Editorial

Authors

Abstract

Aim:Recently, attention has been diverted to the pluripotency characteristic of Spermatogonia Stem Cells (SSCs) in in-vitro culture. The aim of this study was to evaluate the morphological and molecular genetics changes of differentiated SSCs to Embryonic-like Stem cell (ESC). Material and Methods: The SSCs were collected from neonatal mouse testis via a two-step mechanical and enzymatic digestion and cultured in DMED containing 15% FBS.  ES-like cells colonies was appeared in the fifth passage. The expression of pluripotency and spermatogonia specific genes; Nanog, SOX2, Klf4, Stra8, DAZL, Plzf as well as the expression of puripotency markers Oct4 and Alkaline Phosphatase Activity (ALP) of ESC respectively was investigated using RT-PCR and immunocytochemical techniques and compared with ESCs. Results: The pluripotent characteristic of ES-like cells derived from SSCs was confirmed based on morphological investigation and high expression of ALP as well as pluripotency marker Oct4. The expression of specific spermatogonia genes like Stra8, DAZL, Plzf was decreased and the expression of pluripotency genes such as  Nanog, SOX2, Klf4  was increased during the differentiation of SSCs to ES-like cells. Conclusion: In vitro culture of SSCs was conformed to induced ES-like cells. This process was accompanied by wide alteration in molecular profile expression of specific spermatogonia and pluripotency genes. In over all, SSCs can be considered as an opening window to generate pluripotent stem cell.

Keywords

مقدمه

سلول‏های بنیادی اسپرماتوگونی(Spermatogonial Stem Cells, SSCs)  از طریق گامت‏زایی اطلاعات ژنتیکی را از نسلی به نسل دیگر منتقل می‏کنند (1). علی‏رغم انتقال اطلاعات ژنتیکی که مهم‏ترین عمل سلول‏های بنیادی اسپرماتوگونی است. مطالعات جدید الگوی تکاملی دیگری را نیز برای این سلول‏ها در نظر می‏گیرند (2). سلول‏های اسپرماتوگونی پس از کشت در محیط In vitro کلونی‏های سلولی ES-like cells) (Embryonic Stem like cells, را شکل می‏دهند که این سلول‏ها به سلول‏های بنیادی جنینی ESCs)  (Embryonic stem cell, شبیه هستند و دارای قابلیت خودترمیمی (Self-renewal) و تولید هر سه نوع لایه زایای اکتودرمی، مزودرمی و آندودرمی می‏باشند (3).

طی تبدیل شدن سلول‏های اسپرماتوگونی به سلول‏های ES-like cells بیان ژن‏ها دستخوش تغییرات گسترده‏ای می‏گردند به‏طوری‏که برخی از ژن‏های پر توانی نظیر ,SOX2,SSEA1 Nanog ،C-myc و Oct4 افزایش می‏یابد که برای برنامه ریزی مجدد  (Reprogramming) فیبروبلاست به‏مرحله پر توانی ضروری است )4). در حالی‏که بیان مارکرهای اختصاصی سلول‏های اسپرماتوگونی شامل Stra8، ,DAZLPlzf کاهش می‏یابد (5).

نظریه‏ی خاصیت پرتوانی سلول‏های اسپرماتوگونی برای نخستین‏بار در سال 2004 پس از کشت سلول‏های بنیادی اسپرماتوگونی موش تازه متولد شده عنوان شد (6).  محققان دیگر پس از کشت سلول‏های اسپرماتوگونی موش بالغ ES-like cells حاصله را به انواع مختلف سلولی تمایز دادند (7). همچنین نتایج مشابهی پس از کشت سلول‏های اسپرماتوگونی انسانی به‏دست آمد (8).

امروزه استراتژی‏های سلول درمانی فعالیت تکثیری گسترده و پرتوانی سلول‏های بنیادی اسپرماتوگونی را پیشنهاد می‏دهد (9). در واقع این سلول‏ها می‏توانند به حد کافی تکثیر و گسترش یابند که منبع کافی جهت تولید سلولی برای درمان بسیاری از بیماری‏ها و ضایعات ژنتیکی فراهم آورند (10).

منشا سلول‏های بنیادی اسپرماتوگونی سلول‏های اپی‏بلاست جنینی هستند که این سلول‏ها تحت القای BMP4) (Bone Morphogenetic Protein 4, وارد مرحله اختصاصی شدن می‏شوند (11). سپس این سلول‏ها به مزودرم خارج رویانی مهاجرت کرده و در گناد در حال تکامل به سلول‏های رده اسپرماتوگونی تمایز می‏یابند (12و13). سلول‏های بنیادی اسپرماتوگونی مارکرهای ویژه را نظیر Stra8 ,Plzf ,Dazl را بیان می‏کنند که از این مارکرها به‏عنوان مارکرهای اختصاصی اسپرماتوگونی جهت جداسازی این سلول‏ها استفاده می‏شود (14). علاوه بر این تحقیقات جدید نشان می‏دهد که سلول‏های اسپرماتوگونی دارای پتانسیل تشکیل کلونی‏های سلولی ES-like cells تحت شرایط محیط کشت in vitro و حتی بدون دستکاری‏های ژنتیکی می‏باشند (15). این کلونی‏ها از نظر مورفولوژی بسیار شبیه کلونی‏های سلولی بنیادی جنینی هستند. این کلونی‏ها مشابه کلونی‏های مشتق شده از سلول‏های بنیادی جنینی دارای قابلیت خودترمیمی و تولید هرسه نوع لایه زایای جنینی می‏باشند )16-19).

