بررسی میزان بقا، آپوپتوزیس و بیان ژنP75NTRدر سلول های بنیادی مشتق از بافت چربی به هنگام تمایزعصبی دربی‌وزنی شبیه‌سازی شده

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی، واحد علوم و تحقیقات فارس، گروه زیست شناسی، مرودشت، ایران

2 پژوهشگاه هوافضا، وزارت علوم، تحقیقات و فناوری، تهران، ایران

چکیده

هدف: در مطالعه حاضر اثر بی‌وزنی بر میزان مرگ و میر سلولی و بیان ژن p75NTR قبل و بعد از تمایز عصبی سلول‌های مزانشیمی مشتق از بافت چربی بررسی شد.
مواد و روشها:در این مطالعه ابتدا سلول‌های بنیادی مزانشیمی ‌از بافت چربی جدا و کشت و تمایز داده شد. دستگاه کلینواستت تک محوره برای شبیه‌سازی بی‌وزنی به‏مدت 6، 24 و 72 ساعت استفاده شد. از سلول‌ها استخراج RNA صورت گرفت و تغییرات بیان ژن‌ با تکنیک Real-time PCR بررسی شد. میزان زنده بودن سلول‌ها با روش MTT  و میزان آپوپتوزیس با تست انکسین اندازه‌گیری شد.
نتایج: نتایج ما نشان داد که بی‌وزنی به‏طور قابل توجهی منجر به کاهش میزان بیان p75NTR در سلول‌های مزانشیمی شد. بی‌وزنی تاثیر معنی‌داری بر میزان زنده بودن سلول‌ها قبل و بعد از القای تمایز به سلول‌های شبه عصبی نداشت؛ اما میزان آپوپتوزیس را در سلول‌های تمایزنیافته در مقایسه با نمونه‌های کنترل کاهش داد.
نتیجه‌گیری: با توجه به کاهش میزان مرگ و میر و افزایش پتانسیل تمایزی سلول‌ها، بی‌وزنی می‌تواند به‏عنوان ابزاری قدرتمند و محیط جدیدی برای کشت و تمایز سلول‌های عصبی و دستیابی به درمان‌هاى پیوند موفق‌ترمعرفی شود.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

توانایی سیستم عصبی پستانداران بالغ برای جایگزین‌کردن نورون‌های آسیب‌دیده و ترمیم ضایعات عصبی بسیار محدود می‌باشد. علی‌رغم وجود سلول‌های بنیادی عصبی در مناطق محدودی از سیستم عصبی مرکزی در افراد بالغ، توانایی این سلول‌ها برای ترمیم بافت‌های آسیب دیده ناچیز می‌باشد(1).  در چند دهه اخیر، پیوند سلول‌های شبه عصبی حاصل از تمایز سلول‌های بنیادی جنینی یا بالغ به‏عنوان ابزار قدرتمندی جهت درمان ضایعات سیستم عصبی مورد توجه بوده است(2-4). پیوند موفقیت آمیز این سلول‌ها در محل ضایعه بستگی به زنده ماندن طولانی مدت این سلول‌ها و فعالیت صحیح آن‌ها در محل جدید دارد. این واقعیت که اغلب این سلول‌های شبه عصبی قبل یا بعد از پیوند دچار مرگ می‌شوند. استفاده‌ی بالینی آن‌ها را با مشکل مواجه ساخته است(5). بنابراین یکی از چالش‌های مهم بالینی، جلوگیری از مرگ نورون‌ها یا سلول‌های گلیالی حاصل از تمایز نورونی سلول‌های بنیادی می‌باشد.

در سال‌های اخیر، سلول‌های بنیادی مزانشیمی به‏صورت گسترده‌ای جهت جایگزینی سلول‌های عصبی و ترمیم ضایعات عصبی هم باهدف پیوند برای فرد دهنده (پیوند اتولوگ) و هم با هدف پیوند در بیماران دیگر استفاده شده است(6 و 7). فعالیت سلول‌های پیوند شده در محل ضایعه عصبی، بستگی به زنده ماندن طولانی مدت این سلول‌ها دارد. یکی از مشکلاتی که در استفاده از سلول‌های شبه عصبی حاصل از تمایز سلول‌های بنیادی مزانشیمی برای ترمیم ضایعات سیستم عصبی مرکزی وجود دارد. مرگ اکثر این سلول‌ها به دنبال تمایز نورونی آنها می‌باشد(5). نوروتروفین‌ها از مهمترین فاکتورهای رشد در سیستم عصبی می‌باشند که نقش کلیدی در بقا و مرگ سلول‌های عصبی دارند. این پروتئین‌ها نقش خود را از طریق دو نوع گیرنده، گیرنده اختصاصی Trk(TrkA, TrkB, TrkC) و گیرنده عمومی (p75NTR) اعمال می‌نمایند(8). اتصال اعضای خانواده نوروتروفین‌ها به گیرنده اختصاصی خود، موجب بقای سلول‌های عصبی هدف می‌شوند. این در حالی است که درسلول‌های فاقد گیرندهTrk ، اتصال نوروتروفین‌ها به گیرنده عمومی p75NTR بیشتر از آنکه از مرگ نورون‌ها جلوگیری کند،آنرا تشدید می‌کند. گیرنده p75NTR مسیر‌های متعددی از جمله NFқB و کیناز JUN را فعال می‌کند.  فعال شدن مسیر NFқB موجب زنده ماندن نورون‌های حسی و سمپاتیک جنینی می‏شوند، اما فعال شدن مسیر کیناز Jun می‌تواند با به‌کارگیری پروتئین P53 و افزایش بیان لیگاند Fas، موجب بروز آپوپتوزیس در سلول شود(9). نکته جالب توجه این است که مشخص شده است که بیان ژن p75NTR در سلول‌های شبه عصبی حاصل از تمایز سلول‌های بنیادی مزانشیمی هم‏زمان با رخداد مرگ سلولی برنامه ریزی شده (آپوپتوزیس) در سلول‌های کشت داده شده می‌باشد(10) به‌گونه‌ای‌که مهار بیان این ژن، موجب کاهش آپوپتوزیس در این سلول‌ها می‌شود(11).

