خاموشی ژن انتهایی بیوسنتز آلکالوئیدهای پاپاورین و سنگوینارین (DBOX) در گیاه دارویی شقایق با استفاده از فن VIGS

نوع مقاله: علمی - پژوهشی

نویسندگان

دانشگاه لرستان، دانشکده کشاورزی، گروه زراعت و اصلاح نباتات، خرم آباد، ایران

چکیده

هدف: در این پژوهش، به‏منظور بررسی تاثیر خاموشی بر بیان ژن کلیدی DBOX (که آنزیم نهایی بیوسنتز دو آلکالوئید سنگوینارین و پاپاورین را کد می‌کند)، از فن VIGS در گونه ای از خشخاش (Papaver somniferum L.) استفاده شد.
 مواد و روش‌ها: قطعه 350 جفت بازی از توالی ژن DBOX (در محدوده  bp1462-1112) براساس تولید بیشترین تعداد siRNA با طول 21 نوکلئوتید انتخاب شد. پس از همسانه‌سازی این قطعه در ناقل واسط pTZ57R/T و انتقال به ناقل ویروسی pTRV2، مایع تلقیح آگروباکتریوم حاوی سازه خاموشی به برگ‌های بوته‌های گیاه تزریق شد. گیاهان تراریخت اولیه توسط واکنش PCR با استفاده از آغازگرهای ژن کد کننده پوشش پروتئینی ویروس (CP) انتخاب و غربالگری ثانویه توسط تکنیک PCR نیمه کمی صورت گرفت. در مرحله بعد نمونه‌هایی با بیشترین خاموشی (کمترین بیان) ژن مورد نظر توسط تکنیک real-time RT-PCR مورد بررسی قرار گرفتند.
نتایج: صحت همسانه‌سازی در پلاسمیدهای  pTZ57R/Tو pTRV2 با استفاده از واکنش‌های PCR و هضم آنزیمی تائید شد. براساس نتایج PCR نیمه کمی، تعداد 5 بوته تراریخت با کمترین بیان برای ژن DBOX انتخاب شدند. نتایج نهایی real-time RT-PCR به‏طور متوسط بیانگر کاهش نسبی 81 درصدی در بیان رونوشت‌های ژن DBOX در گیاهان تراریخت در مقایسه با گیاهان کنترل (تلقیح شده با پلاسمید خالی pTRV2) بود.
نتیجه‌گیری: به‏طور کلی نتایج نشان داد که فن VIGS به‏طور موفقیت آمیزی می‌تواند میزان بیان ژن DBOX را در گیاه خشخاش کاهش دهد. به‏علاوه از نتایج به‏دست آمده در خصوص این ژن، می‌توان در درک بیشتر مسیر بیوسنتزی آلکالوئیدهای گیاه خشخاش و تولید گیاهان تراریخت با اهداف مهندسی متابولیت بهره برد.
 

کلیدواژه‌ها


مقدمه

گیاهان عالی علاوه ‌بر متابولیت‌های اولیه، حاوی تعداد زیادی از ترکیبات شیمیایی با ساختاری پیچیده و وزن مولکولی پایین به‏نام متابولیت‌های ثانویه هستند. آلکالوئیدها با بیش از 12000 ساختار شیمیایی مختلف، از جمله متنوع‌ترین و مهم‏ترین متابولیت‌های ثانویه محسوب می‌شوند (1). آلکالوئیدهای گروه بنزیل‌ایزوکوینولینیBenzylisoquinolin) alkaloieds) (BIAs) گروه بزرگی از متابولیت‌های ثانویه هستند که تاکنون بیش از 2500 ساختار مختلف از آن‏ها شناسایی شده است. اهمیت شیمیایی بیشتر BIAs به‏دلیل وجود یک یا چند مرکز کایرال در ساختار شیمیایی این گروه از آلکالوئیدها می‌باشد. وجود مرکز کایرال یکی از دلایل اصلی عدم سنتز و تولید صنعتی تعدادی از این آلکالوئیدها بوده و به‏همین دلیل برای سالیان متوالی تنها منبع تولید آن‏ها، به‏صورت طبیعی می‌باشد (2). در بین گیاهان دارویی که حاوی آلکالوئیدهای گروه بنزیل‌ایزوکوینولینی هستند، گیاه شقایق (Papaver somniferum L.) از اهمیت ویژه‌ای برخوردار بوده و سالیان طولانی است که به‏دلیل دارا بودن آلکالوئیدهای مهمی (از جمله پاپاورین، سنگوینارین، بربرین و گروه مورفینان)، مورد توجه فراوان بوده است (3 و 4).

در مسیر بیوسنتزی آلکالوئیدهای بنزیل‌ایزوکوینولینی (BIAs) گیاه شقایق، آنزیم‌های متعددی متعلق به تعداد نسبتا محدودی از خانواده‌های پروتئینی (از جمله سیتوکروم‌های P450، O و N متیل ترانسفرازهای، دهیدروژناز-ردوکتازهای وابسته به NADPH، اکسید ردوکتازهای مرتبط با FAD) حضور دارند (2 و 5). بیوسنتز آلکالوئیدهای ایزوکوئینولینی (BIAs) در گیاه شقایق با متراکم شدن دوپامین و ترکیب شیمیایی دیگری به‏نام 4-هیدروکسی‌فنیل‌استالدهید (4-HPAA) آغاز می‌شود که هر دو از مشتقات اسید آمینه تیروزین هستند. این دو ترکیب طی مراحل بعدی به دو ماده میانی به‏نام اس ـ کوکلاورین و اس ـ رتیکولین تبدیل می‌شوند که تقریبا تمام آلکالوئیدهای مهم و با ارزش گیاه شقایق از جمله پاپاورین، سنگوینارین، نوسکاپین و مورفینان از این دو ترکیب میانی تولید خواهند شد. آلکالوئیدهای سنگوینارین، پاپاورین و نوسکاپین به‏ترتیب با دارا بودن خاصیت آنتی‌باکتریال، شل کننده عضلات و ضد سرطانی، از مهم‏ترین آلکالوئیدهای تولید شده توسط گیاه شقایق محسوب می‌شوند. سنگوینارین و پاپاورین هر دو دارای چرخه بیوسنتزی مختص به خود بوده و در مسیر تولید آن‏ها آنزیم‌های متعددی حضور دارند با این‏حال آنزیم نهایی سنتز هر دو یکسان است. ژن کد کننده این آنزیم، هیدرو بنزوفنانتریدین اکسیداز (DBOX) نام دارد که علاوه‌بر نقش کلیدی در سنتز آلکالوئیدهای سنگوینارین و پاپاورین، بر روی میزان تولید نوسکاپین نیز موثر است (2 و 6).

