تاثیر نانوذرات کبالت روی بیان ژن‌های دخیل در مسیر بیوسنتز سزامین در کنجد (Sesamum indicum L.)

نوع مقاله: علمی - پژوهشی

نویسندگان

1 کارشناس ارشد، دانشگاه بین‌المللی امام خمینی (ره)، دانشکده فنی و مهندسی، گروه بیوتکنولوژی کشاورزی، قزوین، ایران

2 دانشگاه بین‌المللی امام خمینی (ره)، دانشکده فنی و مهندسی، گروه بیوتکنولوژی کشاورزی، قزوین، ایران

چکیده

هدف: هدف از این پژوهش بررسی تاثیر غلظت‌های مختلف نانوذرات کبالت بر میزان بیان ژن‌های کلیدی دخیل در بیوسنتز سزامین شامل CYP81Q1، CYP81Q2، CYP81Q3 و C3H در کشت سوسپانسیون سلولی کنجد بود. مواد و روش‌ها: ابتدا بهینه‌سازی سوسپانسیون سلولی کنجد انجام شد. برای این منظور از ریزنمونه هیپوکوتیل رقم کرج1، ساکارز، 6/0 میلی‌گرم در لیتر BAP و 3 میلی‌گرم در لیتر NAA استفاده شد. الیسیتور نانوکبالت با غلظت‌های 25/0، 5/0 و 1 میلی‌گرم در لیتر در سوسپانسیون سلولی 18 روزه اعمال شد و نمونه‌برداری در سه زمان 2، 8 و 24 ساعت پس از تیمار صورت گرفت. میزان بیان ژن‌های کلیدی مسیر بیوسنتز سزامین با روش Real-Time qRT-PCR اندازه‌گیری شد. آنالیز داده‏ها و رسم نمودارها با استفاده از  Excel انجام شد. نتایج: نتایج نشان داد که محیط MS حاوی 6/0 میلی‌گرم در لیتر BAP، 3 میلی‌گرم در لیتر NAA و 30 گرم در لیتر ساکارز، دمای ºC26، سرعت شیکر 130 دور در دقیقه و تاریکی برای تولید سوسپانسیون سلولی کنجد با غلظت بالای سلول‌ها شرایط مناسبی هستند. افزودن نانوذرات کبالت به کشت سوسپانسیون منجر به افزایش سطح بیان ژن‌ها در غلظت 5/0 میلی‌گرم در لیتر الیسیتور در زمان‌های مختلف گردید. از آنجائیکه هیچ یک از سطوح مورد استفاده برای غلظت الیسیتور تاثیر منفی روی بیان ژن‌های مذکور نداشتند می‌توان اثر غلظت‌های بالاتر را نیز روی میزان بیان این ژن‌ها بررسی کرد. تاثیر منفی الیسیتور به معنی کاهش بیان ژن‌هاو کاهش میزان سزامین است. نتیجه‌گیری: براساس نتایج حاصل نانوکبالت باعث افزایش بیان ژن‌های دخیل در سنتز سزامین می‌شود و بنابراین، از این الیسیتور می‌توان برای القای بیان بیشتر ژن‌های مذکور استفاده کرد.

کلیدواژه‌ها


مقدمه

گیاهان دارای تنوع وسیعی از متابولیت­های ثانویه هستند که بیشتر آن‏ها مستقیما در رشد و نمو دخالت ندارند. اغلب متابولیت­های ثانویه با قرار گرفتن گیاهان در معرض تنش­های گوناگون تولید می­شوند. کشت سوسپانسیون سلولی شامل توده‌های سلولی پراکنده و در حال رشد در محیط کشت مایع در حال تکان خوردن است. این کشت معمولا با انتقال قطعاتی از کالوس ترد و تمایز نیافته به یک محیط کشت مایع که به‏طور یکنواخت و مداوم تکان داده می‌شود، تهیه می‌شود. از کشت سوسپانسیون سلولی به‏عنوان ابزاری برای مطالعه سنتز بیوشیمیایی مواد طبیعی، تولید نیمه صنعتی برخی از ترکیبات طبیعی و تولید محصولات طبیعی دارویی استفاده می­شود. روغن کنجد از روغن­های نیمه خشک و با مرغوبیت زیاد است و به‏علت کیفیت عالی روغن، بوی مطبوع و مزه خوب آن، کنجد را ملکه دانه­های روغنی می­نامند. همچنین روغن کنجد در مقابل اکسیداسیون بسیار مقاوم می­باشد که این ویژگی مربوط به ترکیب فنلی به‏نام سزامول است. روغن کنجد دارای مقدار زیادی اسیدهای چرب غیراشباع است. با وجود این، در مقایسه با سایر روغن­های خوراکی در مقابل فساد اکسیداتیو بسیار مقاوم است. این پایداری اکسیداتیو تنها به‏دلیل وجود توکوفرول­ها نیست و بیشتر مربوط به لیگنان­ها است. لیگنان­ها از اسیدآمینه فنیل­آلانین و با مزدوج شدن اکسیداتیو p– هیدروکسی­فنیل­پروپان تشکیل می­شوند. در دانه کنجد خام سزامین و سزامولین دو لیگنان اصلی هستند. سزامین دارای خواص ضد سرطان، ضد حساسیت و آنتی­اکسیدانتی می­باشد. این ماده در درمان سرطان پستان، پانکراس، روده، پروستات و ریه موثر است. بسیاری از ژن­های مسیر تولید سزامین شناسایی شده­اند. یکی از ژن­های کلیدی در این مسیر ژن CYP81Q1 است که با افزایش بیان آن در مراحل تشکیل دانه کنجد محتوای سزامین دانه افزایش می‏یابد (1). روشRT-PCR  کمی از حساس­ترین و معتبرترین روش­های اندازه­گیری بیان ژن می­باشد. اساس این روش بر پایه نسبت بیان ژن موردنظر به ژن خانه­دار است. یکی از روش‌های نمایش داده‌هایRT-PCR کمی روش CT مقایسه­ای است که به‏عنوان روش ΔΔCT- 2 (یا FC، (Fold change)، یعنی ژن موردنظر چند برابر ژن خانه­دار بیان شده است) شناخته می‌شود (2). از این روش برای بررسی بیان ژن در نمونه‌های مختلف نسبت به نمونه شاهد استفاده می‌شود (3). از آنجائی‏که گزارش کاملی برای تولید سوسپانسیون سلولی کنجد وجود ندارد هدف از این مطالعه بهینه­سازی شرایط کشت سوسپانسیون سلولی کنجد و سپس بررسی تاثیر الیسیتور نانوکبالت روی میزان بیان ژن­های دخیل در سنتز سزامین در محیط کشت سوسپانسیون سلولی کنجد بود.