در سال‌های اخیر، نیروهای بیوفیزیکی مانند جریان، تنش برشی و جاذبه به طور فزاینده‌ای به‏عنوان یک روش کشت و دست‏کاری سلول‌ها به تنهایی و یا همراه با تکنیک‌های بیوشیمیایی مورد توجه قرار گرفته است. جاذبه، یکی از مهم‏ترین نیروهای محیطی است که در طول حیات در تکامل موجودات زنده موثر بوده است. حذف این نیرو و مطالعه سلول‌ها در شرایط بی‌وزنی می‌تواند منجر به روشن شدن بسیاری از سوالات علم زیست شناسی و حتی بهبود کیفیت زندگی بشر بر روی زمین شود (12). مطالعات نشان داده است که بی‌وزنی می‌تواند تمایز، تکثیر سلولی و رشد سلول را تحریک کرده و منجر به رشد سه بعدی سلول، بدون نیاز به داربست شود که این امر در مهندسی بافت و ارگان بسیار حائز اهمیت می‌باشد(13-15).  علاوه بر این مشخص شده است که بی‌وزنی می‌تواند تمایز سلول‌های بنیادی را تسریع نماید(16). مطالعات قبلی نشان داده است که بی‌وزنی تاثیر مثبت بر تمایز نورونی سلول‌های بنیادی مزانشیمی دارد به‌گونه‌ای‌که بی‌وزنی منجر به افزایش تمایز سلول‌های مزانشیمی به سلول‌های شبه عصبی و افزایش بیان نوروتروفین‌ها در این سلول‌ها می‏شود (17و18). شرایط بی‌وزنی را می‌توان با پرواز‌های فضایی یا سقوط آزاد ایجاد کرد. به‏دلیل محدودیت در سفر‌های فضایی و کوتاه بودن طول مدت بی‌وزنی در سقوط آزاد، روش‌هایی برای شبیه‌سازی شرایط بی‌وزنی بر روی زمین توسعه یافته است که از بین آن‏ها دستگاه کلینواستت تک محوره، وسیله مفیدی برای شبیه‌سازی بی‌وزنی برای سلول‌ها است(12). با توجه به مطالب گفته شده، هدف از مطالعه حاضر بررسی اثر بی‌وزنی بر میزان مرگ و میر سلولی و بیان ژن p7NTR5  قبل و بعد از تمایز عصبی سلول‌های مزانشیمی مشتق از بافت چربی (Adipose derived stem cells=ADSC) می‌باشد.

 

مواد و روش‌ها

مطالعه حاضر از نوع مداخله‌ای آینده‌نگر بوده و در آزمایشگاه زیست شناسی، پژوهشگاه هوافضا از تاریخ 1393 تا 1395به انجام رسیده است. بافت چربی از 2 زن سالم (34 و 48 سال) مراجعه کننده به مرکزپزشکی لیزر دانشگاه  تهران (ACECR) و با رضایت افراد اهدا کننده طی عمل لیپوساکشن به‏دست آمد. بافت چربی به‏دست آمده تحت شرایط کاملا استریل به آزمایشگاه تحقیقاتی پژوهشگاه هوافضا منتقل شد. کد اخلاق IR.ACECR.ROYAN.REC.1395.54 بود. 

استخراج سلول‌های بنیادی مشتق از چربی و اثبات مزانشیمی بودن آن‌ها:به‏منظور حذف سلول‌های خونی، نمونه‌های بافت چربی جدا شده و در داخل فالکون50 میلی‏لیتر استریل منتقل شد و چندین بار توسط بافر فسفات سالین شستشو داده شد. سپس نمونه‌ها با محلول HBSS (Hank's Balanced Salt Solution; Biowest, France) شسته شد و برای جداسازی سلول‌های بنیادی مورد استفاده قرار گرفتند.

جداسازی سلول‌های بنیادی درآزمایشگاه مطابق روش زاک و همکاران (19) انجام شد. ابتدا به منظور هضم بافت چربی، هم حجم بافت چربی آنزیم کلاژناز نوع 1A (Sigma, USA) اضافه شد و مخلوط به‏مدت 60 دقیقه در دمای 37 درجه سانتی‏گراد انکوبه شد. برای خنثی کردن آنزیم، هم حجم مخلوط، محیط کشت  DMEM (Dulbecco's Modified Eagle Medium; Biowest, France ) به‏همراه 10 درصد سرم گاوی (FBS; Biowest, France) اضافه شد و سپس با دور g400 به‏مدت 10 دقیقه سانتریفیوژ شد. رسوب سلولی به‏دست آمده در محیط کشت DMEM حاوی 10درصد سرم و 1 درصد آنتی بیوتیک‌های پنی سیلن/ استرپتومایسن یک درصد  و 25 نانوگرم بر میلی‌لیتر آمفوتریسین بی (amphotericin B) (Biowest, France) حل شد و در فلاسک T25 (TPP, Switzerland) در انکوباتور 37 درجه سانتی‏گراد با 5 درصد گاز دی اکسید کربن کشت داده شد. روز بعد محیط کشت تعویض شد. به هنگام تعویض محیط، سلول‌ها توسط فسفات بافر سالین استریل شسته شدند. سلول‌هایی که به کف ظرف پلاستیکی نچسبیده بودند با تعویض محیط از ظرف خارج شدند. تعویض محیط هر دو روز یک بار و تا تخلیه‌ی کاملسلول‌های خونی وبقایای سلولی انجام شد پس از پرشدن بیش از80  درصد کففلاسک، پاساژ دهی با آنزیم تریپسین –EDTA 05/0 درصد (Biowest, France)  انجام شد و شمارش سلولی توسط لام هماتوسایتومتر انجام شد. بعداز سه تا چهار پاساژ، سلول‌ها برای آنالیز‌های بعدی مورد استفاده قرار گرفتند. همچنین سلول‌ها از ابتدا، روزانه از نظر شکل ظاهری و شرایط عمومی توسط میکروسکوپ بررسی شدند. جهت اثبات مزانشیمی بودن سلول‌های استخراج شده، روش فلوسایتومتری و تمایز به دو رده استخوان و چربی انجام شد(18). در روش فلوسایتومتری آنتی ژن‌های سطحی CD90 ، CD105 و CD73 به‌عنوان مارکرهای مثبت و CD34 و CD45 به‌عنوان مارکرهای منفی بررسی شدند و نمونه‌ها با استفاده از دستگاه فلوسایتومتری Cyflow Space (Partec, Germany) و نرم افزار FloMax (version 2.70) آنالیز شدند(20).

برای بررسی پتانسیل تمایزی سلول‌ها، از کیت تمایزیHuman Mesenchymal Stem Cell Functional Identification (R&D systems, USA) و مطابق دستورالعمل کیت استفاده شد. به‏طور خلاصه پس از کشت سلول‌ها در پلیت‌های 96 خانه‌ای، محیط تمایز به چربی (α-MEM ، 10 درصد سرم، 5/0 میکرومول ایزوبوتیل متیل زانتین، 1 میکرومول دگزامتازون و 60 میکرومول ایندومتاسین) و یا محیط تمایز به استخوان (α-MEM ،10 درصد سرم،  50 میکرگرم بر میلی لیتر اسکوربیک فسفات و10 میکرومول βگلیسرول فسفات) به‏ترتیب برای تمایز به چربی و استخوان به سلول‌ها اضافه شد. پس از 7 الی14 روز، آدیپوسیت‌ها تثبیت شده و با رنگ Oil-Red O برای تایید تمایز آدیپوژنیک رنگ آمیزی شدند. نواحی که به سلول‌های چربی تمایز پیدا کرده بودند به‏ علت واکنش تری‌گلیسیریدهای موجود درسلول‌های تمایزیافته با رنگ Oil Red به‏رنگ قرمز درآمدند و با میکروسکوپ نوری مشاهده شدند. برای بررسی تمایز به سلول‌های استخوانی، پس از 21 روز سلول‌ها با   Alizarin Red Sرنگ آمیزی شدند. سلول‌های تمایزیافته به استخوان به‏ علت وجود رسوباتکلسیمی در حضور این رنگ به ‏رنگ قرمز درآمدند(20).