در همین راستا نتایج تحقیقات Huang  و Glasser (20و21) نیز موید ظهور کلونی سلول‏های ES-like cells پس از کشت سلول‏های اسپرماتوگونی بودند که این کلونی‏ها از نظر مورفولوژی مشابه سلول‏های ES-like cells  بوده و مارکرهای پرتوانی و میزان بالای از فعالیت آلکالین فسفاتاز را خود بیان کردند. با توجه به گزارشات مذکور و اهمیت استفاده از سلول‏های اسپرماتوگونی به‏عنوان یک منبع سلولی جدید برای تولید و دستیابی به سلول‏های پرتوان، لذا تحقیقات بیشتری در زمینه کشت سلول‏های اسپرماتوگونی و تولید سلول‏هایES-like cells  ضروری به‏نظر می‏رسد. بنابراین هدف از تحقیق حاضر تولید سلول‏ها ES-like cells پس از کشت سلول‏های اسپرماتوگونی و بررسی تغییرات مورفولوژی و ژنتیکی حاصله در این سلول‏ها و مقایسه با سلول‏های اسپرماتوگونی و سلول‏های بنیادی جنینی است.

 

مواد و روش‏ها

تهیه و جداسازی سلول‏های اسپرماتو گونی:در این تحقیق از سلول‏ها‏ی اسپرماتوگونیموش نوزاد 2 تا 4 روز استفاده شد. بدین ترتیب سلول‏های اسپرماتوگونی از بیضه موش نوزاد توسط دو مرحله هضم مکانیکی و آنزیمی جداسازی می‏شوند (22).

مرحله اول هضم مکانیکی: در این مرحله پس از جداسازی کپسول، بیضه‏های موش های نوزاد 2 تا 4 روزه نژاد NMRIدر محیط کشت حاوی آنزیم‏های لازم جهت هضم آنزیمی به‏طور مکانیکی قطعه قطعه و به مدت 1 ساعت در دمای 37 درجه سانتی‏گراد انکوبه شد. در طی این مدت محیط حاوی بیضه‏ها، هر 10 دقیقه یک بار به آرامی و توسط سمپلر به‏مدت 1 دقیقه به‏هم زده می‏شد. پس از 1 ساعت، محیط حاوی سلول‏ها و قطعات لوله‏های منی‏ساز به‏مدت 5 دقیقه با سرعت RPM1200 سانتریفیوژ شده و محیط بالای رسوب ته لوله با محیط DMEM تازه جایگزین شد. این‏کار باعث حذف بافت بینابینی، از قطعات بیضه شد. حاصل اولین مرحله هضم آنزیمی در انتهای این مرحله قطعات لوله‏های منی‏ساز بودند که برای هضم بیشتر وارد مرحله دوم هضم آنزیمی شدند.

مرحله دوم هضم آنزیمی: به‏منظورجدا شدن سلول‏ها از قطعات لوله‏های منی‏ساز حاصل از اولین مرحله هضم آنزیمی، لوله‏ها در محیطی مشابه مرحله اول به‏مدت 1 ساعت در دمای 37 درجه سانتی‏گراد انکوبه شدند. در طی این مدت هر 10 دقیقه یک بار، محلول حاوی لوله ها توسط سمپلر و به‏مدت یک دقیقه به‏منظور خرد شدن تجمعات سلولی موجود در تعلیق تا حد امکان به‏طور کامل هم زده شد. در انتهای زمان انکوباسیون تعلیق فوق جهت جداسازی قطعات هضم نشده با سرعت معادل  rpm400 و به‏مدت 5 دقیقه سانتریفیوژ شد. قطعات هضم نشده لوله‏های منی‏ساز در ته لوله رسوب کرده و سلول‏های منفرد و برخی از تجمعات سلولی در بالای تعلیق قرار گرفتند. مایع سلولی بالای رسوب از فیلترهای نایلونی 70 میکرومتر عبور داده شد. تعلیق حاصل عمدتا حاوی سلول‏های سرتولی، اسپرماتوگونی بود که در مراحل بعدی از یکدیگر جدا شدند (22).

