تاثیر همزمان -Azacytidin5 و DMSO در القای تمایز کاردیومیوسیت ها از سلول های کارسینومای جنینی P19 در شرایط آزمایشگاهی

نوع مقاله: علمی - پژوهشی

نویسندگان

1 گروه آناتومی و بیولوژی سلولی، دانشکده پزشکی، دانشگاه علوم پزشکی مازندران، ساری، ایران

2 مرکز تحقیقات ایمونوژنتیک، دانشکده پزشکی، دانشگاه علوم پزشکی مازندران، ساری، ایران

3 گروه آناتومی، دانشکده پزشکی، دانشگاه علوم پزشکی تهران، تهران، ایران

-

کلیدواژه‌ها


مقدمه

از جمله مشکلات بزرگی که امروزه جوامعه بشری با آن مواجه‌ است بیماری‌های قلبی ‌ـ عروقی هستند. در مشکلات ایسکمی عضله قلب که متعاقب سکته قلبی رخ می دهد، سلول‏ها دچار آسیب شده و در عمل‏کرد طبیعی کاردیومیوسیت‌ها اختلال ایجاد می‏شود. با توجه به اینکه کاردیومیوسیت‌های بالغ قادر به بازسازی و ترمیم خود نیستند و از سویی مداخلات کلینیکی متداول هم قادر به کاهش عوارض سکته قلبی نیستند میزان مرگ و میر در این دسته از بیماران فوق‌العاده زیاد است، لذا یافتن مخزن سلولی در دسترس که بتواند در صورت نیاز به کاردیومیوسیت‏ها متمایز شود و به محل آسیب دیده تزریق گردد، تحولی شگرف را در درمان این بیماران فراهم خواهد نمود (1-3).

مطالعات متعددی ثابت کرده‏اند که یک منبع سلولی مناسب جهت درمان این دسته از بیماران بایستی برخی از ویژگی‏ها نظیر دسترسی آسان، تکثیر بالا، مقاوم در برابر شرایط ایسکمیک، عدم برانگیختن پاسخ‏های ایمنی و قابلیت تمایز یافتن به کاردیومیوسیت‏ها را داشته باشد. هر چند که تا به‏حال منبع سلولی مناسب برای درمان موفق این دسته از بیماران شناخته نشده است (4-6). برای مثال علیرغم دسترسی راحت سلول‏های آلوژن مشخص شده است که در صورت پیوند سبب ایجاد واکنش‏های ایمونولوژیک می‏شود. در این بین به‏نظر می‏رسد که به‏کاربردن سلول‏های کارسینومای جنینی‏(Embryonic Carcinoma cells, ECs) مناسب باشد (5 و7).

سلول‏های کارسینومای جنینی یکی از انواع سلول‏های بنیادی هستند. این سلول‏ها همانند سایر سلول‏های بنیادی نامیرا بوده و قدرت تکثیر بالایی در محیط کشت دارند. یکی از انواع سلول‏های کارسینومای جنینی، P19 می‏باشد که از تراتو کارسینومای القا شده در موش تهیه می‏شود و دارای کاریوتیپ طبیعی هستند .در همین ارتباط، گزارش‏های متعددی وجود دارند مبنی بر اینکه سلول‏هایP19  قابلیت تمایز به انواع سلول‏ها از جمله کاردیومیوسیت‏ها را در شرایط آزمایشگاهی دارا هستند و تا حدودی مشکلات موجود را می‏تواند مرتفع کند (5 و 8).

فاکتورهایی مختلفی در فرآیند القای کاردیومیوژنیک طی دوران جنینی وجود دارند از جمله Bone Morphogenetic Proteins (BMPs) که متعلق به ابرخانواده Transforming Growth Factor β (TGF-β) می‏باشند که به‏واسطه فاکتورهایی نسخه‏برداری خاص قلبی در فرآیند قلب‏زایی نقش دارند (9).