تمایزسلول‌هایبنیادیمشتقازبافتچربیبه سلول‌های شبه عصبی:تمایز عصبی براساس پروتکل  قبلی ما انجام شد(20). به‏طور خلاصه، ابتدا سلول­های بنیادی مشتق از چربی درفلاسکcm2  ۲۵کشت داده شدند. زمانی که رشد سلول‌ها به حدود 70 تا 80 درصد رسید، سلول‌ها به پلیت‌های 96 خانه منتقل شد. پس از چسبیدن سلول‌ها به کف ظرف، محیط کشت عوض شد و به همه آن‌ها 250میکرولیتر محیط پیش القا (محیط کشت کامل تازه دارای۱۰ نانوگرم بر میلی‏لیتر بتا مرکاپتواتانول) افزوده شد. پس از 24 ساعت محیط پیش القا خارج شده و محیط القائیNIM  (Neural Induction Medium ) اضافه شد. سلول‌ها در زمان‌های مختلف زیر میکروسکوپ بررسی شده و درساعات  6، 24 و 72 ساعت پس از القا، سلول‌ها جهت استخراج RNA لیز و یا این که جهت مطالعات دیگر استفاده شد .به‏جز تعویض محیط کشت معمولی هیچ تغییر دیگری روی نمونه‌های کنترل اعمال نشد. محیط القاکننده عصبی شامل مواد زیر بود: محیط کشت MEMα-، bFGF(ng/ml10)، butylatedhydroxyanisole (µM100) (Sigma)، Forskolin (µM10) (Sigma)، KCl (mM25)، valporic acid (mM2) ( شرکت داروسازی رازک، تهران) و انسولین انسانی regular (µg/ml5) (داروسازی لرستان، ایران).

تیمار بی‌وزنی:تمامی نمونه‌های مورد مطالعه (تمایز نیافته و تمایز یافته) شامل دو گروه بودند: سلول‌های کنترل (G1یا بدون بی‌وزنی) و نمونه‌های بی‌وزنی (6 ساعت، 24 ساعت و 72 ساعت). میزان بی‌وزنی G001/0 بود. برای ایجاد بی‌وزنی از دستگاه کلینواستت تک محوره در پژوهشگاه هوافضا که از سازمان ملل گرفته شده بود، استفاده شد. چرخش دستگاه به صورتی است که جاذبه برای سلول‌ها قابل تشخیص نیست.

مراحل ایجاد بی‌وزنی به شرح زیر بود: دستگاه کلینواستت پس از استریل کردن توسط نور ماورای بنفش و الکل 70 درصد، در داخل انکوباتور کشت سلولی قرار داده شد. دور دستگاه کلینواستت بر روی rpm10 تنظیم شد و سپس پلیت بر روی صفحه کلینواستت توسط چسب دوطرفه چسبانده شد (پلیت باید به نحوی بر روی صفحه کلینواستت قرار گیرد که خانه‌های حاوی سلول در مرکز صفحه قرار گیرد تا میزان جی وارده بر سلول‌ها 001/0 باشد). دستگاه را روشن کرده و در زمان‌های 6، 24 و 72 ساعت دستگاه را قطع کرده و نمونه‌ها جهت استخراج RNA خارج شدند. لازم به ذکر است نمونه‌های کنترل همزمان در داخل انکوباتور و خارج از کلینواستت قرار گرفتند. همچنین ازآنجا که خانه‌ها پر از محیط کشت شده و درب آن محکم بر روی پلیت قرار می‌گرفت، امکان تبادل گاز دی اکسیدکربن وجود نداشت. برای حل این مشکل از HEPES 15 میلی مولار استفاده شد که به محیط کشت اضافه شد. کلیه آزمایشات 3 بار تکرار شد. 

آنالیز بیان ژن به روش Real- time PCR:میزان بیان گیرنده p75NTR قبل و بعد از القا تمایز عصبی و نیز قبل و بعد از تیمار بی‌وزنی توسط Real-time quantitative PCR بررسی شد.RNA  تام سلولی از سلول‌های تمایز داده شده و تمایز داده نشده با استفاده از کیت استخراج RNA (Cell AmpTM Direct RNA Prep Kit for RT-PCR; Takara, Japan) استخراج شد و بلافاصله در نیتروژن مایع فریز شد و در دمای 75- درجه سانتی‏گراد تا زمان استفاده نگه‏داری شد. یک میکروگرم از RNA تام برای سنتزcDNA و با استفاده از کیتPrime ScriptTM RT reagent  (Takara, Japan)در حجم واکنش 20 میکرولیتر و مطابق پروتکل شرکت سازنده استفاده شد. جهت تکثیر ژن‌های P75NTR و رفرانس، واکنش Real time PCR با استفاده از 2 میکرولیتر از محصول cDNA، پرایمرهای مخصوص هر ژن (جدول 1)، کیت  SYBR Green Real Time Master Mix  (Takara, Japan) و دستگاه StepOnePlus Real-Time PCR (Applied Biosystems, USA) انجام شد.  شرایط دمایی مورد استفاده شامل یک مرحله فعال سازی اولیه در دمای 94 درجه سانتی‏گراد به‏مدت 2 دقیقه و در ادامه 40 سیکل به‏صورت 5 ثانیه در دمای  95 درجه سانتی‏گراد برای دناتوراسیون و 30 ثانیه در دمای 60 درجه سانتی‏گراد برای گسترش هم‏زمان بود. برای اطمینان از اختصاصی بودن محصولات، منحنی ذوب برای ژن‌ها بعد از انجام واکنش Real time PCR رسم شد. میزان بیان ژن با روش کمی نسبی و تعیین ΔΔCT و استفاده از فرمول
 –ΔΔCT2 محاسبه گردید. ازGAPDH  به‏عنوان  ژن رفرانس استفاده شد. بیان نسبی با استفاده از نرم افزار REST 2009 (Version 2.0.13) اندازه‏گیری شد. پرایمرهای اختصاصی با نرم افزار OLIGO7 طراحی شد و توسط شرکتMacrogen (South Korea) سفارش داده شد. توالی پرایمرها در جدول 1 آورده شده است.

 

 

جدول1: ترادف و مشخصات پرایمرهای به کار گرفته شده در این مطالعه

نام ژن

RefSeqشماره

توالی پرایمر(5 به 3)

طول محصول PCR (bp)

GAPDH

NG_007073.2

Forward: GGAAGGTGAAGGTCGGAGTCA

Reverse: TCATTGATGGCAACAATATCCACT

101

 

P75NTR

NM_002507.3

Forward :  ACCACCGACAACCTCATCC

Reverse :  TGTTGGCTCCTTGCTTGTTCT

121

 

 

 

تست MTT: برای بررسی میزان زنده بودن سلول‌ها و یا بررسی فعالیت متابولیسمی سلول‌ها از کیت MTT شرکتATOCEL  به شمارهABM21-P1  استفاده شد. برای این‏منظور ابتدا سلول‌ها به تعداد 50 هزار در هر چاهک پلیت 96 خانه کشت داده شدند. سلول‌ها به‏مدت 3 روز در شرایط بی‌وزنی کشت شدند. پس از آن به هر چاهک، 20 میکرو لیتر محلول MTT (10 میلی‌گرم بر میلی‌لیتر) اضافه شد. سپس نمونه‌ها برای مدت 3 تا 4 ساعت در انکوباتور قرار داده شد تا رسوب بنفش ظاهر شود. بعد از آن محیط به آرامی خارج شد و 200 میکرو لیتر دی متیل سولفوکساید(DMSO) به هر چاهک اضافه و پیپتاژ انجام شد. در نهایت جذب نوری درطول موج 570 نانومتر توسط دستگاه الایزا ریدر خوانده شد. سپس میزان زنده بودن سلول ها با کمک منحنی استاندارد به درصد محاسبه شد.