 

مواد و روش‏ها

دانه کنجد رقم کرج1 از موسسه تحقیقات اصلاح و تهیه نهال و بذر کرج تهیه شد. در این مطالعه از محیط کشت موراشیگ و اسکوگ (MS) به‏عنوان محیط کشت پایه جهت کشت دانه و تولید گیاه‏چه درون شیشه­ای، کالوس­زایی و تهیه سوسپانسیون سلولی استفاده شد.

دانه­های کنجد ابتدا به‏مدت دو دقیقه در الکل اتانول 70 درصد (v/v) ضدعفونی و سپس به‏مدت 30 دقیقه در هیپوکلریت­سدیم 20 درصد غوطه­ور شد و در نهایت با آب مقطر اتوکلاو شده 3 مرتبه و هر بار به‏مدت دو دقیقه شستشو شد. تمام مراحل ضدعفونی زیر لامینار ایرفلو (laminar air flow) و در ظروف استریل انجام گرفت. پس از ضدعفونی، دانه­ها در شیشه­های حاوی محیط MS فاقد هورمون و حاوی 30 گرم در لیتر ساکارز کشت شدند. pH محیط­های کشت با استفاده از محلول­های NaOH و HCl یک نرمال در 8/5 تنظیم شد. دانه­ها به منظور جوانه­زنی به‏مدت 3 روز در تاریکی نگه‏داری و سپس به اتاق کشت با درجه حرارت 2 ± 25 درجه سانتی‏گراد و دوره­ی نوری 16 ساعت روشنایی و 8 ساعت تاریکی منتقل شدند.

کالوس­زایی کنجد: با توجه به اینکه برای تولید سوسپانسیون سلولی به کالوس با کیفیت بالا نیاز است، کالوس­زایی با استفاده از هورمون‏های NAA، 2,4-D، BAP و Kin به‏صورت آزمایش فاکتوریل در قالب طرح کاملا تصادفی با سه تکرار انجام شد. در این پژوهش از هیپوکوتیل (به‏دو حالت عمودی و افقی) و کوتیلدون رقم کرج1 به‏عنوان ریزنمونه استفاده شد. هر تیمار شامل 3 پتری­دیش و در هر پتری­دیش 7 ریزنمونه قرار داده شد. پس از کشت ریزنمونه­ها در محیط­های کالوس­زایی پتری­های حاوی کشت در شرایط تاریکی در اتاقک رشد با حرارت 2 ± 25 درجه سانتی‏گراد نگه‏داری شدند. واکشت ریزنمونه­ها هر دو هفته یک بار انجام شد. در آزمایش کالوس­زایی صفات وزن تر، رنگ و نوع کالوس مورد بررسی قرار گرفت.

بهینه­سازی محیط کشت سوسپانسیون سلولی کنجد: براساس نتایج حاصل از آزمایش کالوس­زایی، کالوس­های نرم و ترد انتخاب و به محیط مایع MS با ترکیبات مختلف هورمونی منتقل شدند. بعد از دستیابی به بهترین کالوس، آزمایش بهینه‏سازی شرایط سوسپانسیون سلولی انجام شد. در این آزمایش نوع ریزنمونه هیپوکوتیل و کوتیلدون، منبع کربن گلوکز یا ساکارز، نوع و مقدار هورمون­های NAA، Kin، BAP و 2,4-D، تاریکی یا روشنایی و سرعت شیکر مورد بررسی قرار گرفت.

منحنی رشد سوسپانسیون سلولی کنجد: به‏منظور به‏دست آوردن زمان مناسب جهت بازکشت سوسپانسیون سلولی و نیز زمان مناسب برای اعمال الیسیتور، منحنی رشد سلولی برای محیط­های حاوی 6/0 میلی­گرم در لیتر BAP به همراه 3 میلی­گرم در لیتر NAA و 6/0 میلی­گرم در لیتر BAP به همراه 5/2 میلی­گرم در لیتر NAA رسم شد. وزن تر و وزن خشک سلول­ها طی 30 روز (هر دو روز یک بار) یادداشت­برداری شد.