در همین ارتباط Makino S و همکاران (10) گزارش کردند که در صورتی‏که سلول‏های استرومایی مغز استخوان موش تحت القای ماده محرک -Azacytidin5 قرار گیرند به سلول‏های قلبی ضربان‏دار تمایز می یابند و در ادامه مشخص شده که پیوند سلول‏های مذکور به جایگاه سکته قلبی، روند بهبودی قلب را افزایش چشمگیری می بخشد. علاوه بر این مطالعات مشابهی توسط Shim W و همکاران (11) بر روی سلول‏های استرومایی مغز استخوان انسان صورت پذیرفته است که نشان می‏دهد که نه تنها -Azacytidin5 بلکه برخی از فاکتورهای رشد نیز می‏توانند سبب تمایز کاردیومیوسیت ها گردند.

با توجه به مجموع مطالعاتی که قبلا در این باره صورت گرفته معلوم شده که هم سلول‏های بنیادی قلبی و هم سلول‏های بنیادی غیرقلبی می‏توانند بعد از پیوند به قلب و یا کشت در شرایط آزمایشگاهی شبیه محیط قلب، به کاردیومیوسیت تبدیل شوند. پیشنهاد شده است که سلول‏های بنیادی، آنژیوژنز را توسط کاردیومیوسیت‏های ایسکمیک شده با ترشح IL6,TNF,CRP تحریک و از مرگ آپوپتیتک کاردیومیوست‏ها جلوگیری می کنند و به‏علاوه کاردیومیوسیت‏ها را تحریک به تکثیر می‏کنند (12و13).

تا به حال فاکتورهای کاردیومیوژنیک متعددی به‏واسطه مطالعه تکوین قلب در موش شناخته شده است. به‏منظور بهبود بخشیدن به کارایی تمایز کاردیومیوسیت‏ها از برخی از فاکتورها استفاده می‏شود که از جمله این فاکتورها -Azacytidin5 و DMSO می‏باشند که عمدتا جهت تمایز در شرایط آزمایشگاهی کاردیومیوسیت‏ها شناخته می‏شود. علاوه بر این گزارشات متعددی ثابت می‏کند که تمایز کاردیومیوسیت ها به‏مدت زمان القا و غلظت بستگی دارد. از آنجائی‏که توانایی تمایز کاردیومیوژنیک هر یک از این ترکیبات به‏صورت جداگانه به اثبات رسیده است و با توجه به اینکه تا به حال گزارشی مبنی بر آثار ترکیبی این فاکتورها مشاهده نشده است، به‏نظر می‏رسد که استفاده هم‏زمان از این ترکیبات می‏تواند تاثیر به‏سزایی در القای تمایز کاردیومیوسیت‏ها از سلول‏های P19 در شرایط آزمایشگاهی داشته باشد.

 

مواد و روش‏ها

کشت و تکثیر سلول‏های P19: در این تحقیق از سلول‏های P19 (خریداری شده از انیستیتو پاستور تهران) استفاده شد. محیط کشت این سلول‏ها شامل High Glucose (Gibco)-DMEM که حاوی 15 درصد سرم جنین گاوی (FBS, Gibco)، 0.1 Mm بتامرکاپتواتانول (Sigma)، 1 درصد پنی‏سیلین/استرپتومایسین(Gibco)  و 1 درصد اسید های آمینه غیر ضروری (Sigma) و 1 درصد گلوتامین (Gibco) کشت داده شدند. سلول‏ها در انکوباتور Сº 37 با فشار 5 درصد  CO2و رطوبت 95 درصد انکوبه شدند. تعویض محیط کشت به‏صورت روزانه صورت گرفته شد.

شکل گیری اجسام شبه جنینی و القائ تمایز کاردیوژنیک (Induction of cardiogenic differentiation): شکل‏گیری اجسام شبه جنینی (Embryoid Bodies,EBs) بر مبنای روش قطرات آویزانHanging Drops  انجام شد (14). بدین ترتیب سوسپانسیونی از سلول‏های P19  ایجاد شد و با شمارش سلولی، تعداد 2000 سلول در هر قطره 20 میکرولیتری            cells/drop) 2000( از محیط کشت بر روی درپوش پتری دیش به‏صورت آویزان به‏مدت 48 ساعت در انکوباتور کشت داده شدند. سپس اجسام شبه جنینی توسط میکروسکوپ معکوس (Invert microscope) مورد ارزیابی شدند و اجسام شبه جنینی با ویژگی‏های مناسب جهت ادامه تمایز در نظر گرفته شدند. ضمنا به‏منظور جلوگیری از خشک شدن قطرات، کف دیش‏ها توسط PBS پوشیده شدند. سپس اجسام شبه جنینی به‏مدت 10 روز در محیط های القایی مختلف به پلیت باکتریایی که با ژلاتین 1/0 درصد (Sigma) ژلاتینه شده، منتقل و در انکوباتور کشت داده شدند. جهت القای تمایز سلول‏ها، از 2 میکرومولار (5-Aza group, Sigma) 5-Azacytidin، (DMSO group, Sigma) DMSO،  5/0 درصد و ترکیب DMSO  و 5-Azacytidin (Aza+DM group) استفاده شد. علاوه بر این به برخی چاهک‏های پلیت باکتریایی هیچگونه عامل القای اضافه نشد و به‏عنوان گروه کنترل (Co group) در نظر گرفته شد.