تست انکسین: برای تشخیص سلول‌های در حال آپوپتوزیس در یک جمعیت سلولی (و نه در بافت) از کیت Annexin-V-FlUOS Staining kit استفاده شد. این کیت امکان تشخیص و تمیز دادن سلول‌های در حال آپوپتوزیس را از سلول‌های نکروزیس میسر می‌سازد. بدین‏منظور محیط کشت سلول‌ها در یک ظرف تمیز تخلیه و نگه‏داری شد و سطح سلول‌ها دو مرتبه با PBS شستشو داده شد. سپس سلول‌ها تریپسینه شدند تا به‏طور کامل از کف فلاسک جدا شوند. محیط روئی به سوسپانسیون سلولی اضافه شد. سوسپانسیون سلولی در دور g200 به‏مدت 6 دقیقه در دمای محیط سانتریفیوژ شد. محلول روئی تخلیه شد و رسوب در 5/0 میلی لیتر PBS حل شد. سپس 5/4 میلی لیتر اتانول 70 درصد سرد به نمونه‌ها افزوده شد و به‏شدت پیپتاژ شد. سلول‌های تثبیت شده در دور g200 به‏مدت 6 دقیقه در دمای محیط سانتریفیوژ شدند. محلول روئی تخلیه شد و رسوب در 5 میلی‏لیتر بافر PBS حل شد. مجددا سلول‌ها در دور g200 به‏مدت 6 دقیقه در دمای محیط سانتریفیوژ شدند. محلول رویی تخلیه شد. در نهایت 20 میکرولیتر ماده Annexin-V-Fluos در 1 میلی‏لیتر بافر انکوباسیون حل شد و به آن 20 میکرولیتر محلول پروپیدیوم آیوداید(PI)اضافه شد. 100 میکرولیتر از محلول حاصل به سلول‌های آماده شده افزوده شد. سلول‌ها برای مدت 15 دقیقه در دمای 15 تا 25 درجه سانتی‌گراد انکوبه شدند و جهت آنالیز وارد دستگاه فلوسایتومتری شدند.

 

آنالیز آماری

آنالیز آماری اطلاعات به دست آمده شامل درصد بیان مارکرهای سطحی در سلول‌های بنیادی مشتق از بافت چربی و درصد بیان مارکرها در سلول‌های عصبی و درصد مرگ و میر سلولی و نیز میزان زنده مانی سلول‌ها، توسط آزمون آماری آنالیز واریانس یک‏طرفه (ANOVA) و آزمون Tukey و همچنین آزمون غیر پارامتریک Mann–Whitney  به‏وسیله نرم افزار  SPSSversion15 انجام شد. سطح معنی دار 05/0p< درنظر گرفته شد.

 

نتایج

مشخصات فنوتیپی ADSC و تغییرات مورفولوژیکی در طی القای عصبی

پس از استخراج و کشت ADSC‌ها، آن‏ها به کف پلاستیکی فلاسک‌های کشت چسبیدند و جمعیتی از سلول‌های هتروژن با مورفولوژی سلول‌های دوکی شکل را نشان دادند که در بین آن‏ها تعداد کمی قطرات چربی هم دیده می‌شد. ADSC‌ها به‏سرعت در انکوباتور تکثیر می‌شدند و تقریبا پس از گذشت دو پاساژ از کشت اولیه، آن‏ها شامل جمعیتی هموژن با مورفولوژی فیبروبلاست مانند شدند(شکل 1،A). آنالیز فلوسایتومتری در پاساژ 2 نشان داد که بیش از 95 درصد سلول‌ها ماهیت مزانشیمی داشتند. و برای مارکرهای CD90، CD73 و CD105 مثبت بودند در حالی‏که برای مارکرهای هماتوپویتیک CD34 و CD45 منفی گزارش شدند(20). همچنین استفاده از محیط القایی تمایز به چربی و استخوان و رنگ آمیزی با رنگ‌های Oil Red O و Alizarin Red S اثبات کرد که سلول‌های استخراج شده بنیادی بوده و پتانسیل تمایز به رده‌های مختلف سلولی را دارا هستند(20).

پروتکل اجرا شده برای القای تمایز شامل دو مرحله پیش تمایزی و تمایز بود. پس از قرار دادن ADSC‌ها در معرض محیط پیش-القایی، مورفولوژی سلول‌های ADSC تغییر پیدا نکرد. اما به فاصله دو تا سه ساعت پس از قرار گرفتن در محیط تمایزی NIM سلول‌ها شروع به تغییر شکل به‏سمت سلول‌های شبه عصبی نمودند. به این ترتیب که ابتدا سیتوپلاسم و جسم سلولی پهن و گسترده و چند وجهی شد و سپس زوائد سلولی شبیه دندریت و اکسون ظاهر شدند(شکل 1،B و C). این تغییرات مورفولوژیکی مطرح کننده تمایز عصبی در مدت زمان کوتاهی پس از القاء بود که همچنان نیز ادامه داشت به‏طوری‏که 12 ساعت پس از القاء تقریبا 90 درصد سلول‌ها مورفولوژی شبه نورونی داشتند.

 

 

 

شکل1: استخراج و تمایزعصبی سلول‌هایADSC  . فنوتیپ سلول‌ها پس از اضافه کردن محیط کشت القایی شروع به تغییر می‌کند. A) سلول‌های تمایز نیافته (×100) (B سلول‌های شبه عصبی 12 ساعت پس از القاء تمایز (×100). C): سلول‌های شبه عصبی 24 ساعت پس از القاء تمایز (×100). جسم سلولی مدور بزرگ و زوائد دندروتیک مانند ظاهر شده است.

 

 

آنالیز بیان ژن

برای بررسی اثر بی‌وزنی بر بیان ژن P75NTR، ADSC‌ها پس از 6، 24 و 72 ساعت تیمار بی‌وزنی توسط کلینواستت جمع‌آوری شدند. سلول‌های شبه عصبی نیز بعد از 6 ، 24 و 72 ساعت تیمار بی‌وزنی توسط کلینواستت جمع آوری شدند. برای اندازه‌گیری تغییرات میزان بیان از واکنش Real time PCR استفاده شد. نتایج نشان داد که ژن p75NTR هم قبل از تمایز و

 

هم بعد از آن در سلول‌های استخراج شده بیان می‌شود. به‏دنبال تیمار بی‌وزنی کاهش تدریجی و مشخصی در بیان ژن P75NTR دیده شد. به‏طوری‏که بی‌وزنی منجر به کاهش بیان ژن p75NTR (در حدود 40 درصد) در مقایسه با نمونه کنترل پس از 72 ساعت در سلول‌های تمایزنیافته شد. پس از القای تمایز، بیان ژن p75NTR در نمونه‌های بی‌وزنی در مقایسه با نمونه کنترل (1G) اختلاف معنی‌داری را نشان نداد (05/0p>)(شکل 2).