در حال حاضر استفاده از روش‌های نوین مهندسی ژنتیک، از جمله پرکاربردترین فنونی به‏شمار می‌روند که در دستورزی مسیر تولید ترکیبات آلی موجود در گیاهان دارویی مورد استفاده قرار می‌گیرند. در این بین استراتژی مهندسی متابولیت، تغییر در تولید متابولیت‌های ثانویه با استفاده از دو سیستم کلی افزایش و کاهش بیان ژن‌های بیوسنتز کننده می‌باشد. مهندسی متابولیت را می‌توان راه‌کار نهایی برای افزایش تولید ترکیبات زیستی با استفاده از دانش زیست‌شناسی و مهندسی ژنتیک برای تغییر عملکرد در سطح سلولی دانست (7). به‏طور کلی می‌توان گفت که تغییر بیان ژن‌های کلیدی درگیر در تولید یک یا دسته‌ای از متابولیت‌های ثانویه در گیاهان دارویی، از مهم‏ترین استراتژی‌های مورد استفاده در بالا بردن تولید متابولیت‌ها در گیاهان دارویی محسوب می‌شود (8).

محققین با استفاده از تکنیک‌های خاموشی ژن مختلفی که تاکنون ابداع و گزارش شده است، توانستنه‌اند نتایج قابل توجه‌ای در دستورزی مسیرهای ژنتیکی به دست آورند(9). در فرآیند مهندسی ژنتیک، خاموشی ژن در سطوح مختلفی القاء می‏شودد که از مهم‏ترین آن‏ها می‌توان به خاموشی در دو سطح رونویسی و ترجمه اشاره کرد. خاموشی ژن به واسطه ویروس (virus induced gene silenc) (VIGS) یکی از تکنیک‌های خاموشی ژن پس از رونویسی (post transcriptional gene silencing )(PTGS) محسوب می‌شود. در این روش ژنوم تغییر شکل یافته‌ ویروس به‏همراه بخشی از توالی ژن گیاهی مورد نظر توسط آگروباکتریوم به‏درون گیاه فرستاده می‌شود. در سلول‌های گیاهی ابتدا RNA تراریخت رونویسی شده و سپس توسط آنزیم RNA پلیمراز وابسته به RNA (RDRP) به RNA دو رشته‌ای تبدیل شده و این RNAهای دو رشته‌ای توسط آنزیم‏های برشی خاصی به‏نام DICER شناسایی و به قطعات RNA دو رشته‌ای کوتاه‌تری به‏نام siRNA تبدیل و وارد کمپلکس خاموشی ((RNA-induced silencing complex (RISC) شده و به RNA های کوتاه تک رشته‌ای تبدیل می‌شوند. این قطعات تک رشته‌ای براساس شباهت با توالی ژن هدف به آن‏ها متصل شده و در فرایند PTGS سبب خاموشی ژن هدف خواهند شد (10 و 11).

تاکنون بسیاری از آنزیم‌های کلیدی که در بیوسنتز آلکالوئیدهای گیاه شقایق نقش دارند، شناسایی و جداسازی شده‌اند و با توجه به اهمیت مسیر بیوسنتز این دسته از آلکالوئیدها، مطالعات متعددی در راستای مهندسی آنزیم‌های کلیدی مسیر بیوسنتزی این گیاه دارویی صورت گرفته و نقش فیزیولوژیکی و میزان تغییر بیان آن‏ها با استفاده از انواعی از روش‌های سرکوب و خاموشی ژن بررسی شده است (12-16). با توجه به اهمیت گیاه دارویی شقایق و تولید آلکالوئیدهای پر کاربرد در این گیاه، از جمله دو آلکالوئید مهم پاپاورین و سنگوینارین و نفش فعال آنزیم DBOX در تولید نهایی این دو آلکالوئید (17)، مطالعه حاضر به‏منظور بررسی تاثیر خاموشی ژن DBOX با استفاده از تکنیک VIGS در ژنوتیپ‌ ایرانی این گیاه دارویی اجرا شد.

 

مواد و روش‌ها

استخراج RNA و ساخت cDNA: بذور ژنوتیپ ایرانی گیاه شقایق (P. somniferum L.) در گلدان‌هایی با قطر 30 سانتیمتر در گلخانه گیاهان تراریخت دانشکده کشاورزی دانشگاه لرستان تحت شرایط 16 ساعت روشنایی و 8 ساعت تاریکی کشت شدند و دمای رشد شبانه و روزانه در کل دوره رشد به‏ترتیب 18 و 20 درجه سانتی‏گراد در نظر گرفته شد. RNA کل با استفاده از کیت جداسازی RNA (Thermo Fisher scientific, Germany) استخراج و به‏منظور حذف DNA ژنومی احتمالی، نمونه‌های RNA استخراج شده با آنزیم DNaseI (Fermentase, Germany) تیمار شدند و برای تائید نهایی عدم حضور DNA ژنومی، از PCR با استفاده از آغازگرهای ژن کنترل داخلی بتا-اکتین (beta-Actin) بر روی RNA مورد نظر به‏عنوان الگو استفاده گردید. ژن کنترل داخلی بتا-اکتین از بیان بالا و پایداری بیان در بیشتر بافت‌ها و شرایط محیطی برخوردار است و آغازگرهای این ژن از بخشی طراحی شدند که به ناحیه هدف اگزونی ژن متصل می‌شوند و قابلیت تکثیر بخش ژنومی و cDNA را دارند.