اعمال الیسیتور: برای القای بیان بیشتر ژن­های مسیر سنتز سزامین از الیسیتور نانوکبالت (زیست شیمی آزما رشد) در محیط کشت سوسپانسیون سلولی کنجد استفاده شد. برای این منظور تیمار نانوکبالت با غلظت­های 25/0، 5/0 و 1 میلی­گرم در لیتر در روز هجدهم (فاز لگاریتمی) در کشت سوسپانسیون سلولی اعمال شد. نمونه­برداری در 4 زمان صفر، 2، 8 و 24 ساعت انجام شد. آزمایش تیمار سوسپانسیون سلولی کنجد با الیسیتور نانوکبالت در سه تکرار مجزا صورت گرفت.

استخراجRNA  و سنتز cDNA: نمونه­برداری از کشت­های سلولی در زمان­های صفر، 2، 8 و 24 ساعت بعد از اعمال الیسیتور انجام شد. نمونه­ها در ازت مایع منجمد و تا زمان استخراج RNA کل در فریزر 80- درجه سانتی­گراد نگه‏داری شدند. RNA با استفاده از روش فنل- کلروفرم از سوسپانسیون سلولی استخراج شد (4). برای حذف آلودگی ژنومی از کیت آنزیم DNase І (شرکت سیناکلون) استفاده شد. کیفیت و کمیت RNA با استفاده از ژل الکتروفورز و دستگاه اسپکتروفتومتر بررسی گردید. در این روش میزان جذب نمونه RNA در طول موج­های 260 و 280 نانومتر به‏منظور بررسی کیفیت RNA اندازه­گیری شد. این نسبت برای نمونه­های RNA استخراج شده از سلول­ها، بین 8/1 تا 2 بود که نشانگر کیفیت مطلوب RNA استخراج شده است. cDNA طبق دستورالعمل کیت سنتز cDNA (شرکت سیناکلون) تهیه شد. ترکیبات مورد نیاز برای سنتز  cDNAدر جدول 1 آورده شده است.

درستی سنتز cDNA با استفاده از آغازگر ژن 18S rRNA (ژن خانه­دار) در واکنش PCR مورد تایید قرار گرفت. cDNA به‏دست آمده به‏عنوان الگو برای تکثیر ژن­های موردنظر استفاده شد. 

 

 

جدول 1: مواد مورد نیاز برای سنتز cDNA

حجم (μl 20)

مواد

μl 2/1

Oligo (dT) 100 μM

μg 2

RNA

μl 5/12

DEPC Water

μl  2

reaction buffer 10X

μl 2

dNTPs 10 mM

μl  5/0

Ribolock RNase Inhibitor 2500 u

μl 1

M-MuL V Reverse transcriptase 10000 u

 

 

بررسی بیان ژن­های دخیل در سنتز سزامین با روشRT-PCR  کمی: آغازگرهای الیگونوکلئوتیدی جهت انجام واکنش‫های PCR و RT-PCR  کمی براساس توالی­های موجود ژن­های کنجد در بانک NCBI و با استفاده از نرم­ افزار Oligo5 طراحی شدند. صحت آغازگرهای طراحی شده از لحاظ عدم اتصال غیراختصاصی و دایمر آغازگر، با استفاده از Primer Blast در کل ژنوم و همچنین با PCR مورد تایید قرار گرفت. اطلاعات مربوط به آغازگرهای هر ژن در جدول 2 آورده شده است.

 

 

جدول 2: اطلاعات مربوط به آغازگرهای هر ژن جهت واکنشRT-PCR کمی

طول محصول (bp)

% GC

پرایمر

Tm (ºC)

پرایمر

F/R (5'-3')توالی پرایمرهای رفت و برگشت

شماره دسترسی ژن در NCBI

نام ژن

169

60

50

4/75

9/60

F- TCTCGCTCTCACCTTCGCC

R-CTGGGAGAAGTCGTATAGTG

AB194714

 

CYP81Q1

168

2/63

50

/69

8/62

F-CTCTCGCTCTCACCTTCGC

R- GGGAGCAGTCGTATAGTGTT

AB194715

 

CYP81Q2

162

50

6/52

64

7/65

F- GGGAAGAGATACTATGGGGA

R- AGCCAGCTTCTTCTCCAAC

AB194716.1

CYP81Q3

173

55

6/45

/66

2/65

F- GCCCCCACTATGTTAAGGTC

R- GTATTCACGCAACACCAAAG

AY065995.1

C3H

171

45

45

/65

6/46

F- TCTTAGTTGGTGGAGCGATT

R- GAACATCTAAGGGCATCACA

AJ236041.1

18SrRNA

 

 

واکنش RT-PCR  کمی:میزان بیان چهار ژن دخیل در سنتز سزامین شامل CYP81Q1، CYP81Q2، CYP81Q3 و C3H با روش RT-PCRکمی مورد بررسی قرار گرفت. برای اطمینان از آلوده نبودن ترکیبات به‏کار رفته در این واکنش از کنترل منفی استفاده شد. در این روش از معرف SYBR green (شرکت تاکارای ژاپن) و دستگاه ترمال سایکلر Rotor Gene Q (شرکت کیاژن) استفاده شد. واکنشRT-PCR کمی در میکروپلیت­های 72 چاهکی و در حجم نهایی 15 میکرولیتر انجام شد. مواد استفاده شده در واکنش طبق جدول 3 است. برنامه PCR مطابق جدول ‏4 و در 40 چرخه انجام شد.