 

 

 

 

 

شکل 2: بیان ژن p75NTR در  6 ساعت و 24 ساعت و 72 ساعت بعد از تیمار بی‌وزنی در گروه بی‌وزنی در مقایسه با گروه نرمال زمینی. بیان ژن‌ها با ژن رفرانس GAPDH نرمالایز شده است. بی وزنی منجر به کاهش معنی‏دار  بیان ژن p75NTR در مقایسه با نمونه کنترل در سلول‏های تمایزنیافته شد. بیان ژن p75NTR در نمونه‏های بی وزنی در مقایسه با نمونه کنترل (1G) پس از القای تمایز، اختلاف معنی‏داری را نشان نداد. 05/0p< به‏عنوان سطح معنی‏دار در نظر گرفته شده است.

 

تست MTT

ارزیابی توانایی زنده ماندن سلول‌ها پس از گذشت 72 ساعت از کشت سلول‌ها در شرایط بی‌وزنی و نرمال زمینی

قبل و بعد از القای تمایز عصبی با استفاده از تست MTT انجام شد. همان‏طور که در شکل 3 نشان داده شده است،

 

بی‌وزنی تاثیر معنی‌داری بر میزان زنده بودن سلول‌ها قبل و بعد از القای تمایز به سلول‌های شبه عصبی نداشته است(05/0p>). اگرچه بعد از تمایز میزان زنده بودن سلول‌ها در هر دو گروه کاهش یافت(3/38 درصد).

 

 

 

شکل 3: میزان زنده بودن ADSC‌های کشت داده شده در شبیه سازی بی‌وزنی(SMG)، قبل و بعد از القای تمایز عصبی با استفاده از سنجش MTT. همانطور که مشخص است شبیه سازی بی‌وزنی اثری بر میزان زنده بودن سلول‌های تمایز داداه شده و تمایز داده نشده نداشته است. NLC: سلول‌های شبه عصبی پس از 24 ساعت تمایز

 

 

تست انکسین

برای بررسی میزان مرگ برنامه ریزی شده سلولی (آپوپتوزیس) قبل و بعد از تمایز در دو شرایط نرمال زمینی و بی‌وزنی از تست انکسین استفاده شد. شکل 4 نتایج تست انکسین را نشان می‌دهد. در این شکل مشاهده می‌شود که در سلول‌های تمایز نیافته‌ای که در شرایط نرمال زمینی قرار گرفته بودند، میزان نکروزه شدن سلول‌ها 47/15 درصد، میزان آپوپتوزیس اولیه 34/2  درصد و میزان آپوپتوزیس دیر هنگام 37/12 درصد بود. بنابراین به‏طور کلی 71/14 درصد سلو ل‌ها پس ازگذشت 24 ساعت دچار آپوپتوزیس شدند. اما در سلول‌های تمایز نیافته‌ای که در شرایط بی‌وزنی قرار گرفته بودند، میران نکروزه شدن سلول‌ها 85/5 درصد، میزان آپوپتوزیس اولیه 26/2 درصد و میزان آپوپتوزیس دیر هنگام 03/3 درصد بود و در نهایت 29/5 درصد سلول‌ها پس ازگذشت 24 ساعت دچار آپوپتوزیس شدند. بنابراین بی‌وزنی به‏طور معنی‌داری میزان آپوپتوزیس را در سلول‌های تمایزنیافته در مقایسه با نمونه‌های کنترل کاهش داد.

در سلول‌های تمایز یافته‌ای که در شرایط نرمال زمینی قرار گرفته بودند، میران نکروزه شدن سلول‌ها 42/42 درصد، میزان آپوپتوزیس اولیه 86/7 درصد و میزان آپوپتوز دیر هنگام 82/15 درصد بود و در کل میزان  68/23 درصد سلول‌ها پس ازگذشت 24 ساعت دچار آپوپتوزیس شدند. در سلول‌های تمایزنیافته‌ای که در شرایط تیمار بی‌وزنی  قرار گرفته بودند، میزان نکروزه شدن سلول‌ها 73/45 درصد، میزان آپوپتوزیس اولیه 55/8 درصد و میزان آپوپتوزیس دیر هنگام 69/17 درصد بود. بنابراین به‏طور کلی 24/26 درصد سلول‌ها پس ازگذشت 24 ساعت دچار آپوپتوزیس شدندکه اختلاف معنی‌داری با نمونه‌های کنترل تمایز یافته نداشت.

 

 

شکل 4: اندازه‌گیری میزان آپوپتوزیس با استفاده از تست انکسین V.A) ADSC  در شرایط زمینی، B) ADSC در بی‌وزنی ، C) سلول‌های تمایز یافته بعد از 24 ساعت تیمار در شرایط زمینی،D) سلول‌های تمایز یافته بعد از24ساعت تیمار در بی‌وزنی. بی‌وزنی میزان آپوپتوزیس در سلول‌های تمایزنیافته را به‏طور معنی‌داری در مقایسه با نمونه‌های کنترل کاهش داد. میزان آپوپتوزیس در نمونه‌های تمایز یافته اختلاف معنی‌داری با کنترل نداشت.

 

بحث

جاذبه یکی از مهم‏ترین نیروهای فیزیکی است که در طول حیات در تکامل موجودات زنده موثر بوده است. حذف این نیرو و مطالعه سلول‌ها در شرایط بی‌وزنی می‌تواند منجر به روشن شدن بسیاری از سوالات علم زیست شناسی و حتی بهبود کیفیت زندگی بشر بر روی زمین شود (12). مطالعات نشان داده است که بی‌وزنی می‌تواند تمایز، تکثیر سلولی و رشد سلول را تحریک کرده و منجر به رشد سه بعدی سلول‌ها بدون نیاز به داربست شود که این امر در مهندسی بافت و ارگان بسیار حائز اهمیت می‌باشد (13-15). تاثیر بی‌وزنی بر روی رفتار سلول‌ها، مسیرهای پیام رسانی، تکثیر سلولی و بیان ژن‌ها در مقالات مختلفی بررسی شده است(21-24). در این مطالعه ما به بررسی اثر بی‌وزنی بر میزان مرگ برنامه ریزی شده سلولی (آپوپتوزیس) وابسته به گیرنده p75NTR در سلول‌های بنیادی مشتق از چربی و نیز در سلول‌های شبه عصبی حاصل از تمایز آنها پرداختیم. گیرنده نوروتروفینى p75NTR از اعضاى گیرنده‌هاى مرگ می‌باشد ولى برخلاف نامش هم در مرگ و هم در بقاى سلول‌هاى مختلف عصبى ایفاى نقش می‌کند. عملکرد غیرمعمول، نقش  دوگانه و پیچیدگى تعاملات و مسیرهاى سیگنالى وابسته به این گیرنده، آنرا کاندید مطالعات بیانی هم در سطح ژن و هم در سطح پروتئین در بسیاری از بیماری‌هاى عصبی نموده است. باوجود مطالعات زیادى که برروى نقشp75NTR  در شرایط مختلف انجام شده است، هنوز مکانیسم‌هاى اساسى فعال‌سازى این گیرنده و مولکول‌ها و مسیرهاى سیگنالى وابسته به آن به‌خوبى شناخته نشده‌اند. باوجود ابهاماتى که درمورد چگونگى عملکرد و اثرات p75NTR در بیماری‌هاى مختلف عصبى مشاهده می‌شود، این امکان وجود دارد که بتوان با ایجاد یک تعادل مناسب بین  p75NTR و گیرنده‌هاى نوروتروفینى تیروزین کینازى به‌ویژه TrkA، درمان احتمالى براى بسیارى از بیماری‌هاى عصبى ازجمله آلزایمر، پارکینسون و ضایعات نخاعى معرفى کرد.