ارزیابی ضربان کاردیومیوسیت‏های تمایز یافته: پس از شکل‏گیری اجسام شبه جنینی تعداد ضربان در دقیقه طی روزهای 2+2، 4+2، 6+2، 8 +2 و10+2 در گروه‏های مختلف به‏وسیله میکروسکوپ معکوس مشاهده و شمارش شدند.

ارزیابی ایمونوسیتوشیمی :(Immunocytochemistry) در ابتدا کاردیومیوسیت‏های مشتق شده از سلول‏های P19 در گروه‏های مختلف توسط  PBSسه مرتبه شستشو شدند. سلول‏های مذکور در محلول پارافرمالدئید 4 درصد در دمای اتاق به‏مدت یک شب تثبیت شدند. به‏دنبال شستشوی مجدد سلول‏ها با PBS، سلول‏ها به‏مدت 60 دقیقه در دمای اتاق با سرم بز (Goat serum) پوشانده شدند. سپس در محلول 2O2H، 3 درصد قرار داده شدند. آنتی‏بادی اولیه F-actin (Dako) با رقت 1:400 به‏مدت 45 دقیقه به نمونه‏ها افزوده شد و به‏دنبال آن آنتی‏بادی ثانویه EnVision TM (Dako) به‏مدت 30 دقیقه به نمونه‏ها اضافه شد. در نهایت سلول‏ها توسط میکروسکوپ نوری بررسی شدند (15).

آنالیز نسخه برداری معکوس واکنش زنجیره‏ای پلی مراز (RT-PCR): با استفاده از RT-PCR میزان بیان ژن‏های ویژه کاردیومیوسیت‏ها در گروه‏های ذکر شده مورد ارزیابی قرار گرفته شد. بدین ترتیب زنجیره سنگین میوزین α  (α-Myosin Heavy Chain, α-MHC)، زنجیره سبک میوزین (Myosin Light Chain, MLC)   و کانکسین 43- (Connexin-43) در روز 10 پس از القا بررسی شدند. علاوه بر این ژن –actinβ نیز به‏عنوان کنترل داخلی در نظر گرفته شد. همچنین از قلب نوزادان موش صحرایی به‏عنوان کنترل مثبت استفاده شد.  RNA کل با استفاده از کیت  (Fermentas)  RNX Plus استخراج شده و با به‏کارگیری پرایمر الیگو dt و آنزیم نسخه‏بردار معکوس MMULV،cDNA  ساخته شد. سپس با استفاده از پرایمر‏های اختصاصی کاردیومیوسیت‏ها، واکنش PCR انجام شد. (جدول 1). در نهایت به‏منظور الکتروفور محصولات PCR بروی ژل آگارز 2 درصد منتقل شده  و با دستگاه ترانس لومیناتورUV  مشاهده شدند.


 

جدول 1: ویژگی‏ها و توالی پرایمر‏های ذکر شده در تحقیق حاضر.

Primer (Forward/Reverse)                                                                   Length (bp)

Gene

F 5'-CTGCTGGAGAGGTTATTCCTCG -3'                                                 301

R 5'- GGAAGAGTGAGCGGGGCATCAAGG-3'

F 5'-TGTGGGTCACCTGAGGCTGTGGTTCAG -3'                                    189

R 5'-GAAGGCTGACTATGTGTCCGGGAGATGC -3'

F 5'-AGCGCCTTAGGCAAACTCCTT -3'                                                    298

R 5'- TCTTCCTTTCGCATCACATAGA-3'

F 5'- CTTCTTGGGTATGGAATCCTG -3'                                                    317

R 5'- GTGTTGGCATAGAGGTCTTTAC -3'

α-MHC

 

MLC

 

Connexin-43

 

β- actin

 


آنالیز آماری: تعداد ضربان کاردیومیوسیت‏ها در گروه‏های مختلف با استفاده از آزمون آنالیز واریانس یک‏طرفه           One Way ANOVA و نرم افزار آماری SPSS ارزیابی شد 05/0  P<معنی‏دار در نظر گرفته شد.