 

 

جدول 3: مواد لازم برای انجامRT-PCR کمی

حجم (μl)

مواد

5/7

SYBR green Master Mix (1×)

5/2

cDNA Tamplate (50 ng/ μl)

5/0 + 5/0

Primer (10 pM each) F/R

4

Distillated water

15

Total volume

 

جدول 4: برنامه PCR جهت بررسی بیان ژن­ها

 

چرخه دوم

چرخه اول

متغیرها

منحنی ذوب

طویل شدن

اتصال

واسرشته­سازی

واسرشته­سازی اولیه

 

55 به 94

72

61

94

94

دما (ºC)

5/0 Cº/S (Ramping)

20ثانیه

20ثانیه

10ثانیه

30 ثانیه

زمان

 

 

نتایج

انتخاب کالوس و استقرار سوسپانسیون سلولی

با توجه به این­که برای تهیه سوسپانسیون سلولی به کالوس ترد و شکننده نیاز است کالوس­های ترد و نرم با رنگ زرد مایل به سبز برای تهیه سوسپانسیون سلولی انتخاب شدند (شکل 1، الف).

جهت بهینه­سازی محیط کشت برای تولید سوسپانسیون سلولی با غلظت بالای سلول­ها آزمایش­های مختلفی انجام شد. در آزمایش اول بهترین کالوس­ها از نظر ظاهر برای دو ریز نمونه انتخاب و سوسپانسیون سلولی با همان ترکیبات هورمونی مورد استفاده برای القای کالوس تولید شد. براساس نتیجه آزمایش اول، سوسپانسیون سلولی مطلوبی در هیچ یک از محیط­های استفاده شده به‏دست نیامد، مقدار سلول‏های موجود در کشت سوسپانسیون به‏طور چشمی بسیار کم بود و از این‏رو آزمایش جدیدی طراحی شد. در آزمایش دوم قندهای گلوکز و ساکارز با مقدارهای 20، 30 و 50 میلی­گرم و شرایط تاریکی و روشنایی برای هر دو رقم و هر دو ریزنمونه استفاده شدند. در آزمایش دوم ساکارز 30 میلی­گرم در لیتر و شرایط تاریکی نسبت به سایر آزمایش­های انجام شده وضعیت بهتری داشت، اما این سوسپانسیون سلولی نیز از نظر تعداد سلول­های تکثیر شده مطلوب نبود. در آزمایش سوم بهترین کالوس­های به‏دست آمده از دو ریزنمونه بررسی و برای هر ریزنمونه 8 تیمار با کالوس­زایی مطلوب انتخاب و با به‏کار بردن بهترین کالوس (نرم و زرد روشن) سوسپانسیون سلولی تولید شد. در این آزمایش تیمار 6/0 میلی‏گرم در لیتر BAP و 3 میلی­گرم در لیتر NAA سوسپانسیون مطلوبی را از نظر غلظت سلول­ها تولید کرد. در ادامه برای بررسی این‏که آیا می­توان با غلظت کمتر از این مقدار نیز سوسپانسیون مطلوبی به‏دست آورد، از غلظت 6/0 میلی­گرم در لیتر BAP و 5/2 میلی­گرم در لیتر NAA استفاده شد. براساس نتایج حاصل با غلظت 5/2 میلی­گرم در لیتر NAA نیز می‏توان سوسپانسیون مطلوبی را به‏دست آورد ولی با توجه به این­که بعد از چندین واکشت در این تیمار هورمونی سلول­ها به سمت ریشه‏زایی تمایز پیدا کردند، لذا محیط حاوی 6/0 میلی‏گرم در لیتر BAP به همراه 3 میلی­گرم در لیتر NAA برای تهیه سوسپانسیون سلولی کنجد مورد استفاده قرار گرفت. در این تیمار بعد از گذشت 10 ماه هیچ­گونه تمایززایی مشاهده نشد. از آنجائی‏که هیپوکوتیل رقم کرج1 نسبت به کوتیلدون آن پاسخ مطلوب­تری را نشان داد برای تولید سوسپانسیون سلولی مورد استفاده قرار گرفت.

بررسی رشد سلول­ها در محیط کشت مایع

از سوسپانسیون سلولی در حال رشد هر 2 روز یک بار نمونه‏برداری صورت گرفت و وزن خشک سلول­ها برای رسم منحنی رشد سلولی اندازه­گیری شد. براساس (شکل 1، ب) در روز هجدهم (بیشترین میزان رشد سلولی) الیسیتور به سوسپانسیون سلولی اضافه شد.

با انتقال کالوس­های ترد و نرم به محیط MS تازه با ترکیبات قندی و هورمونی پس از یک ماه سوسپانسیون سلولی مناسبی به‏دست آمد. برای داشتن سوسپانسیون سلولی یکنواخت و غنی از سلول، هر 14 روز یک بار واکشت انجام شد. بدین ترتیب بعد از حدود سه ماه سوسپانسیون سلولی متراکم و یکنواخت جهت تیماردهی تولید شد (شکل 1، ج).

 

 

 

شکل 1: الف) کالوس تولید شده از هیپوکوتیل رقم کرج1 که برای تولید سوسپانسیون سلولی استفاده شد. ب) سوسپانسیون سلولی18 روزه به‏دست آمده از ریزنمونه هیپوکوتیل رقم کرج1 در محیط حاوی 6/0 میلی­گرم در لیتر BAP و 3 میلی­گرم در لیتر NAA. ج) منحنی رشد سلول­ها در محیط حاوی 6/0 میلی­گرم در لیتر BAP و 3 میلی­گرم در لیتر NAA .