جهت تعیین کمیت و کیفیت RNA استخراج شده، از ژل الکتروفورز و دستگاه اسپکتوفتومتری استفاده شد. پس از تایید کمیت و کیفیتRNA، رشته‌های اولیه cDNA با استفاده از کیت سنتز cDNA (Thermo Fisher scientific, Germany) براساس دستورالعمل شرکت ساخته شد. برای این‏ منظور هر تیوب حاوی 20 میکرولیتر مخلوط واکنش بود که اجزای آن شامل نیم میکرولیتر از هر یک از آغازگرهای تصادفی 6 نوکلئوتیدی (هگزامر) و آغازگر عمومی Oligo (dT)18(با غلظت 100 میکرومولار در هر میکرولیتر)، 2 میکرولیتر dNTPs (با غلظت 10 میکرومولار در هر میکرولیتر)، 4 میکرولیتر بافر واکنش (5X)، 5 میکرولیتر RNA (با غلظت 100 نانو گرم در هر میکرولیتر)، یک میکرولیتر آنزیم ترانسکریپتاز معکوس (با غلظت200 واحد در هر میکرولیتر) و مابقی آب بود. برنامه تکثیر نیز براساس چرخه دمایی 42 درجه سانتی‏گراد برای 90 دقیقه با استفاده از پس از واسرشت‌سازی مخلوط واکنش در دمای 70 درجه سانتی‏گراد به‏مدت 5 دقیقه صورت گرفت. پس از سنتز cDNA، کارایی و سلامت cDNA ساخته شده با استفاده از PCR و آغازگرهای ژن کنترل داخلی بتا- اکتین  تایید شد (جدول 1).

همسانه‌سازی سازه خاموشی ژن DBOX: به‏منظور ساخت سازه خاموشی، ابتدا بخشی از ژن هدف به‏طول 355 جفت باز از روی توالی ژن DBOX (با شماره دسترسی JX390714 موجود در بانک اطلاعاتی NCBI) انتخاب شد. روش انتخاب قطعه مورد نظر جهت ساخت سازه خاموشی به‌ این‏صورت بود که ابتدا توالی نوکلئوتیدی ORF ژن هدف به قطعات 300 نوکلئوتیدی تقسیم بندی و با استفاده از ابزار RNAi Scan مورد بررسی قرار گرفت. سپس قطعه‌ای از نظر پارامترهای مربوطه (میزان GC بین 30 تا 60 درصد، وجود نوکلئوتیدهای AU در '5 و نوکلئوتیدهای GC  در '3، عدم وجود تکرارهای 3 یا بیشتر از نوکلئوتیدهای GC و عدم وجود تکرارهای 4 یا بیشتر از نوکلئوتیدهای AT) مناسب بود و احتمال تولید بیشترین siRNA با طول 21 نوکلئوتید را داشت انتخاب شد. پس از انتخاب قطعه‌ مورد نظر با بیشترین میزان تولید siRNA، با استفاده از نرم افزارهای Vector NTI 10.3 و Allele ID 7.0 یک جفت آغازگر اختصاصی (جدول 1) برای تکثیر این ناحیه طراحی شد.  با استفاده از PCR و آغازگرهای اختصاصی طراحی شده، قطعه مورد نظر توسط آنزیم Pfu از روی cDNA تکثیر و پس از الکتروفورز بر روی ژل 5/1 درصد آگارز، تخلیص گردید. پس از خالص سازی محصول PCR، قطعه مورد نظر با استفاده از کیت همسانه‌سازی (Thermo Fisher scientific, Germany) به‏درون ناقل واسط pTZ57R/T وارد شد و نهایتا پلاسمید نوترکیب (pTZ-DBOX)، جهت تکثیر به‏درون سلول‌های مستعد DH5α باکتری E.coli به‏روش شوک کلسیمی منتقل شد. جهت تائید همسانه‌سازی، از PCR با آغازگرهای اختصاصی و واکنش هضم با استفاده از آنزیم‌های برشی BamHI و EcoRI استفاده شد و نهایتا توالی‌یابی قطعه همسانه‌سازی شده با استفاده از آغازگرهای M13 صورت گرفت.

 

 

جدول 1: آغازگرهای مورد استفاده جهت جداسازی، تکثیر، ساخت و تائید سازه خاموشی

نام آغازگر

توالی آغازگر

اندازه محصول

bp

Forward primer (5-3)

Reverse primer (5-3)

pTRV2-DBOX

CATTAGAACAAGGTGCCACG

GGTTCCCTCACGTAATCAGC

350

CP-TRV

CGGGCTAACAGTGCTCTTG

CTCCCTTGGTTCGTCGTAAC

134

Elf1

CGATAGGCGATCTGGAAAGG

AGGTGGATACTGAGCGAAGG

124

Beta-Actin

TCTCAACCCAAAGGCTAATTCG

CCCCAGAATCCAAGACAATAC

313

DBOX-RT

AACCTTCTCATCCAATCAATCTGC

TTCGGAATTTGAAACTCCTTACCC

117

 

 

جهت ساخت سازه نهایی، ابتدا قطعه همسانه‌سازی شده در ناقل pTZ57R/T (pTZ-DBOX)، با استفاده از آنزیم‌های برشی BamHI و ECORI جدا شد و سپس با استفاده از واکنش الحاق در ناقل pTRV2 و در محل جایگاه این دو آنزیم قرار داده شد. صحت همسانه‌سازی نیز در این مرحله با استفاده از واکنش PCR و هضم آنزیمی تائید شد و سازه نهایی pTRV2-DBOX نامیده شد (شکل 1). در این تحقیق از پلاسمید pTRV2 خالی (pTRV2-Empty) که بدون قطعه خاموشی است جهت تلقیح نمونه‌های گیاهان شاهد (کنترل) تراریخت استفاده شد. پلاسمید pTRV2 خالی (pTRV2-Empty)، پلاسمید pTRV1 و سازه pTRV2-DBOXبه‏طور جداگانه با استفاده از تکنیک الکتروپوراسیون به‏درون سلول‌های مستعد شده سویه GV3101 باکتری Agrobacterium tumefaciensمنتقل و بر روی محیط کشت جامد LB حاوی 50 میلی‌گرم در لیتر آنتی‌بیوتیک کانامایسین به‏عنوان گزینش‏گر کشت داده شدند. پس ازکشت باکتری‌ها در دمای 28 درجه سانتی‏گراد به‏مدت 48 ساعت، تک کلونی‌های مثبت اولیه براساس واکنش PCR انتخاب شدند.

 

 

شکل 1: شماتیک پلاسمیدهای مختلف جهت تراریزش بوته‌های شقایق. 35S: پروموتر ویروس موزایک کلم (CaMV)، BamHI و EcoRI: سایت‌های برشی مورد استفاده جهت هضم و لیگاسیون،  CP: ژن کد کننده پوشش پروتئینی ویروس، Rz: ریبوزیم خود برشی، NOS-T: خاتمه دهنده ژن نوپالین سینتاز، MCS: جایگاه همسانه‌سازی چندگانه، RdRp: آنزیم RNA پلی‌مراز وابسته به RNA، MP: پروتئین حرکتی ویروس، 16K: پروتئین 16 کیلودالتونی، RB و LB: به‏ترتیب مرز راست و چپ T-DNA هستند.