جداسازی سلول‏های سرتولی: جداسازی سلول‏های سرتولی از تعلیق سلولی حاصل از مرحله دوم هضم آنزیمی با استفاده از روش اسکارپینو و همکاران (22) انجام شد. برای این منظور از 5  میکرو گرم بر میلی‏لیتر لکتین داچورا استرامونیوم اگلوتینین (DSA, Sigma, USA) در بافر فسفات استفاده شد پتری دیش حاوی این محلول به‏مدت یک ساعت در دمای 37 درجه سانتی‏گراد انکوبه شد. پس از شستشوی پتری دیش با بافر فسفات سالین (Phosphate Buffered Saline, PBS) حاوی 5/0 درصد سرم آلبومین گاوی (Bovine Serum Albumin,BSA) محصولات شرکت Sigma تعلیق سلولی به پتری دیش پوشیده با لکتین DSA منتقل شده و به‏مدت یک ساعت در دمای 32 درجه سانتی‏گراد و فشار 5 درصد CO2، انکوبه شد. پس از یک ساعت انکوباسیون سلول‏های شناور به‏عنوان سلول‏های اسپرماتوگونی در نظر گرفته شدند درحالی‏که سلول‏های چسبیده به کف پتری به‏عنوان سلول‏های سرتولی شناخته شدند. (22).

 کشت سلول‏های اسپرماتوگونی: سلول‏های اسپرماتوگونی در محیط  ES medium که حاوی DMEM، FBS 15 درصد، (1000 IU/ml; Chemicon) LIF، 1 درصد اسید‏های آمینه غیر ضروری، بتا مرکاپتواتانول mM1 و 1 درصد پنی سیلین/ استرپتومایسین بوده  کشت داده شدند. پاساژ سلول‏های اسپرماتوگونی هر سه روز یک‏بار و با استفاده از تریپسین-EDTA و پیپتاز انجام شد. در هر گروه به تعداد پنج بار مراحل کشت سلولی تکرار شد.

ایجاد ES-like cell: سلول‏های اسپرماتوگونی در محیط   ES mediumبه‏مدت دو تا سه هفته کشت داده شدند. سلول‏ها هر هفته دو بار پاساژ داده شده و در پاساژ پنجم معادل هفته 3  کشت کلونی‏های ES-like cells حاصل شد.

کشت سلول بنیادی جنینی موش(ESC) : در پژوهش فوق از رده سلولی بنیادی جنینی موشی (CGR8) مشتق از گونه موش SV/129،  اهدائی از طرف دکتر سلیمانی (دانشگاه تربیت مدرس) استفاده شد. کشت اولیه سلول‏های بنیادی جنینی در محیط کشتES mediumبوده که پس ازبررسی سلول‏ها در زیر میکروسکوپ، به‏صورتروزانهتعویض محیط کشت انجام شد

 ارزیابی سلول‏هایES-like Cells : در مطالعه حاضر سعی شد با به‏کارگیری روش‏های متفاوتی حضور سلول‏های ES-like cells حاصله مشخص گردید که شامل ارزیابی‏های مورفولوژیک، ایمونوسیتوشیمی و مولکولی بود. ماهیت پر توانی سلول‏های ES-like cells از طریق مقایسه با سلول‏های بنیادی جنینی ذکر شده به‏عنوان کنترل مثبت انجام شد. 

ارزیابی‏های مورفولوژیک: پس از گذشت 3 تا 4 روز از کشت سلول‏های اسپرماتوگونی به‏تدریج کلونی‏های اسپرماتوگونی ظاهر شدند. این کلونی‏ها از نظر ویژگی‏های مورفولوژیک و شکل ظاهری توسط میکروسکوپ معکوس مورد ارزیابی قرار گرفتند. همچنین کلونی‏های ES-like cells حاصله از کشت سلول‏های اسپرماتوگونی در هفته چهارم نیز از نظر ویژگی مذکور مجددا مورد ارزیابی و مقایسه با کلونی های سلولی اسپرماتوگونی و ESC قرار گرفتند.

  هیستوشیمی آلکالین فسفاتاز: برای ارزیابی آلکالین فسفاتاز (Sigma) ابتدا سلول‏های حاصل از کلونی‏های اسپرماتوگونی، ES-like cells و سلول بنیادی جنینی به‏وسیله PBS سه مرتبه شستشو شدند. ابتدا سلول‏ها در محلول تثبیت کننده که حاوی استن، فرمالدئید و سیترات به‏مدت 10 دقیقه فیکس شدند. در مرحله بعد سلول‏ها توسط محلول Tris 0.1 M دو مرتبه شستشو داده شدند. سپس سلول‏های فیکس شده در محلولی که حاوی Violet (Sigma) 0.5 mg/ml Fast Red و 40 μl/ml Naphtol Phosphate به مدت 45 دقیقه در دمای اتاق، نسبتا مرطوب و تاریک انکوبه شدند. در نهایت سلول‏ها با آب مقطر شستشو شدند و محل‏های فعالیت آنزیم آلکالین فسفاتاز توسط میکروسکوپ نوری Olympus  مشاهده و عکس‏برداری شدند (23).