نوروتروفین‌ها به‏وسیله اتصال به گیرنده‌های Trk از خانواده تیروزین کینازها و گیرنده p75NTR اثر خودشان را اعمال می‌کنند(1و2). گیرنده p75NTR نقش‌های متفاوتی در سلول‌های متفاوت دارد. برای مثال، بقای بعضی از نوروتروفین‌ها را در پاسخ به فاکتور رشد عصبی (NGF) بالا می‌برد(3) اما در بعضی دیگر از انواع سلول‌ها و نورون‌ها پاسخ سایتوکاینی را به NGF واسطه‌گری می‌کند(5، 6، 8-10).

زمان بیان گیرنده‌ها و نوع فاکتورهایی که به‏عنوان لیگاند گیرنده نقش بازی می‌کنند، کلیداصلی فعالیت گیرنده‌های سطح سلولی است. بنابراین میزان، نوع و زمان حضور نوروتروفین‌ها سبب فعالیت‌های مختلف و بعضا متضاد گیرنده‌ها می‌شود(25). گیرنده p75NTR در طی تکوین مغز بسیار بیشتر از زمان بلوغ بیان می‌شود(26و27). همچنین مطالعات نشان داده است که پس از آسیب سیستم عصبی بیان این گیرنده در جمعیت‌های نورونی به‏ویژه نورون‌هایی که دچار آپوپتوزیس شده‌اند، افزایش می‌یابد. بنابراین می‌توان نتیجه‌گیری کرد که در این شرایط نوروتروفین‌ها موجب القای مرگ سلولی از طریق مکانسیم وابسته به p75NTR می‌شوند(28 و 29).

به‏طور کلی فعال شدن گیرنده p75NTR در غیاب مسیرهای سیگنالینگ Trk منجر به مرگ نورون‌ها می‌شود(30-33). همچنین تمایل نوروتروفین‌های غیر فعال برای اتصال به گیرنده p75NTR بیش از گیرنده‌های Trk می‌باشد. در‏حالی‌که اتصال نوروتروفین‌های فعال به گیرنده‌های Trk منجر به تنظیم عملکردهای مختلف نورون‌ها مانند بقای، تمایز و اثر سیناپتیک می‌شود، اتصال نوروتروفین‌های غیر فعال به گیرنده p75NTR منجر به فعال شدن مسیر‌های آپوپتوزیس و در نهایت مرگ نورون‌ها می‌شود(34 و 35). در سال‌های اخیر، سلول‌های بنیادی مزانشیمی به‏صورت گسترده‌ای جهت جایگزینی سلول‌های عصبی و ترمیم ضایعات عصبی استفاده شده است(6). فعالیت سلول‌های پیوند شده در محل ضایعه عصبی، بستگی به زنده ماندن طولانی مدت این سلول‌ها دارد. یکی از مشکلاتی که در استفاده از سلول‌های شبه عصبی حاصل از تمایز سلول‌های بنیادی مزانشیمی برای ترمیم ضایعات سیستم عصبی مرکزی وجود دارد. مرگ اکثر این سلول‌ها به‏دنبال تمایز نورونی آن‏ها می‌باشد(5). در مطالعه‌ای که قبلا توسط یعقوبی و همکاران (10) انجام شد، نشان داده شد که بیان گیرنده p75NTR در حدود 6 ساعت پس از شروع تمایز سلول‌های بنیادی مغز استخوان موش صحرایی به سلول‌های شبه عصبی شروع شده و تا 12 ساعت ادامه می‌یابد. نکته جالب توجه این است که بیشترین مرگ نورون‌ها (آپوپتوزیس) نیز در همین زمان اتفاق می‌افتاد. بنابراین تداخل در بیان گیرنده p75NTR می‌تواند منجر به افزایش بقای سلول‌های شبه عصبی پیوند شده در محل آسیب شود. مطالعه عدالت و همکاران (11) تاکیدی بر این مسئله بود.