 

آگرو-فیلتراسیون و اجرای فرایند VIGS: از تک کلونی‌های مثبت انتخاب شده از هر کدام از پلاسمیدهای pTRV2 خالی و pTRV1و سازه نهایی pTRV2-DBOXبرای کشت شبانه دردمای 28 درجه سانتی‏گراد در محیط LB مایع حاوی آنتی‌بیوتیک کانامایسین (50 میلی‌گرم در لیتر) استفاده شد. باکتری‌های رشد یافته توسط سانتریفیوز (5000 دور به‏مدت 20 دقیقه) در دمای محیط جداسازی و در مایع تلقیح (حاوی 10 میلی‌مولار MgCl2، 10 میلی‌مولار MES و 20 میکرومولار استوسیرینگون) مجددا حل شد به‏طوری‏که جذب نهایی تمام نمونه‌ها در طول موج 600 نانومتر تقریبا برابر با 2 بود (OD600=2) (18).

جهت اجرای آگرو-فیلتراسیون و تلقیح بوته‌های شقایق (بوته‌هایی با عمر 4 تا 5 هفته‌) از روش پیشنهادی هیلمن و همکاران (19) و پنیکس و فاچینی (18) استفاده شد، بدین منظور مایع تلقیح حاوی پلاسمید pTRV2 خالی (به‏عنوان شاهد تراریخت)و سازهpTRV2-DBOXبطور جداگانه به نسبت 1:1 با پلاسمیدpTRV1ترکیب و به‏مدت 3 ساعت در دمای محیط قرار داده شد. در مرحله بعد از سرنگ‌های یک میلی‌لیتری بدون سوزن برای تزریق مایع تلقیح به زیر قسمت پشتی 3 تا 4 برگ هر بوته شقایق استفاده شد و از مجموع 30 بوته انتخابی، 20 بوته با سازه pTRV2-DBOX و 10 بوته با پلاسمید pTRV2 خالی به‏عنوان شاهد تلقیح شدند. بوته‌های تلقیح شده تا زمان گلدهی در گلخانه نگه‏داری شدند. نمونه‌های برگی بوته‌های تیمار شده چند روز قبل از باز شدن گل (مرحله آنتزیز) جمع‌آوری و در ازت مایع قرار داده و پس از انتقال به آزمایشگاه برای مطالعات بعدی در دمای 80- درجه سانتی‏گراد نگه‏داری شدند.

انتخاب گیاهان تراریخت و اجرای PCR نیمه کمی: پلاسمید pTRV2 قطعه‌ای از پوشش پروتئینی ویروس را به‏نام (coat protein) CP را کد می‌کند (10). به‏منظور تائید حضور پلاسمید و سازه خاموشی نهایی در بوته‌های تلقیح شده و انتخاب گیاهان تراریخت اولیه، از آغازگرهای اختصاصی ژن کد کننده قطعه پروتئینی CPاستفاده شد. ازمجموع بوته‌های تراریخت کهCP-PCRآن‏ها مثبت بود، تعداد 10 نمونه انتخاب و میزان نسبی تغییر بیان ژن هدف (DBOX) در آن‏ها با استفاده تکنیک  PCRنیمه کمی و آغازگرهای اختصاصی خارج از توالی قطعه خاموشی انتخاب شده از ژن DBOX، مورد بررسی قرار گرفتند. از آغازگرهای ژن بتا-اکتین گیاه شقایق نیز به‏عنوان ژن کنترل داخلی جهت مقایسه میزان بیان ژن در نمونه‌های تراریخت استفاده شد.

ابتدا cDNA تمامی نمونه‌هایی با CP-PCR مثبت از روی RNA کل آن‏ها ساخته شد و با استفاده از غلظت‌های مشخص و یکسان از cDNA هر نمونه به‏عنوان الگو، PCR نیمه کمی با استفاده از آغازگرهای اختصاصی ژن DBOX و ژن بتا-اکتین به‏طور همزمان در واکنش‌های مجزا اجرا شد. حجم معین و یکسانی از محصول نهایی PCR تمام نمونه‌ها برای ژن هدف و ژن کنترل داخلی بر روی ژل آگارز 5/1 درصد بارگذاری و اجرا شد. قطعات تکثیر شده بررسی و تغییر بیان ژنی هر نمونه برای ژن هدف با استفاده از قطعه تکثیر شده ژن کنترل داخلی همان نمونه مقایسه شد و نهایتا نمونه‌هایی که از بیان کمتری برخوردار بودند، برای مراحل بعدی انتخاب شدند. 

واکنش‌های PCR در زمان واقعی: قبل از اجرای این مرحله از مطالعه، به‏منظور بررسی کارایی تکثیر با استفاده از آغازگرهای طراحی شده، از واکنش PCR با استفاده از cDNA گیاه غیر تراریخت و برداشت محصول واکنش در 4 چرخه دمایی مختلف (چرخه‌های 22، 25، 28 و 31) استفاده و راندمان تکثیر با کمی سازی میزان شدت نور قطعات تکثیر شده، محاسبه شد. واکنش‌های real-time RT-PCR با استفاده از دستگاهRotor-Gene Q (Qiagen, Germany) و کیت SYBR Green شرکت فرمنتاز اجرا شد. جهت انجام این واکنش‌ها از cDNA مربوط به بافت‌های برگی گیاهان تراریخت (سازهpTRV2-DBOX) و شاهد تراریخت (تلقیح با سازهpTRV2 خالی) استفاده شد. هر واکنش شامل 5/7 میکرولیتر از محلول پایه SYBR Green، 300 نانومولار از آغازگرهای اختصاصی و 10 نانوگرم از cDNA به‏عنوان الگو بود. از ژن کنترل داخلی Elf1 نیز به‏عنوان استاندارد برای مقایسه تغییر سطوح بیان در تمامی واکنش‌ها استفاده شد. شرایط دمایی واکنش نیز به صورت 95 درجه سانتی‏گراد به‏مدت 20 ثانیه و دمای 51 و 53 درجه سانتی‏گراد نیز به‏عنوان دمای اتصال به‏مدت 1 دقیقه به‏ترتیب برای ژن هدف و ژن کنترل داخلی در نظر گرفته شد. جفت آغازگرهای مورد استفاده (DBOX-RT) براساس اتصال در خارج از قطعه هدف خاموشی طراحی و مورد استفاده قرار گرفتند (جدول 1). از 5 تکرار بیولوژیک و 2 تکرار تکنیکی در اجرای واکنش‌های  real-time RT-PCR استفاده شد و نهایتاً نتایج با استفاده از روش 2-ΔΔCt(20) مورد تجزیه و تحلیل قرار گرفتند.