 

 

استخراج RNA

RNA از نمونه­های برداشت شده در 3 تیمار زمانی و 3 غلظت الیسیتور براساس روش فنل- کلروفرم استخراج شد. کیفیت RNAهای استخراجی با الکتروفورز نمونه­ها روی ژل آگار(w/v)  5/1 درصد بررسی شد. آلودگی ژنومی نمونه­های RNA با آنزیم DNase І حذف شد. شکل 2 نمونه­های RNA را بعد از تیمار با آنزیم DNase I نشان می­دهد.

 

 

 

شکل 2: RNA نمونه­های تیمار شده با نانوکبالت پس از حذف آلودگی ژنومی

 

 

واکنشRT-PCR کمی

از روشRT-PCR  کمی برای بررسی میزان بیان ژن­های مسیر بیوسنتز سزامین استفاده شد. در این آزمایش میزان بیان ژن­ها در همه نمونه­ها و در 3 تکرار تکنیکی با استفاده از دستگاه Rotor Gene Q بررسی شد. واکنشRT-PCR  کمی در میکروپلیت­های 72 چاهکی و در حجم نهایی 15 میکرولیتر با استفاده از معرف SYBR green انجام شد. نتایج به‏دست آمده از آنالیز منحنی ذوب نشان داد که تکثیر تمام ژن­ها به‏صورت اختصاصی و بدون محصولات غیراختصاصی مثل دایمر آغازگر بود. در این آزمایش جهت اطمینان از عدم وجود آلودگی در ترکیبات مورد استفاده در واکنش از کنترل منفی استفاده شد که نتایج غیرآلوده بودن ترکیبات مورد استفاده را نشان دادند. نرمال‌سازی داده‌های CT مربوط به نمونه‌های مختلف و نمونه شاهد با استفاده از  CTژن مرجع صورت گرفت (ΔCT). سپسΔCT هر نمونه با ΔCT نمونه شاهد کالیبره شد و تغییر بیان ژن­ها به‏صورت -ΔΔCT یا Log2FC گزارش گردید.

مقایسه میانگین بیان ژن­ها

بیان ژن CYP81Q1

 براساس نتایج مقایسه میانگین اثر زمان بر بیان و بدون در نظر گرفتن غلظت الیسیتور، ژن CYP81Q1 بیشترین میزان بیان را 2 ساعت بعد از اعمال الیسیتور داشت. همان‏طور که در شکل 3 مشاهده می­شود اعمال الیسیتور پس از 2، 8 و 24 ساعت باعث افزایش بیان ژن CYP81Q1 در مقایسه با نمونه شاهد شد. بین دو زمان 8 و 24 ساعت اختلاف معنی­داری در بیان این ژن مشاهده نشد (شکل 3، الف).

بررسی اثر غلظت­های مختلف الیسیتور بر بیان ژن CYP81Q1 نشان داد که صرف نظر از زمان، بیشترین تغییر در بیان این ژن در غلظت 5/0 میلی­گرم در لیتر نانوکبالت به‏دست آمد. براساس نتایج مقایسه میانگین اثر غلظت بر بیان ژن، با اعمال 1 میلی­گرم در لیتر نانوکبالت تغییر معنی­داری در میزان بیان ژن نسبت به نمونه شاهد مشاهده نشد (شکل 3، ب).

در مقایسه میانگین اثر متقابل غلظت در زمان، بیشترین تغییر در بیان ژن، در زمان 2 و 8 ساعت به‏ترتیب بعد از اعمال 25/0 و 1میلی‏گرم در لیتر نانوکبالت حاصل شد. اعمال الیسیتور در غلظت­ها و زمان­های مختلف باعث افزایش بیان ژن CYP81Q1 نسبت به نمونه شاهد گردید (شکل 3، ج).

 

 

 

 

 

 

 

 

 

 

 

 

ب

 

الف

 

ج

 شکل 3:  الف) بیان ژن CYP81Q1 در تیمارهای زمانی مختلف الیسیتور. ب) بیان ژن CYP81Q1 در غلظت­های مختلف الیسیتور. ج) اثر متقابل غلظت در زمان بر بیان ژن CYP81Q1.

 

 

بیان ژن  CYP81Q2

 براساس نتایج مقایسه میانگین اثر زمان بر بیان ژن CYP81Q2 بدون در نظر گرفتن غلظت نانوکبالت بیشترین میزان بیان این ژن 24 ساعت بعد از اعمال الیسیتور نسبت به سایر زمان­ها و همچنین نمونه شاهد تعیین شد. با توجه به (شکل 4، الف) بین بازه­های زمانی بررسی بیان ژن بعد از اعمال الیسیتور اختلاف معنی­دار مشاهده شد.

افزودن الیسیتور در غلظت­های 25/0، 5/0 و 1 میلی­گرم در لیتر باعث افزایش بیان ژن CYP81Q2 نسبت به بیان آن در نمونه شاهد شد. تفاوت معنی­دار بین اثر غلظت­های 25/0، 5/0 و 1 میلی­گرم در لیتر بر بیان این ژن مشاهده شد ولی غلظت 1 میلی­گرم در لیتر الیسیتور تاثیر معنی­داری روی بیان ژن CYP81Q2 نسبت به شاهد نداشت (شکل 4، ب).