 ارزیابی ایمونوسیتوشیمی: در ابتدا سلول‏های حاصل از کلونی‏های اسپرماتوگونی، ES-like cells و سلول بنیادی جنینی توسط  PBSسه مرتبه شستشو شدند. سلول‏های مذکور در محلول پارافرمالدئید 4 درصد در دمای اتاق به‏مدت یک شب تثبیت شدند. سپس سلول‏ها با محلول Tween 20  0.05% + PBS شستشو داده شده و با محلول Triton X-100 0.2% نفوذپذیر شده و مجددا توسط محلول Tween 20  0.05% +  PBS به‏مدت 5 دقیقه شسته شدند و سلول‏ها به‏مدت 60 دقیقه در دمای اتاق با سرم بز پوشانده شدند. آنتی بادی اولیه Oct4 (Goat polyclonal IgG, ab764, abcam system) به رقت 200/1 در محلول Tween 20  0.05% +  PBS+ BSA 1% به‏مدت یک شب در دمای 4 درجه سانتی‏گراد به سلول‏های مذکور اضافه شد. پس از سه مرتبه شستشو با PBS، سلول‏های مذکور توسط آنتی‏بادی ثانویه (Phycoerythrin (PE) -conjugated Donkey polyclonal to Goat IgG, ab976,abcam system) به رقت 100/1 در محلول Tween 20 0.05% +  PBS+ BSA 1% به‏مدت یک ساعت در دمای اتاق و در شرایط تاریکی انکوبه شدند. رنگ آمیزی هسته سلول‏ها با استفاده از DAPI محصول شرکت سیگما صورت پذیرفت و در انتها بررسی نمونه‏ها با استفاده از میکروسکوپ فلورسانسOlympus phase contrast microscope (BX51, Olympus, Tokyo, Japan) صورت گرفت (24و25).

ارزیابی مولکولی: به‏منظور ارزیابی بیان ژن‏هایStra8 ، Plzf،Dazl ،Nanog ، Klf4، SOX2 از روش نسخه برداری معکوس واکنش زنجیره‏ای پلی مراز (RT-PCR) استفاده شد. بدین ترتیب که  RNA کل با استفاده از کیت RNA Plus (محصول شرکت فرمنتاز) از کلونی‏های حاصل از اسپرماتوگونی، ES-like cells و سلول بنیادی جنینی استخراج شده و پس از اطمینان یافتن از کیفیت RNA استخراج شده، جهت تبدیل mRNA مورد نظر به  cDNAاز پرایمر الیگو dT (MWG-Biotech AG) و آنزیم نسخه بردار معکوس (Gibco BRL, M-MLV)  استفاده شد. لازم به‏ذکر است که پرایمرهای مورد استفاده تحقیق مذکور در جدول 1 آورده شدند (28-26).

 

 

 

 

جدول 1: ویژگی‏ها و توالی پرایمر‏های ذکر شده در تحقیق حاضر.

     Primer (forward/reverse)                                                         Significance                   

Gene

5'- ACGACGCGTCGCTATTCCCTCTCACATCTTC-3'                       Spermatogonial marker

5'- AGCGAGCTCGATGCACCTTCGACACTTG -3'

5'- CCACCACAGTTCCAGAGTGTTTGG-3'                                          Spermatogonial marker

5'- CTTGAGTAACAAGAGAGTTTCTCAG-3'

5'-CAAGAAGTTCAGCCTCAAGCA-3'                                                  Spermatogonial marker

5'-CACTCAAAGGGCTTCTCACC-3'

5'-CTGGGAACGCCTCATCAA-3'                                                          Pluripotency marker

5'-CGCATCTTCTGCTTCCTGG-3'

5'-CAGCTCGCAGACCTACATGA-3'                                                     Pluripotency marker

5'-TGGAGTGGGAGGAAGAGGTA-3'

5'-GAAATTCGCCCGCTCCGATGA-3'                                                   Pluripotency marker

5'-CTGTGTGTTTGGTAGTGCC-3'

5'- CTTCTTGGGTATGGAATCCTG -3'                                                  Internal control

5' - GTGTTGGCATAGAGGTCTTTAC-3

Stra8

 

DAZL

 

Plzf

 

Nanog

 

Sox2

 

Klf4

 

β actin

 

 

 

نتایج

تاییدهویت سلول‏هایES-like cells  

مورفولوژی

کلونی‏های ES-like cellsبه لحاظ مورفولوژیک بسیار شبیه کلونی‏هایسلول‏های بنیادی جنینیو دارای شکلکروی تا بیضی با محدود سلولی نامشخص بودند.

توانایی تولید اجسام شبه جنینی

سلول‏هایES-like cells در صورت کشت معلق قادر به تشکیل دستجات و تولید اجسام شبه جنینی (Embryoid Bodies, EBs) هستند.

سنجش آنزیم آلکالین فسفاتاز

بررسی هیستوشیمی آنزیم آلکالین فسفاتاز نشان داد که سلول‏هایES-like cells مشابه ESC دارای فعالیت آلکالین فسفاتازی نسبتا بالای هستند. به‏طوری‏که محل‏های فعالیت آنزیم به‏صورت نقاط صورتی تا قرمز قابل مشاهده است. علاوه بر این سلول‏های مشتق شده از اسپرماتوگونی نیز دارای فعالیت آلکالین فسفاتاز می‏باشند (شکل 1،A  و (B.