نتایج

براساس نتایج به‏دست آمده از ژل الکتروفورز و اسپکتوفتومتری مشخص شد که RNA استخراج شده از کمیت و کیفیت مناسبی برخوردار بوده و نسبت جذب A260/A280 و A260/A230 آن به‏ترتیب برابر با 9/1 و 1/2 بود. هیچ قطعه‌ای توسط واکنش PCR با استفاده از آغازگرهای کنترل داخلی بتا-اکتین تکثیر نشد که بیانگر عدم وجود DNA ژنومی در RNA کل بود. نتایج RNAi Scan نشان داد که قطعه 350 جفت بازی حد فاصل بین نوکلوتیدهای 1112 تا 1462 از بیشترین تعداد siRNA برخوردار است. پس از اجرای PCR بر روی cDNA ساخته شده از روی RNA اولیه با استفاده از آغازگرهای اختصاصی، قطعه 350 جفت بازی تکثیر شد (شکل 2).

پس از اتمام تراریزش قطعه تکثیر شده در ناقل pTZ57R/T، نتایج واکنش PCR با آغازگرهای اختصاصی بر روی کلونی‌های سفید نشان داد که تمامی کلونی‌ها باند 350 جفت بازی را تکثیر نمودند که بیانگر حضور قطعه مورد نظر در این کلونی‌ها بود. از مجموع کلونی‌های مثبت، 2 کلونی انتخاب گردید. نتایج هضم با استفاده از دو آنزیم برشی BamHI و EcoRI نیز حضور قطعه 350 جفت بازی را تائید نمود (شکل 2). نتایج توالی‌یابی 2 کلونی تائید شده اولیه نشان داد که قطعه همسانه‌سازی شده با 100 درصد همسانی با بخش انتخاب شده ژن DBOX شباهت داشت. در مرحله بعد، پس از انتقال قطعه هدف به‏درون پلاسمید  pTRV2با استفاده از واکنش هضم و لیگاسیون مجدد، حضور قطعه مورد نظر توسط واکنش PCR و هضم آنزیمی با استفاده از دو آنزیم برشی BamHI و EcoRI تائید گردید (شکل 2).

 

 

شکل 2: مراحل جداسازی، ساخت و تائید سازه نهایی خاموشی. A) تکثیر قطعه هدف ژن DBOX با استفاده از آغازگرهای اختصاصی از روی cDNA، M: نشانگر با وزن مولکولی مشخص 100bp، اعداد بیانگر شماره واکنش است. B) کلونی PCR قطعه هدف در پلاسمید pTZ57R/T، M: نشانگر با وزن مولکولی مشخص 1Kb، C- کنترل منفی و اعداد بیانگر شماره کلونی انتخاب شده می‌باشند. C) هضم آنزیمی پلاسمید pTZ57R/T حاوی قطعه خاموشی، M: مارکر مولکولی 1Kb، UC: پلاسمید pTZ57R/T برش نخورده، 1 و 2 شماره کلونی حاوی پلاسمید pTZ57R/T برش خورده توسط آنزیم‌های برشی BamHI و EcoRI و با قطعه خاموشی خارج شده به طول 350 جفت باز. D) کلونی PCR قطعه هدف در پلاسمید pTRV2، M: نشانگر با وزن مولکولی مشخص 1Kb، C- کنترل منفی و اعداد بیانگر شماره کلونی انتخاب شده می‌باشند. E) هضم آنزیمی پلاسمید pTRV2 حاوی قطعه خاموشی، M: مارکر مولکولی 1Kb، UC: پلاسمید pTRV2 برش نخورده، 1، 2 و 3 شماره کلونی حاوی پلاسمید pTRV2-DBOX برش خورده با قطعه خاموشی خارج شده با طول 350 جفت باز. 

 

حدود 3 ماه پس از زمان تلقیح بوته‌های شقایق (4 ماه پس از کاشت) توسط مایع تلقیح حاوی سازه خاموشی و پلاسمید pTRV2 خالی، استخراج RNA و ساخت cDNA از تمامی بوته‌های تلقیح شده صورت گرفت و نتایج PCR با استفاده از آغازگرهای ژن کد کننده پروئین CP نشان داد که از مجموع 20 بوته تلقیح شده با سازه خاموشی (pTRV2-DBOX) تعداد 16 نمونه مثبت بودند و قطعه 134 جفت بازی را تکثیر نمودند که این مقدار برای نمونه‌های کنترل تلقیح شده با پلاسمید pTRV2خالی، 7 عدد از مجموع 10 بوته بود. در مجموع میزان تراریختی در بوته‌های شقایق تلقیح شده با سازه خاموشی و پلاسمید pTRV2خالی به ترتیب 80 و70 درصد بود (شکل 3).

 

 

شکل 3: نتایج PCR بوته‌های تلقیح شده با سازه خاموشی توسط آغازگرهای ژن کد کننده پوشش پروتئینی ویروسی (CP). M: نشانگر با وزن مولکولی مشخص 100bp، C-: کنترل منفی و اعداد بیانگر شماره بوته‌های تراریخت اولیه می‌باشند.

 

نتایج به‏دست آمده نشان داد که راندمان واکنش PCR کمی با استفاده از آغازگرهای طراحی شده حدود 100 درصد بود. قبل از اجرای واکنش‌های real-time RT-PCR، تعداد 10 نمونه از بوته‌های تراریخت اولیه که CP-PCR آن‏ها مثبت بود انتخاب و با استفاده از تکنیک PCR نیمه کمی مورد غربالگری قرار گرفتند. با توجه به نتایج به‏دست آمده و مقایسه بین شدت باندهای تولید شده توسط آغازگرهای ژن DBOX و ژن کنترل داخلی بتا-اکتین، تعداد 5 نمونه ترا ریخت براساس کمترین بیان ژن DBOX  انتخاب شد (شکل 4).