در مقایسه میانگین اثر متقابل غلظت در زمان، بیشترین میزان بیان ژن در زمان 8 ساعت بعد از اعمال 1 میلی­گرم در لیتر الیسیتور تعیین شد. اعمال الیسیتور در غلظت­ها و زمان­های مختلف باعث افزایش بیان ژنCYP81Q2  نسبت به نمونه شاهد گردید (شکل 4، ج). به‏طورکلی اعمال الیسیتور نانوکبالت باعث افزایش بیان ژن CYP81Q2 نسبت به نمونه شاهد شد.

 

 

 

 

 

ب

 

الف

 

ج

شکل 4: الف) اثر زمان بر بیان ژن CYP81Q2. ب) اثر غلظت الیسیتور بر بیان ژن CYP81Q2. ج) اثر متقابل غلظت در زمان بر بیان ژن CYP81Q2.

 

 

 بیان ژن CYP81Q3

 نتایج مقایسه میانگین اثر زمان بر بیان ژن CYP81Q3 نشان داد که بدون در نظر گرفتن غلظت الیسیتور در زمان­های 2، 8 و 24 ساعت بعد از اعمال الیسیتور نسبت به نمونه شاهد بیان این ژن افزایش یافت. با توجه به (شکل 5، الف) میزان بیان این ژن در بازه­های زمانی بعد از اعمال الیسیتور اختلاف معنی­دار نداشت.

افزودن الیسیتور نانوکبالت در غلظت­های 25/0، 5/0 و 1 میلی­گرم در لیتر باعث افزایش بیان ژن CYP81Q3  نسبت به نمونه شاهد شد. یشترین میزان بیان ژن CYP81Q3 بدون در نظر گرفتن زمان، با افزودن 5/0 میلی­گرم در لیتر الیسیتور حاصل شد (شکل 5، ب).

در مقایسه میانگین اثر متقابل غلظت در زمان، بیشترین میزان بیان ژن، در زمان 24 ساعت بعد از اعمال 25/0 میلی­گرم در لیتر الیسیتور تعیین شد. همان­طور که در شکل 5 مشاهده می‏شود اعمال الیسیتور در غلظت­ها و زمان­های مختلف باعث افزایش بیان ژن CYP81Q3 نسبت به نمونه شاهد گردید (شکل 5، ج).

 

 

 

ب

 

الف

 

ج

شکل 5: الف) اثر زمان بر بیان ژن CYP81Q3. ب) اثر غلظت الیسیتور بر بیان ژن CYP81Q3. ج) اثرات متقابل غلظت در زمان بر بیان ژن CYP81Q3.

 

 

بیان ژن C3H

 بر اساس نتایج مقایسه میانگین داده­هایRT-PCR کمی اثر زمان، غلظت و اثر متقابل زمان در غلظت الیسیتور معنی­دار شده است. نتایج مقایسه میانگین اثر زمان بر بیان ژن C3H نشان داد که اعمال الیسیتور نانوکبالت در زمان­های 2، 8 و 24 ساعت باعث افزایش میزان بیان ژن C3H در مقایسه با نمونه شاهد می­شود. با وجود این، بین زمان­های2، 8 و 24 ساعت اختلاف معنی­داری در افزایش بیان ژن مشاهده نشد (شکل 6، الف).

هرچند افزودن الیسیتور نانوکبالت در غلظت­های 25/0، 5/0 و 1 میلی­گرم در لیتر باعث افزایش بیان ژن C3H  نسبت به نمونه شاهد شد ولی بیشترین میزان بیان ژن C3H بدون در نظر گرفتن زمان، با افزودن 5/0 میلی­گرم در لیتر الیسیتور تعیین شد (شکل 6، ب)

در مقایسه میانگین اثر متقابل غلظت در زمان، بیشترین بیان ژن در زمان 2 ساعت بعد از اعمال 5/0 میلی­گرم در لیتر الیسیتور حاصل شد. همان­طور که در شکل 6 مشاهده می­شود کمترین میزان بیان ژن C3H در زمان 8 ساعت بعد از اعمال 25/0 میلی­گرم در لیتر الیسیتور حاصل شد که از میزان بیان ژن در نمونه شاهد نیز کمتر بود (شکل 6، ج).

 

 

 

 

 

ب

 

الف

 

ج

شکل 6: الف) اثر زمان بر بیان ژن C3H. ب) اثر غلظت الیسیتور بر بیان ژن C3H. ج) اثر متقابل غلظت در زمان بر بیان ژن C3H

 

 

 