ردیابی نشانگر سلولی Oct4

به‏کارگیری آنتی‏بادی ضد  Oct4به‏روش ایمونویستوشیمی بیان این نشانگر را در سلول‏های ES-like cells مذکور به اثبات رسانید (شکل 2‌، (B، علاوه بر این بیان این پروتئین در ES-like cells مشابه سلول‏های بنیادی جنینی بوده (شکل 2، (D که این امر دال بر فعالیت پرتوانی سلول‏های ES-like cells است. هر چند که در کلونی‏های حاصل از اسپرماتوگونی این نشانگر ظهور پیدا نکرد (شکل 2، (F.

 

 

 

شکل 1: ارزیابی هیستوشیمی آنزیم آلکالین فسفاتاز. (A). کلونی‏های حاصل از ESC و(B)  کلونی‏هایES-like cells  مشتق از سلول‏های بنیادی اسپرماتوگونی، بزرگنمایی ×400.

 

 

 

شکل2:روش ایمونوسیتوشیمی برای تعیین محل Oct4 در کلونی‏های ES-like. (A)، کلونی‏های حاصل از سلول‏های بنیادی جنینی، (B)، کلونی‏های حاصل از سلول‏های بنیادی جنینی، (C)  در کلونی‏های حاصل از اسپرماتوگونی ،(D) در کلونی‏های حاصل از اسپرماتوگونی، (E) توسط DAPI به رنگ آبی در آمده اند، (F) همچنین هسته سلول‏ها به‏ترتیب برای کلونی‏های ES-like ، بزرگنمایی ×400.

 

بررسیمولکولی

بررسی مولکولی با روش  RT-PCR نشان داد که ژن‏های اختصاصی اسپرماتوگونی نظیرStra8 ,Plzf ,Dazl  در کلونی‏های اسپرماتوگونی به‏طور واضحی بیان می شوند  در حالی‏که ژن‏های فوق در کلونی‏های ES-like cells و ESC بیان نمی شوند. ‏علاوه بر این میزان بیان ژن‏های پرتوانی نظیر  Nanog ,Klf4 SOX2 ، در کلونی‏های ES-like cells مشابه ESC بیان شد درحالی‏که ژن‏های مذکور در کلونی‏های حاصل از اسپرماتوگونی بیان نگردید (شکل 3).

 

شکل3: ژل الکتروفورز بیان ژن‏های اختصاصی اسپرماتوگونی و ژن‏های پرتوانی در کلونی‏های حاصل از اسپرماتوگونی، ES-like cells و ESC. همچنین ژن actinβ به‏عنوان کنترل داخلی در نظر گرفته شد.

 

بحث

سلول‏های بنیادی اسپرماتوگونی جمعیت زایای در بیضه‏ها هستند که بر روی غشای پایه لوله‏های منی ساز قرار گرفته و با عمل اسپرماتوژنز وظیفه انتقال ژنتیکی را بر عهده دارند (29). این سلول‏ها دارای ویژگی‏هایی نظیر قابلیت خودترمیمی و تکثیر سلولی هستند (30). به‏طوری‏که این ویژگی منجر به تولید کلونی‏های اسپرماتوگونی در شرایط in vitro می‏شود. در تحقیق حاضر 3 الی 4 روز پس از جداسازی و کشت سلول‏های اسپرماتوگونی، کلونی‏های فوق ظاهر شدند. پس از بررسی‏های مولکولی ثابت شد که این سلول‏ها مارکرهای اختصاصی اسپرماتوگونی نظیر Stra8 ,Plzf ,Dazl را بیان کردند. در همین ارتباط Sadri ardekani و  Yamazaki(31و32) اظهار داشتند که کلونی‏های  ES-likeمشتق شده از سلول‏های اسپرماتوگونی تمامی مارکرهای پرتوانی را طی تمایز بروز دادند و در ادامه مطالعات پیوند (Transplantation) ویژگی تومورزایی سلول‏های مذکور را نشان دادند که خود دال بر ویژگی پرتوانی و برنامه ریزی مجدد این سلول‏ها به سلول‏های ES-like می‏باشد و در ادامه امکان ایجاد موجود کایمرا (chimaeric animal) نیز از این سلول‏ها حاصل گردید. بنابراین این فرآیند یک مثال واضحی از تمایز سلول‏های پرتوان از سلول‏های پستانداران بالغ می باشد که احتمالا برای مطالعات پایه بیولوژیک و درمان بیماری‏های ژنتیکی (Genetic Diseases) مفید می‏باشد.