 

 

شکل 4: نتایج PCR کمی بر روی 10 نمونه انتخاب شده با استفاده از آغازگرهای ژن کنترل داخلی بتا-اکتین و آغازگرهای اختصاصی ژن هدف DBOX: C-: گیاه شاهد، CT: گیاه تلقیح شده با pTRV2 خالی و اعداد 1 تا 10 بیانگر شماره بوته‌های تلقیح شده با سازه خاموشی (pTRV2-DBOX) می‌باشند.

 

پس از انتخاب اولیه نمونه‌های ترار یخت با دارا بودن بالاترین خاموشی (کمترین بیان) نسبت به سایر نمونه‌ها، واکنش‌های real-time RT-PCR با استفاده از 2 تکرار تکنیکی و 5 تکرار بیولوژیکی (روی نمونه‌های انتخاب شده براساس PCR نیمه کمی) اجرا شد. کاهش بیان ژن DBOX در نمونه‌های تراریخت انتخاب شده آن نسبت به نمونه‌های شاهد غیر ترا ریخت انتخاب شده به‏طور متوسط حدود 81 درصد بود (شکل 5).

 

 

شکل 5: مقایسه میزان کاهش نسبی بیان ژن DBOX در گیاه تراریخت (pTRV2-DBOX) نسبت به گیاه کنترل (pTRV2خالی). خطوط روی ستون هیستوگرام‌ها نشان دهنده خطای معیار میانگین می‌باشد و ستون‌ها با حروف غیر مشترک، بیانگر معنی‌دار بودن اختلاف میانگین‌ها در سطح 1 درصد با استفاده از آزمون t-student می‌باشد.

 

بحث

هر یک از آلکالوئیدهای بنزیل ایزوکوئینولینی گیاه شقایق، در مسیر بیوسنتزی مختص به خود تولید می‌شوند. در ابتدای چرخه، پاپاورین توسط دو مسیر وابسته به‏هم از ماده میانی اس-کوکلاورین سنتز شده که در انتهای هر دو مسیر، آنزیم DBOX سبب تبدیل تترا هیدرو پاپاورین به پاپاورین خواهد شد (2 و 18). در مراحل پائین‌تر چرخه، تولید ترکیب میانی (S)-scoulerine اولین قدم در سنتز آلکالوئیدهای بنزوفنانتریدین نظیر سنگوینارین محسوب می‏شود. تبدیل (S)-scoulerine به سنگوینارین شامل بسته شدن مسیرهای متیلاسیونی توسط تعدادی سیتوکروم P450 می‌باشد که در مرحله نهایی اکسیداسیون دو الکترون سبب تبدیل دی‌هیدروسنگوینارین به سنگوینارین می‏شود که این واکنش توسط آنزیم DBOX صورت می‌گیرد. علاوه ‌بر این چرخه نهایی تبدیل دی‌هیدروپاپاورین و پاپاورین نیز توسط این آنزیم کاتالیز می‌‏شود. آنزیم DBOX یک فلاوپروتئین از خانواده اکسید-ردوکتازهای وابسته به FAD (FADOX) می‌باشد که ژن‌های کد کننده این گروه از آنزیم‌ها، از جمله ژن‌های مهم و پایه‌ای حیات محسوب می‌شوند که در واکنش‌های متعدد شیمیائی، کاتابولیسم و تولید انرژی سلولی نقش فعالی دارند (17) و به‏نظر می‌رسد که مطالعه این دسته از ژن‌ها با استفاده از روش‌های نوین مهندسی ژنتیک نظیر خاموشی و فوق بیان، به شناخت و درک بهتر آن‏ها کمک بسیار زیادی خواهد کرد.

نتایج پژوهش‌های گذشته نشان می‌دهد که از تکنیک VIGS می‌توان جهت خاموشی ژن‌های مسیرهای متابولیک در بافت‌های مختلف گیاهی استفاده نمود. در همین راستا به‏منظور بررسی 6 آنزیم درگیر در بیوستز پاپاورین مطالعه‌ای با استفاده از تکنیک VIGS و خاموشی ژن‌های کد کننده این آنزیم‌ها اجرا شد (18). تفاوت معنی‌داری در سطوح رونوشت‌های تمام ژن‌های مورد مطالعه مشاهده شد به‏طوری‏که مقدار کاهش بین 30 درصد برای ژن N70MT و 75 درصد برای ژن 7OMT بود.  در مطالعه دیگری که به مطالعه آنزیم‌های درگیر در مسیر بیوسنتز آلکالوئیدهای مورفینان پرداخته است (16)، ژن‌های مورد نظر با استفاده از تکنیک VIGS خاموش شد. نتایج نشان داد که خاموشی دو ژن CODM و T6ODM در مراحل پایانی سنتز این گروه از آلکالوئیدها، سبب کاهش معنی‌دار سطوح رونوشت‌های هر دو ژن گردید و این مقدار کاهش به‏طور متوسط 60 درصد بود. دنگ و فاچینی (21) نشان دادند که خاموشی القا شده توسط VIGS بر روی ژن CYP82V1 سطوح متفاوتی از رونوشت‌های این ژن را در بافت‌های مختلف گیاه شقایق ایجاد می‌کند که به‏طور کلی متوسط این کاهش در کل بافت‌های مورد مورد مطالعه حدود 75 درصد بود. در مطالعه دیگری که توسط گورکوک و همکاران (22) بر روی خاموشی دو ژن 4´OMT  و 7OMT صورت گرفت، توانستند میزان رونوشت‌های این ژن‌ها را به‏ترتیب 71 و 46 درصد در بافت برگ گیاه شقایق کاهش دهند.

در مطالعات متعددی که بر روی خاموشی ژن‌های کد کننده چرخه بیوسنتزی آلکالوئیدهای بنزیل ایزوکوینولینی گیاه شقایق با استفاده از تکنیک VIGS صورت گرفته، کارایی بالای این تکنیک در کاهش رونوشت‌های ژن‌های مورد مطالعه اثبات شده است (16، 18، 21 و 22). نتایج مطالعه حاضر ضمن مشابهت با نتایج مطالعات قبلی، در بیشتر موارد از کارایی بیشتری برخوردار بود به‏طوری‏که سطوح رونوشت‌های ژن مورد مطالعه (DBOX) به مقدار قابل توجهی (81 درصد) کاهش یافته بود که این مقدار در مقایسه با گیاه شاهد بسیار معنی‌دار بود (شکل 5).  در رابطه با میزان موفقیت تلقیح با سازه خاموشی و تولید گیاهان تراریخت، تراریختگی بیش از 70 درصد بود که در مطالعات قبلی این میزان کمتر از 50 درصد (16) گزارش شده است.