بحث

در این تحقیق محیط­ها و شرایط کشت مختلفی برای دستیابی به محیط کشت غنی از سلول مورد بررسی قرار گرفت که از میان آن‏ها بیشترین میزان تقسیم سلولی در محیط دارای 6/0 میلی­گرم در لیتر BAP به‏همراه 3 میلی­گرم در لیتر NAA مشاهده شد. میزان بالای اکسین مورد نیاز احتمالا به‏دلیل پایین بودن اکسین داخلی در این گیاه است. رشد و تکثیر سلول­ها در دمای 26 درجه سانتی‏گراد، تاریکی و سرعت 130 دور در دقیقه به بالاترین میزان رسید که بیانگر فعالیت حداکثر ژن­های کنترل کننده چرخه سلولی تحت این شرایط است. در بررسی تیمارهای مختلف نانوکبالت در غلظت­ها و بازه­های زمانی مختلف به طور جداگانه، افزایش بیان ژن CYP81Q1 نسبت به نمونه شاهد مشاهده شد. با توجه به نتایج مقایسه میانگین، الیسیتور نانوکبالت باعث افزایش بیان ژن CYP81Q1 می­شود، بنابراین با توجه به این­که این ژن از ژن­های اصلی مسیر سنتز سزامین می­باشد می­توان گفت که با اعمال این الیسیتور بیان این ژن افزایش می­یابد و احتمال می­رود که تولید لیگنان سزامین نیز بیشتر شود که باید اندازه­گیری گردد. براساس نتایج بیشترین میزان بیان ژن CYP81Q1 در غلظت 5/0 میلی­گرم در لیتر و2 ساعت بعد از اعمال نانو ذره کبالت تعیین شد و سپس در بازه زمانی 8 و 24 ساعت بعد از تیماردهی بیشترین تغییر در میزان بیان این ژن مشاهده شد. با توجه به منحنی رشد سلول­ها (شکل 1، ج) در بازه زمانی روز هجدهم تا بیستم سلول­ها در مرحله رشد لگاریتمی هستند و از روز بیستم به بعد وارد فاز سکون و سپس مرگ می­شوند. از آنجا که الیسیتورها درروز هجدهم اعمال شد و با توجه به این‏که افزایش بیان ژن تا 24 ساعت بعد از اعمال الیسیتور یعنی روز نوزدهم اتفاق افتاده است، می­توان نتیجه گرفت که بهترین زمان برای اعمال الیسیتور جهت القای بیان ژن­های مسیر سنتز سزامین، قبل از وارد شدن سلول­ها به فاز سکون است. در تحقیقات انجام شده توسط میتوفر و همکاران (5) فلزاتی مانند کبالت، نیکل، آهن و نقره باعث تحریک تولید دامنه وسیعی از متابولیت­های ثانویه در گیاهان می­شوند. ترجو و همکاران (6) تاثیر پنج نانوذره مس، کبالت، آهن، منگنز و مولیبدن را در تولید بتالانین و رشد سوسپانسیون سلولی گیاه چغندرقند (Beta vulgaris) بررسی کردند. آن­ها به این نتیجه رسیدند که با افزایش کبالت از 1 میکرومولار به 5 میکرومولار می­توان بتالانین را تا 60 درصد افزایش داد (بیشترین میزان افزایش متابولیت) اما غلظت­های بیشتر کبالت (10 تا 20 میکرومولار) باعث افزایش متابولیت و رشد سلولی نشد. براساس نتایج مثبت اثر کبالت بر تولید متابولیت­های ثانویه سایر گیاهان همچنین افزایش تولید سزامین در اثر تحریک با این الیسیتور در تحقیق حاضر می­توان نتیجه­گیری کرد که با افزودن الیسیتور نانوکبالت به محیط سوسپانسیون سلولی می‫توان میزان بیان ژن CYP81Q2 را افزایش داد. ژن CYP81Q2 از ژن­های مسیر تولید سزامین در گونه Sesamum radiatum و از همولوگ­های ژن CYP81Q1 است. در مقایسه میانگین اثر متقابل غلظت در زمان، بیشترین بیان ژن، در بازه زمانی 8 ساعت بعد از اعمال 1 میلی­گرم در لیتر الیسیتور حاصل شد. دو ژن همولوگ CYP81Q2 و CYP81Q1 به‏دو گونه مجزا تعلق دارند و رقم ایرانی کرج1 دارای هر دو ژن می­باشد و با اعمال الیسیتور می­توان میزان بیان این دو ژن را در این رقم افزایش داد. ژن CYP81Q3 از ژن­های گزارش شده در گونه Sesamum alatum است. این ژن نیز از هومولوگ­های ژن CYP81Q1 است ولی در مسیر سنتز سزامین فعالیتی شبیه به فعالیت CYP81Q1 و CYP81Q2 نشان نمی­دهد. اعمال الیسیتور باعث افزایش بیان این ژن نسبت به نمونه شاهد شد. در بررسی اثر متقابل متغیرها بیشترین میزان بیان این ژن در غلظت 25/0 میلی­گرم در لیتر و 24 ساعت بعد از اعمال الیسیتور نانوکبالت مشاهده شد. این مقدار کمترین سطح الیسیتور است که پس از یک شبانه روز باعث افزایش بیان ژن شده است. این موضوع نشان می­دهد که نوع الیسیتور و غلظت مورد استفاده آن جهت تغییر در میزان بیان ژن­ها مؤثر است. پوتالون و همکاران (7) نیز با اضافه کردن 150 میلی­گرم در لیتر کایتوزان به کشت ریشه­ی مویین گیاه آرتمیزیا (Artemisia annua) میزان تولید آرتمیزنین را تا 6 برابر افزایش دادند. نتایج بررسی اثر الیسیتور بر افزایش بیان ژن C3H نشان داد که با افزودن الیسیتور به محیط سوسپانسیون سلولی می‏توان میزان بیان این ژن را افزایش داد. در مقایسه میانگین اثر متقابل غلظت در زمان، بیشترین بیان ژن در زمان 2 ساعت بعد از اعمال 5/0 میلی­گرم در لیتر الیسیتور حاصل شد. افزودن 25/0 میلی­گرم در لیتر الیسیتور بعد از 8 ساعت منجر به کاهش بیان این ژن شد. سایر تیمارهای زمانی و غلظت­های مختلف الیسیتوری منجر به افزایش بیان این ژن شدند. مسیر فنیل­پروپانوئید در گیاهان منجر به تولید لیگنان­ها و فلاونوئیدها می­شود. ژن C3H از ژن­های کلیدی در مسیر فنیل­پروپانوئید است که کافئیل­شیکیمات را به P- کوماریل­شیکیمات تبدیل می­کند. این ترکیب در ادامه­ی مسیر به لیگنان­های گروه S و G تبدیل می­شود. بنابراین می­توان گفت با افزایش بیان این ژن شاید بتوان تولید لیگنان سزامین را افزایش داد. بهابادی و همکاران (8) اثر عصاره قارچ Sclerotinia sclerotiorum را به‏عنوان الیسیتور بر میزان ژن­های کلیدی مسیر بیوسنتزی فنیل­پروپانوئیدها در کشت سلولی گیاه دارویی کتان (Linum album) بررسی کردند. مطالعه بیان ژن­ها با روشRT-PCR کمی نشان داد که بیان ژن­های فنیل­آلانین­آمونیالیاز، سینامیل­الکل­دهیدروژناز و سینامیل­کوآنزیم­آ ردوکتاز که در مراحل ابتدایی مسیر بیوسنتزی پودوفیلوتوکسین نقش دارند و همچنین بیان پینورزینول­لاریسی­رزینول­ردوکتاز، ژن کلیدی در مسیر بیوسنتز لیگنان­ها، بعد از افزودن عصاره قارچ به محیط کشت به طور معنی­داری افزایش یافت. بیشترین میزان فعالیت آن­ها بعد از گذشت دو تا سه روز مشاهده شد.