 در همین راستا نتایج تحقیقات Guan و همکاران (16) نشان داد که کلونی‏های سلول‏های اسپرماتوگونی توسط مارکرهای SSEA1 و Oct4 مشخص می‏شوند. علاوه بر این برای شناسایی کلونی‏های سلول‏های اسپرماتوگونی از مارکرهای Stra8 و Mvh  استفاده شد. در ادامه پس از 3 هفته کشت سلول‏های اسپرماتوگونی به‏تدریج کلونی‏هایES-like  ظاهر شدند. این کلونی‏ها متشکل از سلول‏های متراکم و با حاشیه سلولی کاملا مشخص و واضح مشابه کلونی‏های حاصل از سلول‏های بنیادی جنینی هستند. در تحقیق حاضر از یک روش کشت ساده و کوتاه به‏منظور ایجاد سلول‏های ES-like از سلول‏های بنیادی اسپرماتوگونی در شرایط محیط کشت استفاده شد. هر چند که در این راستا روش‏ها و فاکتورهای مختلفی گزارش شده است. اهمیت روش فوق زمانی مشخص می‏گردد که با پروتکول‏های طولانی مدت و وقت‏گیر به‏کار رفته دیگر مقایسه گردد.  به‏منظور شناسایی ماهیت کلونی‏های ES-like از ارزیابی‏های مولکولی و ایمونوسیتوشیمی استفاده شد. در سطح مولکولی مشخص شد که این سلول‏ها مارکرهای پرتوانی نظیر SOX2, Klf4,Nanog را بیان می‏کنند. بررسی‏های مولکولی کلونی های ESC نیز موید بیان ژن‏های فوق در این کلونی هستند که این امر دال بر ماهیت پرتوانی سلول‏های فوق است. علاوه بر این نتایج پژوهش حاضر نشان داد که طی تبدیل سلول‏های اسپرماتوگونی به سلول‏های ES-like، بیان ژن‏های اسپرماتوگونی Stra8, DAZLPlzf کاهش و در عوض بیان ژن‏های سلول‏های بنیادی افزایش می‏یابد. این مساله همراستا با نتایج Guan وShinohara  (6 و 16) است که تغییرات گسترده‏ای از ژن‏ها‏ی را طی تبدیل سلول‏های اسپرماتوگونی به سلول‏های ES-like گزارش کردند. به‏طوری‏که طی تبدیل سلول‏های ES-like از سلول‏های اسپرماتوگونی ژن‏های پرتوانی افزایش و ژن‏های احتصاصی اسپرماتوگونی کاهش می‏یابند. به‏منظور ارزیابی اینکه آیا کلونی‏های ES-like ویژگی پرتوانی را دارند از ایمونوسیتوشیمی Oct4 استفاده شد. سلول‏های بیان کننده Oct4 در کلونی‏های سلول‏های ES-like و ESC به‏وضوح مشاهده شدند که بیانگر خاصیت پرتوانی هر دو تیپ سلولی می‏باشد. یکی از مهم‏ترین فاکتورها در عامل ایجاد خودترمیمی فاکتور نسخه برداری(Pou5f1)  Oct4 است که جهت حفظ پرتوانی این سلول‏ها ضروری می‏باشد. همچنین تحقیقات اخیر نشان داد که تمایز اولیه اپی‏بلاست‏ها به سه لایه زایای جنینی طی گاسترولاسیون به مقادیر مشخص فاکتور نسخه‏برداری(Pou5f1)  Oct4 وابسته است. بنابراین طی تمایز سلولی Oct4  در تعیین سرنوشت سلولی (Cell Fate) سلول‏های در حال تمایز نقش مهمی دارد (24). با توجه ظهور سلول‏های ES-like از سلول‏های اسپرماتوگونی و بیان فاکتور  نسخه برداری  Oct4در این سلول‏ها، به‏نظر می‏رسد برخی از فاکتورهای موجود در محیط کشت از جمله سرم بتواند از طریق مسیرهای سیگنالی داخل سلولی   PI3k/Aktویژگی‏های خودترمیمی و بنیادی بودن (Stemness) را در سلول‏های ES-like حفظ کند (32) که با نتایج تحقیق حاضر مطابقت دارد.

 با توجه به پروفایل سلولی و مولکولی مشترکی که سلول‏های ES-like با سلول‏های ES دارند لذا می‏توان از این سلول‏ها به‏عنوان یک منبع سلولی جدید برای دستیابی به سلول‏های پرتوان استفاده کرد. به‏نظر می‏رسد که این منبع سلولی جدید قابلیت تمایز به هر سه رده لایه زایای اکتودرمی، مزودرمی و اندودرمی  را در شرایط in vitro داشته باشد (32). در مجموع ایجاد کلونی‏های ES-like پرتوان از سلول‏های اسپرماتوگونی و شناسایی آن‏ها در شرایط محیط کشت می‏تواند یک قدم اولیه و ضروری در زمینه تولید سلول‏های پرتوان باشد که خود می‏تواند در تحقیقات پایه‏ای و سلول درمانی مفید و موثر باشد. 