تاکنون بیشتر ژن‌های کد کننده آنزیم‌های درگیر در مسیر بیوسنتزی پاپاورین و سنگوینارین از جمله ژن DBOX و عملکرد هر یک از آن‏ها شناسایی شده است. با توجه به عملکرد کلیدی ژن DBOX و موفقیت تکنیک VIGS در کاهش بیان آن، خاموشی این ژن سبب تغییرات قابل توجهی در سطوح دو آلکالوئید سنگوینارین و پاپاورین خواهد شد. علاوه ‌بر کاهش این دو آلکالوئید، نوسکاپین نیز که از آلکالوئیدهای پرکاربرد موجود در شقایق محسوب می‌گردد تحت تاثیر تغییر بیان ژن DBOX قرار گرفته و با کاهش میزان بیان نسخه‌های این ژن، سطوح نوسکاپین نیز کاهش خواهد یافت (17).

نتیجه‌گیری

گیاهان منبع اصلی متابولیت‌های ثانویه با اهداف پزشکی و درمانی محسوب می‌شوند و امروزه تمایل به مصرف گیاهان دارویی و ترکیبات طبیعی موجود در آن‏ها رو به افزایش است (23). گیاه دارویی شقایق به دلیل دارا بودن طیف وسیعی از آلکالوئیدهای مهم و پر کاربرد بنزیل ایزوکوئینولینی (BIAs)، از اهمیت قابل توجهی برخوردار بوده و به‏عنوان تنها منبع تجاری و طبیعی این دسته از آلکالوئیدها محسوب می‌‏شود. استفاده از روش‌های نوین مهندسی متابولیت و دست‏کاری مسیرهای بیوسنتزی گیاهان دارویی نقش ارزنده‌ای در بهبود مسیرهای بیوسنتزی متابولیت‌های ثانویه در گیاهان دارویی بر عهده داشته است (2). استفاده از تکنیک‌های موفق خاموشی ژن، نظیر VIGS، به عنوان ابزاری کار آمد و مناسب برای مطالعات عملکرد ژن‌های مهم و تغییر محتوای ژنتیکی و شیمیایی در گیاهان به‏حساب می‌آید (9).

نتایج مطالعه حاضر بطور کلی نشان داد که استفاده از تکنیک VIGS می‌تواند جهت خاموش نمودن یک ژن و نهایتاً کاهش بیان محصول نهایی آن، موثر و موفق ‌باشد. مزیت‌های تکنیک VIGS از جمله دامنه وسیع میزبانی، عدم ایجاد علائم بیماری‌زایی در گیاهان تیمار شده و کم هزینه بودن آن، سبب شده است که از این تکنیک در مطالعات گوناگون و سطوح مختلف از جمله بررسی عملکردهای ژنی و تغییر مسیرهای ژنتیکی در گیاهان مختلف استفاده شود (9).

منابع

  1. Khan F, Qidwai T, Shukla RK, Gupta V. Alkaloids Derived from Tyrosine: Modified Benzyltetrahydroisoquinoline Alkaloids. In Natural Products. Springer. 2013; 405-460.
  2. Beaudoin GA, Facchini PJ. Benzylisoquinoline alkaloid biosynthesis in opium poppy. Planta. 2014; 240(1): 19-32.
  3. Hagel JM, Facchini PJ. Dioxygenases catalyze the O-demethylation steps of morphine biosynthesis in opium poppy. Nat Chem Biol. 2010; 6: 273-275.
  4. Wink M. Introduction: biochemistry, physiology and ecological functions of secondary metabolites. Ann Plant Rev. 2010; 40: 1-19.
  5. Liscombe DK, MacLeod BP, Loukanina N, Nandi OI, et al. Evidence for the monophyletic evolution of benzylisoquinoline alkaloid biosynthesis in angiosperms. Phytochemistry. 2005; 66(20): 1374-93.
  6. Hagel JM, Facchini PJ. Benzylisoquinoline alkaloid metabolism–a century of discovery and a brave new world. Plant Cell Physiol. 2013; 54(5): 647-672.
  7. Wu S, Chappell J. Metabolic engineering of natural products in plants; tools of the trade and challenges for the future. Curr Opin Biotechnol. 2008; 19(2): 145-152.
  8. Alvarez MA, Marconi PL. 2011. Genetic transformation for metabolic engineering of tropane alkaloids. INTECH Open Access Publisher.
  9. Senthil-Kumar M, Mysore KS. New dimensions for VIGS in plant functional genomics. Trends Plant Sci. 2011; 16(12): 656-665.
  10. Becker A. 2013. Virus-induced gene silencing: methods and protocols. Humana Press New York.
  11. Kalantidis K, Schumacher HT, Alexiadis T, Helm JM. RNA silencing movement in plants. Biol Cell. 2008; 100(1): 13-26.
  12. Kempe K, Higashi Y, Frick S, Sabarna K, et al. RNAi suppression of the morphine biosynthetic gene salAT and evidence of association of pathway enzymes. Phytochemistry. 2009; 70(5): 579-589.
  13. Allen RS, Miller JA, Chitty JA, Fist AJ, et al. Metabolic engineering of morphinan alkaloids by over‐expression and RNAi suppression of salutaridinol 7‐O‐acetyltransferase in opium poppy. Plant Biotechnol J. 2008; 6(1): 22-30.
  14. Allen RS, Millgate AG, Chitty JA, Thisleton J, et al. RNAi-mediated replacement of morphine with the nonnarcotic alkaloid reticuline in opium poppy. Nat Biotechnol. 2004; 22(12): 1559-1566.
  15. Larkin PJ, Miller JA, Allen RS, Chitty JA, et al. Increasing morphinan alkaloid production by over‐expressing codeinone reductase in transgenic Papaver somniferum. Plant Biotechnol J. 2007; 5(1): 26-37.
  16. Wijekoon CP, Facchini PJ. Systematic knockdown of morphine pathway enzymes in opium poppy using virus‐induced gene silencing. Plant J. 2012; 69(6): 1052-1063.
  17. Hagel JM, Beaudoin GA, Fossati E, Ekins A, et al. Characterization of a flavoprotein oxidase from opium poppy catalyzing the final steps in sanguinarine and papaverine biosynthesis. J Biol Chem. 2012; 287(51): 42972-42983.
  18. Desgagné‐Penix I, Facchini PJ. Systematic silencing of benzylisoquinoline alkaloid biosynthetic genes reveals the major route to papaverine in opium poppy. Plant J. 2012; 72(2): 331-344.
  19. Hileman LC, Drea S, Martino G, Litt A, Irish VF. Virus‐induced gene silencing is an effective tool for assaying gene function in the basal eudicot species Papaver somniferum (opium poppy). Plant J. 2005; 44(2): 334-341.
  20. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 2001; 25(4): 402-408.
  21. Dang T-TT, Facchini PJ. Cloning and characterization of canadine synthase involved in noscapine biosynthesis in opium poppy. FEBS Lett. 2014; 588(1): 198-204.
  22. Gurkok T, Ozhuner E, Parmaksiz I, Özcan S, et al. Functional Characterization of 4′ OMT and 7OMT Genes in BIA Biosynthesis. Front Plant Sci. 2016; 7: 98-109.
  23. Gurib-Fakim A. Medicinal plants: traditions of yesterday and drugs of tomorrow. Mol Aspects Med. 2006; 27(1): 1-93.