در مطالعه حاضر، به بررسی اثر بی‌وزنی بر بیان ژن p75NTR  و میزان مرگ و میر سلولی در سلول‌های بنیادی مشتق از بافت چربی قبل و بعد از تمایز به سلول‌های شبه عصبی پرداخته شد. نتایج نشان داد که بی‌وزنی منجر به کاهش بیان ژن p75NTR در سلول‌های بنیادی مشتق از بافت چربی قبل از تمایز به سلول‌های شبه عصبی می‌شود به‌طوری‌که پس از 72 ساعت اعمال بی‌وزنی، بیان این ژن در حدود 40 درصد کاهش می‌یابد. القای مرگ سلولی توسط گیرنده p75NTR قبلا در برخی مطالعات گزارش شده است(36-38). به‏منظور ارزیابی تاثیر کاهش بیان p75NTR  بر میزان آپوپتوز در سلول‌های بنیادی مشتق از بافت چربی کشت شده در شرایط بی‌وزنی، میزان آپوپتوزیس در این سلول‌ها با استفاده از کیت انکسین اندازه‌گیری شد. آپوپتوزیس یک فرآیند فیزیولوژیکی طبیعی است که در طول تکوین جنینی و همچنین برای حفظ هومئوستازی بافت‌ها صورت می‌گیرد. در مراحل اولیه آپوپتوزیس، یک سری تغییرات در سطح سلول و در غشای پلاسمایی آن اتفاق می‌افتد. یکی از تغییرات غشای پلاسمایی سلول، جابه‏جایی فسفاتیدیل سرین (PS)  از سطح داخلی و سیتوپلاسمی غشاء و قرار گرفتن آن در سطح خارجی غشا می‌باشد. مطالعات نشان داده‌اندکه ماکروفاژها به‏‏طور اختصاصی این مولکول‌های PS را که در سطح خارجی غشای لنفوسیت‌ها قرار گرفته‌اند، در طول فرایند آپوپتوزیس می‌شناسند. با توجه به مطالب فوق، یکی از روش‌های موجود برای بررسی آپوپتوزیس، آنالیز و مطالعه مولکول‌های PS موجود در سطح خارجی غشا به هنگام فرایند آپوپتوزیس می‌باشد. مولکول AnnexinV یک پروتئین متصل شونده به فسفولیپید‌ها در حضور یون کلسیم می‌باشد. این ماده دارای تمایل بالایی برای مولکول PS می‌باشد. بنابراین این ماده بسیار مناسب برای تشخیص سلول‌های در حال آپوپتوزیس در یک جمعیت سلولی (و نه در بافت) می‌باشد. کیت Annexin-V-FlUOS Staining  هم دارای ماده AnnexinV و هم دارای رنگ PI  میباشد که امکان تشخیص و تمیز دادن سلول‌های در حال آپوپتوزیس را از سلول‌های نکروزی میسر می‌سازد(39). آنالیز انکسین نشان داد که بی‌وزنی همچنین منجر به کاهش میزان آپوپتوزیس در سلول‌های بنیادی مشتق از بافت چربی قبل از تمایز به سلول‌های شبه عصبی می‌شود. این نتایج هم راستا با داده‌های بیان گیرنده p75NTR می‌باشد و نتایج به‏دست آمده توسط عدالت و همکاران (11) را تایید می‌کند. همچنین این نتایج مجددا تاکیدی بر این موضوع می‌باشد که گیرنده p75NTR می‌تواند موجب القای آپوپتوزیس در سلول‌های نورونی شود. مطالعه دیگر ما بر روی بیان نوروتروفین‌ها در شرایط بی‌وزنی نشان دادکه تیمار بی‌وزنی در سلول‌های بنیادی مشتق از چربی قبل از القای تمایز عصبی منجر به افزایش بیان نوروتروفین‌ها می‌شود(20). بنابراین می‌توان این‏گونه نتیجه گرفت که بی‌وزنی با افزایش نوروتروفین‌ها و کاهش p75NTR مانع از اثر آپوپتوزی این گیرنده می‌گردد. ازطرف دیگر نتایج تست MTT نشان داد که بی‌وزنی تاثیر معنی‌داری بر میزان زنده بودن سلول‌ها قبل از القای تمایز به سلول‌های شبه عصبی ندارد. علت اختلاف مشاهده شده در نتایج تست انکسین با تست MTT می تواند ناشی از این باشد که در تست MTT قراورده‌های متابولیکی سلول سنجیده می‌شود درحالی‏که در تست انکسین میزان آپوپتوز سلولی با آنتی‌بادی‌های سطح سلولی اندازه‌گیری می‌شود. ازآن‏جا که ژن‌های درگیر در این دو مسیر با یکدیگر متفاوت است نتایج این دو تست ‌ممکن است با یکدیگر اختلاف داشته باشند. به‏طور مثال سلول‌هایی ممکن است برای انکسین مثبت باشند درحالی‏که در تست MTT مشخص نگردند و این امر موجب شود تا تفاوت در تست MTT مشاهده نشود. ازطرف دیگر تست MTT معمولا اثرات محافظتی تیمارهای مختلف بر روی سلول های عصبی (neuroprotective effects) را به‏خوبی اندازه‌گیری نمی‌کند. این امر ناشی از این می‌باشد که نقطه اثر تیمارهای مختلف در مسیرهای مرگ سلولی با یکدیگر متفاوت می‌باشد. بنابراین تست MTT از ارزش محدودی در ارزیابی اثرات محافظتی مواد مختلف بر روی سلول‌های عصبی برخوردار است ولی با این وجود می‌تواند اطلاعاتی دراختیار ما قرار دهد مبنی بر اینکه تیمارهای ضد آپوپتوزیس در کدام بخش مسیرهای میتوکندریایی (بالادست و یا پایین دست) منجر به آپوپتوزیس می‌‏شود (40).

نتایج به‏دست آمده بعد از تمایز سلول‌های فوق به سلول‌های شبه عصبی متفاوت بود. نتایج ما نشان داد که بی‌وزنی تاثیری بر بیان گیرنده p75NTR در سلول‌های شبه عصبی حاصل از تمایز سلول‌های بنیادی مشتق از بافت چربی ندارد. نتایج کیت انکسین نیز این مسئله را تایید نمود به‏طوری‏که میزان آپوپتوزیس در سلول‌های شبه عصبی  کشت داده شده در شرایط بی‌وزنی اختلاف معنی‌داری را با سلول‌های کشت شده در شرایط نرمال 1جی نشان نداد. به‏نظر می‌رسد با شروع تمایز مسیرهایی در سلول فعال می‌شود که مانع از تاثیر بی‌وزنی بر میزان مرگ سلولی از طریق گیرنده p75NTR می‌‏شود و تاثیر بی‌وزنی بر سلول‌ها قبل از تمایز بیش از تاثیر آن بعد از تمایز می‌باشد. به‏نظر می‌رسد بی‌وزنی روشی مفید برای تسهیل فرآیند تمایز سلولی و افزایش پتانسیل تمایزی سلول‌های بنیادی می‌باشد و منجر به افزایش ماهیت بنیادی بودن سلول‌ها می‌گردد؛ ولی با شروع فرآیند تمایز دیگر تاثیر چشم‏گیری بر فرایند تمایز ندارد. بنابراین پیشنهاد می‌‏شود که پیش-تیمار سلول‌های بنیادی با بی‌وزنی، می‌تواند تاثیری مثبت بر فرایند تمایز بگذارد. مطالعات چن و همکاران (41) نیز موید این مطلب است. آن‏ها نشان دادند که تیمار سلول‌های بنیادی مزانشیمی مشتق از مغز استخوان با بی‌وزنی، پتانسیل تمایزی و توان ترمیم آن‏ها را پس از پیوند در محل ضایعه عصبی افزایش می‌دهد.

 

نتیجه‌گیری

به‌طور کلی امروزه از سلول‌هاى بنیادى به ‏عنوان یک درمان بالقوه براى بسیارى از بیماری‌هاى عصبى استفاده می‌شود. موفقیت چنین روش‌هایى به واسطه مرگ سلول‌هاى پیوندشده، امیدوارکننده نبوده و کاربرد بالینی این روش‏ها را محدود می‌سازد. با توجه به کاهش میزان مرگ و میر و افزایش پتانسیل تمایزی سلول‌ها، بی‌وزنی می‌تواند به‏عنوان ابزاری قدرتمند و محیط جدیدی برای کشت و تمایز سلول‌های عصبی و دستیابى به درمان‌هاى پیوند موفق‌ترمعرفی شود.

تشکر و قدردانی

این مقاله بر اساس  نتایج  حاصل از پایان نامه دانشجوی دکتری با کد 19830553931002 که در سال 1393- 1395در آزمایشگاه زیست فضایی پژوهشگاه هوافضا انجام شده است، نگارش شد. نویسندگان مقاله مراتب تشکر و قدرردانی خود را از مسئولین محترم پژوهشی آن مرکز ابراز می‌دارند.