در مطالعه حاضر کلونی‏های ES-like از برخی جنبه‏ها مشابه سلول‏های بنیادی جنینی هستند از جمله اینکه دارای فعالیت نسبتا بالای آنزیم آلکالین فسفاتاز هستند در حالی‏که میزان فعالیت آنزیم آلکالین فسفاتاز در SSCs نسبتا پایین مشاهده شد. همچنین کلونی‏های ES-like مشابه ESC فاکتور نسخه‏برداری(Pou5f1)  Oct4 را بیان کردند درحالی‏که این فاکتور در SSCs بروز پیدا نکرد. علاوه بر این مطالعات بیان ژن نشان داد که افزایش بیان ژن‏های پرتوانی نظیر ,Nanog  Klf4 ,SOX2 و همزمان کاهش بیان ژن های احتصاصی اسپرماتوگونی نظیرStra8  Plzf ,Dazl در کلونی‏های ES-like حاصله می‏تواند دال بر برنامه ریزی مجدد (Reprogramming) سلول‏های اسپرماتوگونی در شرایط محیط کشت باشد به‏نظر می‏رسد برخی از فاکتورهای محیط کشت نظیر سرم در کنترل مکانیسم این فرآیند نقش داشته باشند که همگی دال بر خاصیت پرتوانی کلونی‏های ES-like می‏باشد.

از سوی دیگر پیشرفت‏های جدید در سلول درمانی منجر به بروز روش‏های نوین علمی در درمان بسیاری از بیماری‏ها و ضایعات ژنتیکی شده است )8). امروزه استراتژی‏های سلول درمانی متعددی با استفاده از منابع مختلف مانند سلول‏های بنیادی مغز استخوان، سلول‏های بنیادی خونی و سلول‏های بنیادی جنینی در دست بررسی و مطالعه‏اند (9).

در مجموع به‏نظر می‏رسد کشت سلول‏های اسپرماتوگونی در شرایط In vitro باعث ایجاد تغییرات گسترده‏ای در بیان ژن‏ها و مارکرهای اسپرماتوگونی و پرتوانی می‏شود. به‏طوری‏که عناصر محیط کشت سرنوشت این سلول‏ها را به سمت سلول‏های پرتوان سوق می‏دهند. لذا بررسی‏های دقیق تر و جزیی‏تر این تغییرات امری ضروری است که باید مورد توجه محققین قرار گیرد.

شواهد متعددی از جمله یافته‏های مطالعه حاضر فعالیت تکثیری گسترده و پرتوانی سلول‏های بنیادی اسپرماتوگونی را پیشنهاد می‏دهد (10) درواقع این سلول‏ها می‏توانند به حد کافی تکثیر و گسترش یابند که منبع کافی برای تولید سلولی برای درمان بسیاری از بیماری‏ها و ضایعات ژنتیکی باشند (6) این ویژگی‏های اسپرماتوگونی استفاده این سلول‏ها را برای درمان های ترمیمی میسر می‏سازد.

 

نتیجه گیری

در مطالعه حاضر کلونی‏های ES-like از برخی جنبه‏ها مشابه سلول‏های بنیادی جنینی هستند از جمله اینکه دارای فعالیت نسبتا بالای آنزیم آلکالین فسفاتاز هستند در حالی‏که میزان فعالیت آنزیم آلکالین فسفاتاز در SSCs نسبتا پایین مشاهده شد. همچنین کلونی‏های ES-like مشابه ESC فاکتور نسخه‏برداری(Pou5f1)  Oct4 را بیان کردند درحالی‏که این فاکتور در SSCs بروز پیدا نکرد. علاوه بر این مطالعات بیان ژن نشان داد که افزایش بیان ژن‏های پرتوانی نظیر ,Nanog  Klf4 ,SOX2 و هم‏زمان کاهش بیان ژن‏های احتصاصی اسپرماتوگونی نظیرStra8  Plzf ,Dazl در کلونی های ES-like حاصله می‏تواند دال بر برنامه ریزی مجدد (Reprogramming) سلول‏های اسپرماتوگونی در شرایط محیط کشت باشد به‏نظر می‏رسد برخی از فاکتورهای محیط کشت نظیر سرم در کنترل مکانیسم این فرآیند نقش داشته باشند که همگی دال بر خاصیت پرتوانی کلونی‏های ES-like می‏باشد.