Hidalgo O, Bartholmes C, Gleissberg S. Virus-induced gene silencing (VIGS) in Cysticapnos vesicaria, a zygomorphic-flowered Papaveraceae (Ranunculales, basal eudicots). Ann Bot. 2012; 109(5): 911-920.

  1. Khan F, Qidwai T, Shukla RK, Gupta V. Alkaloids Derived from Tyrosine: Modified Benzyltetrahydroisoquinoline Alkaloids. In Natural Products. Springer. 2013; 405-460.
  2. Beaudoin GA, Facchini PJ. Benzylisoquinoline alkaloid biosynthesis in opium poppy. Planta. 2014; 240(1): 19-32.
  3. Hagel JM, Facchini PJ. Dioxygenases catalyze the O-demethylation steps of morphine biosynthesis in opium poppy. Nat Chem Biol. 2010; 6: 273-275.
  4. Wink M. Introduction: biochemistry, physiology and ecological functions of secondary metabolites. Ann Plant Rev. 2010; 40: 1-19.
  5. Liscombe DK, MacLeod BP, Loukanina N, Nandi OI, et al. Evidence for the monophyletic evolution of benzylisoquinoline alkaloid biosynthesis in angiosperms. Phytochemistry. 2005; 66(20): 1374-93.
  6. Hagel JM, Facchini PJ. Benzylisoquinoline alkaloid metabolism–a century of discovery and a brave new world. Plant Cell Physiol. 2013; 54(5): 647-672.
  7. Wu S, Chappell J. Metabolic engineering of natural products in plants; tools of the trade and challenges for the future. Curr Opin Biotechnol. 2008; 19(2): 145-152.
  8. Alvarez MA, Marconi PL. 2011. Genetic transformation for metabolic engineering of tropane alkaloids. INTECH Open Access Publisher.
  9. Senthil-Kumar M, Mysore KS. New dimensions for VIGS in plant functional genomics. Trends Plant Sci. 2011; 16(12): 656-665.
  10. Becker A. 2013. Virus-induced gene silencing: methods and protocols. Humana Press New York.
  11. Kalantidis K, Schumacher HT, Alexiadis T, Helm JM. RNA silencing movement in plants. Biol Cell. 2008; 100(1): 13-26.
  12. Kempe K, Higashi Y, Frick S, Sabarna K, et al. RNAi suppression of the morphine biosynthetic gene salAT and evidence of association of pathway enzymes. Phytochemistry. 2009; 70(5): 579-589.
  13. Allen RS, Miller JA, Chitty JA, Fist AJ, et al. Metabolic engineering of morphinan alkaloids by over‐expression and RNAi suppression of salutaridinol 7‐O‐acetyltransferase in opium poppy. Plant Biotechnol J. 2008; 6(1): 22-30.
  14. Allen RS, Millgate AG, Chitty JA, Thisleton J, et al. RNAi-mediated replacement of morphine with the nonnarcotic alkaloid reticuline in opium poppy. Nat Biotechnol. 2004; 22(12): 1559-1566.
  15. Larkin PJ, Miller JA, Allen RS, Chitty JA, et al. Increasing morphinan alkaloid production by over‐expressing codeinone
  16. reductase in transgenic Papaver somniferum. Plant Biotechnol J. 2007; 5(1): 26-37.
  17. Wijekoon CP, Facchini PJ. Systematic knockdown of morphine pathway enzymes in opium poppy using virus‐induced gene silencing. Plant J. 2012; 69(6): 1052-1063.
  18. Hagel JM, Beaudoin GA, Fossati E, Ekins A, et al. Characterization of a flavoprotein oxidase from opium poppy catalyzing the final steps in sanguinarine and papaverine biosynthesis. J Biol Chem. 2012; 287(51): 42972-42983.
  19. Desgagné‐Penix I, Facchini PJ. Systematic silencing of benzylisoquinoline alkaloid biosynthetic genes reveals the major route to papaverine in opium poppy. Plant J. 2012; 72(2): 331-344.
  20. Hileman LC, Drea S, Martino G, Litt A, Irish VF. Virus‐induced gene silencing is an effective tool for assaying gene function in the basal eudicot species Papaver somniferum (opium poppy). Plant J. 2005; 44(2): 334-341.
  21. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 2001; 25(4): 402-408.
  22. Dang T-TT, Facchini PJ. Cloning and characterization of canadine synthase involved in noscapine biosynthesis in opium poppy. FEBS Lett. 2014; 588(1): 198-204.
  23. Gurkok T, Ozhuner E, Parmaksiz I, Özcan S, et al. Functional Characterization of 4′ OMT and 7OMT Genes in BIA Biosynthesis. Front Plant Sci. 2016; 7: 98-109.
  24. Gurib-Fakim A. Medicinal plants: traditions of yesterday and drugs of tomorrow. Mol Aspects Med. 2006; 27(1): 1-93.
 

Hidalgo O, Bartholmes C, Gleissberg S. Virus-induced gene silencing (VIGS) in Cysticapnos vesicaria, a zygomorphic-flowered Papaveraceae (Ranunculales, basal eudicots). Ann Bot. 2012; 109(5): 911-920.