, Fu X, etal. Prognostic value of autophagy related proteins ULK1, Beclin 1, ATG3, ATG5, ATG7, ATG9, ATG10, ATG12, LC3B and p62/SQSTM1 in gastric cancer. Am J Transl Res. 2016; 8(9): 3831-3847.

26. Huang C, Deng W, Zhang L, Zhang W, etal. Expression of LC3, LAMP2, KEAP1 and NRF2 in Salivary Adenoid Cystic Carcinoma. Pathol Oncol Res. 2016; 22(1): 109–114

27. Chen Y, He J, Tian M, Zang Y, etal. UNC51-like kiase 1, autophagic regulator and cancer therapeutic target. Cell Prolif. 2014; 47(6): 494-505.