1. Olive V, Cuzin F. The spermatogonial stem cell: from basic knowledge to transgenic technology. Int J Biochem  Cell  Biol .2005; 37(2): 246–250.
2. Mardanpour P,  Guan K , Nolte J, Lee J , et al. Potency of germ cells  and its relevance for regenerativemedicine. J Anat. 2008; 213(1): 26–29.
3. Nayernia K, Lee J, Wolfgang E, Nolt J, et al. From stem cells to germ cells and from germ cells to stem cells. Iranian J Reprod Med. 2005; 5(2): 41-44.
4. Stevens LC. Origin of testicular teratomas  from  primordial germ cells in mice. J Nat Cancer.  1967; 38(4): 549-552.
5. Nayernia K. Stem cells derived from testis show promise for treating a wide variety of medical conditions. Cell Res. 2007; 17: 895-897.
6. Shinohara M, Inoue K, Lee J, Yoshimoto M, et al. Generation of pluripotent stem cells from neonatal mouse Testis. Cell. 2004; 119(7): 1001–1012.
7. Ehmcke J, Wistuba J,  Schlatta S.  Spermatogonial stem cells: questions, models and
perspectives.Hum Reprod. 2006; 3: 275–282.
8. Kossack N, Meneses J, Shefi S, Nguyen H, et al. Isolation and characterization of cluripotent human spermatogonial stem cell-derived cells. Stem cells. 2009; 27: 138–149.
9.  Donovan P, Miguel M. Turning germ cells into stem cells. Gen  Dev. 2003; 13: 463–471.
10.  Niels G, Lean J. Seminal discoveries in regenerative medicine: contributions of the male germ line to understanding pluripotency. Hum Mol. 2008; 17: 16-22.
11. Toyooka Y, Tsunekawa N, Akasu R, Noce T. Embryonic stem cells can form germ cells in vitro. Proc Nat Acad Sci U S A. 2003; 100(20):11457–11462.
12. McLaren A. Germ and somatic cell lineages in the developing gonad. Mol Cell Endocrinol. 2000; 163(1-2): 3–9.
13.  Bowles J, Knight D, Smith C, Wilhelm D, et al. Retinoid signaling determines germ cell fate in mice. Sci. 2006;  312: 596–600.
14. Baba S, Heike T, Umeda K, Iwasa T, et al. Generation of cardiac and endothelial cells from neonatal mouse testis-derived multipotent germline stem cells. Stem Cells. 2007;25: 1375-1383.
15. Guan G, Nayernia  K, Lars M, Wagner S, et al. Pluripotency of spermatogonial stem  cells from adult mouse testis. Nature. 2006; 440:1199-1203.
16. Guan K, Wanger S, Unsold B, Lars S, et al. Generation of functional cardiomyocytes from adult mouse spermatogonial stem cells. Circ Res. 2008; 100: 1615-1625.
17. De Rooij DG. Rapid expansion of the spermatogonial stem cell tool box. Proc. Natl. Acad. Sci. USA. 2006; 103(21): 7939-7940.
18. Huleihel M, Abuelhija M, Lunenfeld E. In vitro culture of testicular germ cells: regulatory factors and limitations. Growth Factors. 2007; 25(4): 236-52.
19. De Rooij DJ, Mizrak C. Deriving multipotent stem cells from mouse spermatogonial stem cells: a new tool for developmental and clinical research. Development. 2008; 135: 2207–2213.
20. Glaser T, Opitz T, Kischlat T, Konang R, et al. Adult germ line stem cells as a source of functional neurons and glia. Stem Cells. 2008;26:2434–2443.
21. Huang YH,Chin CC, Ho HN, Chou CK, et al. Pluripotency of mouse spermatogonial stem cells maintained by IGF-1- dependent pathway.  The FASEBJ. 2009; 23(7): 2076-2087.
22.Scarpino S, Morena AR, Petersen C, Fröysa B, et al. A rapid method of Sertoli cell isolation by DSA lectin, allowing mitotic analyses. Mol Cell Endocrinol. 1998; 146(1-2): 121-7.
23.Mirzapour T, MovahedinM, Tengku IbrahimTA, Koruji M, et al. Effects of basic fibroblast growth factor and leukaemia inhibitory factor on proliferation and short-term culture of human spermatogonial stem cells. Andrologia. 2012; 441: 41-55.
24. Hobbs R, Seandel M, Falciatori I, Rafii S, et al. Plzf regulates germline progenitor self-renewal by opposing mTORC1. Cell. 2010; 142(3): 468–479.
25.Ghasemi HH, Pasbakhsh P, Amidi F, Soleimani M, et al. Functional Concentrations of BMP4 on Differentiation of Mouse Embryonic Stem Cells to Primordial Germ Cells.IJFS. 2011; 5(2):104-109.
26.Saitou M, Payer B, Lange UC, Erhardt S, et al. Specification of  germ cell fate in mice. Biol  Sci. 2003; 358: 1363–1370.
27. Izadyar F, Pau F, Marh J, Slepko N, et al. Generation of multipotent cell lines from a distinct population of male germ line stem cells. Reprod. 2008; 135: 771–784.
28. Nayernia K, Nolte J, Michelmann H, Lee J, et al. In vitro-differentiated embryonic stem cells give rise
 
to male gametes that can generate offspring mice. Dev cell. 2006; 11(1): 125-132.
29. Izadyar F, Den Ouden K, Stout  TA, Stout J, et al. Autologous and homologous transplantation of bovine spermatogonial stem cells. Reprod. 2003; 126(6): 765–774.
30. Hayashi K, Ohta H, Kurimoto K, Aramaki S, et al. Reconstitution of the mouse germ cell specification pathway in culture by pluripotent stem cells. Cell. 2011; 146(4): 519–532.
31. Yamazaki  Y. Adult mice cloned from migrating primordial germ cells. Proc. Natl Acad. Sci. USA. 2005;102: 11361–11366.
32. Sadri-Ardekani H, Akhondi MA, van der Veen F, Repping S, et al. In vitro propagation of human prepubertal spermatogonial stem cells. JAMA2011; 305: 2416–2418.