  1. Lindvall O, Kokaia Z. Stem cells for the treatment of neurological disorders. Nature. 2006; 441: 1094–1096.
  2. Cuevas P, Carceller F, Dujovny M, Garcia-Gómez I, et al. Peripheral nerve regeneration by bone marrow stromal cells. Neurol Res. 2002; 24(7): 634–638.
  3.  Hofstetter C, Schwartz E, Hess D, Widenfalk J, et al. Marrow stromal cells form guiding strands in the injured spinal cord and promote recovery. Proc Natl Acad Sci U S A. 2002; 99(4): 2199–2204.
  4. Azizi F, Jalil HR, Moshtaghian SJ, Doostmohammadi A, et al. Neuronal differentiation of embryonal carcinoma stem cells in threedimensional culture system. Journal of Cell and Tissue (JCT). 2017; 7(3): 301-311.
  5. Rismanchi N, Floyd C, Berman R, Lyeth B. Cell death and long-term maintenance of neuron-like state after differentiation of rat bone marrow stromal cells: a comparison of protocols. Brain Res. 2003; 991: 46–55.
  6. Sanchez-Ramos J, Song S, Cardozo-Pelaez F, Hazzi C, et al. Adult bone marrow stromal cells differentiate into neural cells in vitro. Exp Neurol. 2000; 164(2): 247–256.
  7. Jahantigh F, Nanakar H, Ghorashi SMB. Fabrication and characterization of graphene foams and using it for electrical stimulation of human neural stem cells. Journal of Cell and Tissue (JCT). 2017; 7(3): 259-273.
  8. Barde YA. Trophic factors and neuronal survival. Neuron.1989; 2(6): 525–1534.
  9. Huang EJ, Reichardt LF. Neurotrophins: Roles in neuronal development and function. Annu Rev Neurosci. 2001; 24: 677–736.
 

10.Yaghoobi MM, Mowla SJ. Differential gene expression pattern of neurotrophins and their receptors during neuronal differentiation of rat bone marrow stromal cells. Neurosci Lett. 2006; 397(1-2):149-54.

11. Edalat H, Hajebrahimi Z, Movahedin M, Tavallaei M, et al. P75NTR suppression in rat bone marrow stromal stem cells significantly reduced their rate of apoptosis during neural differentiation. Neurosci Lett. 2011; 498(1):15-9.

12. Rea G, Cristofaro F, Pani G,Pascucci B, et al. Microgravity-driven remodeling of the proteome reveals insights into molecular mechanisms and signal networks involved in response to the space flight environment. J Proteomics. 2016; 137: 3-18.

13.Grimm DBauer JKossmehl P, Shakibaei M, et al. Simulated microgravity alters differentiation ad increases apoptosis in human follicular thyroid carcinoma cells. Faseb J. 2002; 16:604-614.

14.Claassen DE, Spooner BS. Impact of altered gravity on aspects of cell biology. Int Rev Cyt. 1994; 156: 301– 373.

15.Hammond TG, Lewis FC, Goodwin TJ, et al. Gene expression in space. Nat Med. 1999; 70(5): 359.

16. Unsworth BR, Lelkes PI. Growing tissues in microgravity. Nat Med. 1998; 4(8):901-907.

17.Chen JLiu RYang Y, Li J, et al. The simulated microgravity enhances the differentiation of mesenchymal stem cells into neurons. Neurosci Lett. 2011; 505(2):171-5.

18.Yuge LSasaki AKawahara Y,  Wu SL, et al. Simulated microgravity maintains the undifferentiated state and enhances the neural repair potential of bone marrow stromal cells. Stem Cells Dev. 2010; 20(5): 893–900.

19.Zuk PA, Zhu M, Ashjian P, De Ugarte DA, Huang JI, Mizuno H, Alfonso ZC, Fraser JK, Benhaim P, Hedrick MH, 2002, Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell. 13(12):4279–4295

20.Zarrinpour V, Hajebrahimi Z, Jafarinia M. Expression pattern of neurotrophins and their receptors during neuronal differentiation of adipose-derived stem cells in simulated microgravity condition. Iran J Basic Med Sci. 2017; 20:178-186.

21.Hughes-Fulford M, Lewis ML. Effects of microgravity on osteoblast growth activation. Exp Cell Res. 1996; 224(1): 103– 109.

22.Moos- PJ, Fattaey HK, Johnson TC. Cell proliferation inhibition in reduced gravity. Exp Cell Res. 1994; 213: 458– 462.

23.Boonstra J. Growth factor-induced signal transduction in adherent mammalian cells is sensitive to gravity. Faseb J. 1999; 13: S35– S42.

24. Carmeliet G, Bouillon R. The effect of microgravity on morphology and gene expression of osteoblasts in vitro. Faseb J. 1999; 13: S129– S134.

25.Ibanez C, Fand Simi A. neurotrophin receptor signaling in nervous system injury and degeneration: paradox and opportunity. Trends Neurosci. 2012; 35(7): 431-440

26. Yan Q, Johnson EM Jr. An immunohistochemical study of the nerve growth factor receptor in developing rats. J Neurosci. 1988; 8(9):3481–3498.

  1. Friedman WJ, Olson L, Persson H. Temporal and spatial expression of NGF receptor mRNA during postnatal rat brain development analyzed by in situ hybridization. Dev Brain Res.1991; 63:43-51.
28.Ernfors P, Henschen A, Olson L, Persson H. Expression of nerve growth factor receptor mRNA is developmentally regulated and increased after axotomy in rat spinal cord motoneurons. Neuron. 19892; 2(6): 1605–1613

  1. Koliatsos VE, Crawford TO, Price DL. Axotomy induces nerve growth factor receptor immunoreactivity in spinal. Brain Res. 1991; 549(2): 297-304.
30.Domeniconi M, Zampieri N, Spencer T, et al. MAG induces regulated intramembrane proteolysis of the P75 neurotrophin receptor to inhibit neurite outgrowth. Neuron 2005; 46(6): 849-855.

31.Ahmed Z, Mazibrada G, Seabright RJ, et al. TACEinduced cleavage of NgR and P75NTR in dorsal root ganglion cultures disinhibits outgrowth and promotes branching of neuritis in the presence of inhibitory CNS myelin. FASEB J 2006; 20(11): 1939-1941.

32. Cosgaya JM, Chan JR, Shooter EM. The neurotrophin receptor P75NTR as a positive modulator of myelination. Science 2002; 298(5596): 1245-1248.

33.Chan JR, Jolicoeur C, Yamauchi J, et al. The polarity protein Par-3 directly interacts with P75NTR to regulate myelination. Science 2006; 314(5800): 832-836.

  1. Kaplan D. R, Stephens R. M.  Neurotrophin signal transduction by the Trk receptor. J Neurobiol. 1994; 25(11):1404–1417.
35.Barbacid M. The Trk family of neurotrophin receptors. J Neurobiol. 1994; 25(11):1386–1403.

36.Hasegawa Y, Yamagishi S, Fujitani M, Yamashita T. P75 neurotrophin receptor signaling in the nervous system. Biotechnol  Annu  Rev. 2004; 10: 123–149.

37.Lee R, Kermani P, Teng KK, Hempstead BL. Regulation of cell survival bysecreted proneurotrophins Science. 2001; 294: 1945–1948.

38. Teng HK, Teng KK, Lee R, Wright S, et al. ProBDNF induces neuronal apoptosis via activation of a receptor complex of p75NTR and sortilin. J Neurosci. 2005; 25(22):  5455–5463.

39. Penaloza C, Orlanski S, Ye Y, Entezari-Zaher T, et al. Cell death in mammalian development. Curr Pharm. 2008; 4: 184–196.

40.Lobner D. Comparison of the LDH and MTT assays for quantifying cell death: validity for neuronal apoptosis?. J Neurosci Methods. 2000; 96(2): 147-152.

41. Chena J, Liub R, Yang Y.  Zhang X, et al. The simulated microgravity enhances the differentiation of mesenchymal stem cells into neurons. Neurosci Lett. 2011; 505(2): 171– 175.