به‏طورکلی محیط پایه MS حاوی 6/0 میلی­گرم در لیتر BAP، 3 میلی­گرم در لیتر NAA و 30 گرم در لیتر ساکارز، دمای 26 درجه سانتی‏گراد، سرعت شیکر 130 دور در دقیقه و تاریکی برای دستیابی به تولید سوسپانسیون سلولی کنجد با غلظت بالای سلول­ها توصیه می­شوند. افزایش سطح بیان هر چهار ژن مورد مطالعه در غلظت 5/0 میلی­گرم در لیتر الیسیتور ولی در زمان­های مختلف رخ داد. همچنین مشخص گردید که هیچ یک از سطوح مورد استفاده برای غلظت الیسیتور تاثیر منفی روی بیان ژن­ها نداشتند و از این‏ر‏و می­توان اثر غلظت­های بالاتر را مورد بررسی قرار داد. براساس رابطه مستقیم موجود بین بیان ژن­های مسیر تولید سزامین و میزان تولید این ماده، تاثیر منفی الیسیتور روی بیان این ژن­ها (کاهش بیان این ژن­ها) به معنی کاهش میزان سزامین است.

 

نتیجه­گیری

براساس نتایج حاصل از این پژوهش الیسیتور نانوکبالت باعث افزایش بیان ژن­های دخیل در سنتز سزامین شامل CYP81Q1، CYP81Q2، CYP81Q3 و C3Hدرکشتسوسپانسیون سلولی کنجد می­شود و بنابراین از این الیسیتور می­توان برای افزایش بیان ژن‏های مذکور استفاده کرد.

 

تشکر و قدردانی

از همکاری کارشناسان محترم آزمایشگاه­های کشت بافت و بیولوژی مولکولی گروه بیوتکنولوژی دانشگاه بین­المللی امام خمینی (ره) و گروه بیوتکنولوژی پردیس کشاورزی دانشگاه تهران تشکر و قدردانی می­شود.

  1. Hata N, Okazawa A, Ono E. Comparison of sesamin contents and CYP81Q1 gene expressions in aboveground vegetative organs between two Japanese sesame (Sesamum indicum L.) varieties differing in seed sesamin contents. Plant Science. 2010; 178: 51-60.
  2. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT Method. Methods. 2001; 25(4): 402-408.
  3. Khodadadi A, Hamidi NM, Ghaforian M. Mohammadi AJ. Evaluation of real-time PCR efficiency by the use of two strategies: standard curve and linear regression. Jundishapur Scientific Medical Journal. 2012; 1(76): 85-95.
  4. Kansal R, Kuhar K, Verma I, Gupta RN, et al. Improved and convenient method of RNA isolation from polyphenols and polysaccharide rich plant tissues. Indian Journal of Experimental Biology. 2008; 47: 842-845.
  5. Mithöfer A, Schulze B, Boland W. Biotic and heavy metal stress response in plants: evidence for common signals. FEBS Letters. 2004; 566(1): 1-5.
  6. Trejo-Tapia G, Jimenez-Aparicio A, Rodriguez-Monroy M, De Jesus-Sanchez A, et al. Influence of cobalt and other microelements on the production of betalains and the growth of suspension cultures of Beta vulgaris. Plant Cell, Tissue and Organ Culture. 2001; 67(1): 19-23.
  7. Putalun W, Luealon W, De-Eknamkul W, Tanaka H, et al. Improvement of artemisinin production by chitosan in hairy root cultures of Artemisia annua L. Biotechnology Letters. 2007; 29(7): 1143-1146.
  8. Bahabadi SE, Sharifi M, Safaie N, Murata J, et al. Increased lignan biosynthesis in the suspension cultures of Linum album by fungal extracts. Plant Biotechnology Reports. 2011; 5(4): 367-73.