نتایج

تمایز سلول‏های P19 به کاردیومیوسیتها

تعداد ضربان در دقیقه در تمامی گروه‏ها از روز 2+2 مشاهده شده و تا روز 8+2 به‏تدریج افزایش یافته اما در روز 10+2 از میزان تعداد ضربانات کاسته شده است به استثنای گروه 5-Aza که از روز 2+2 تا روز 10+2 بر میزان تعداد ضربانات آن افزوده شد. یافته‏ها نشان داد که تعداد ضربان در کاردیومیوسیت‏های تمایز یافته در گروه Aza+DM نسبت به سایر گروه‏ها بیشتر بود به‏طوری‏که حداکثر ضربان در روز 8+2 با میزان 87  ضربان در دقیقه مشاهده شد و با روزهای 2+2 و 4+2 اختلاف معنی‏داری دارد (05/0P<). علاوه بر این در گروه 5-Aza اختلاف معنی‏داری در فرکانس ضربان در روزه‏های 2+2 و 10+2 وجود داشت (05/0P<). حداکثر تعداد ضربان در گروه DMSO در روز 8+2  مشاهده شد که فقط با روز 2+2 اختلاف معنی‏داری دارد (05/0P<) (نمودار1).


 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار 1: تعداد ضربان در دقیقه در گروه‏های کنترل (Co)، 5-Aza، DMSO و Aza+DM (05/0P<)*.

 


در گروه کنترل کاردیومیوسیت‏های مشتق شده از P19 شکل فیبروبلاستی خود را حفظ کرده بودند (شکل1، A). در حالی‏که تغییرات مورفولوژیکی زیادی در کاردیومیوسیت‏های مشتق شده از P19 ایجاد شد به‏طوری‏که طی روزهای 2+2 تا 4+2 افزایش

 

مشخصی در اندازه سیتوپلاسم و زواید سیتوپلاسمی آن‏ها دیده شد و به‏تدریج تا روز 10+2 اندازه سلول‏ها و شاخه شاخه شدنآن‏ها افزایش یافت و به‏صورت گرد یا چندوجهی ظاهر گردیده و با سلول‏های مجاور ارتباط برقرار کردند (شکل1،B).


 

شکل 1: A) تغییرات مورفولوژیکی حاصله در کاردیومیوسیت‏های مشتق شده از P19، در گروه کنترل به شکل فیبروبلاستی مشاهده می‏شوند (سر پیکان‏ها)، B) بزرگنمایی 10×. در گروه Aza+DM سلول‏ها عمدتا به‏صورت چندوجهی ظاهر گردیده (سر پیکان‏ها) و با سلول‏های مجاور ارتباط تنگاتنگی برقرار کردند (پیکان‏های کوتاه)‏، بزرگنمایی ×20.

 


علاوه بر این نتایج جاصل از ارزیابی ایمونوسیتوشیمی ثابت کرد که کاردیومیوسیت‏های مشتق شده از P19 که تحت القای هم‏زمان DMSO و  5-Azacitidin قرار گرفته‏اند قادر به بیان پروتئین اختصاصی قلبی F-actin می‏باشند و سلول‏های F-actin مثبت با ظاهری مشخص و سیتوپلاسم واضح از سلول‏های F اکتین منفی مشخص هستند (شکل2).


 

 

 

 

 

 

 

 

 

شکل 2: سلول‏های بیان کننده F اکتین (سر پیکان ها)، بزرگنمایی ×20.

 


آنالیز نتایج RT-PCR نشان داد که در سلول‏های P19 که به‏وسیله 5-Aza تیمار شده‏اند ژن‏های Connexin-43 و MLC بیان شدند. اما در گروهی که به‏وسیله DMSO تیمار شده ژن MLC بروز یافت. سلول‏های P19 که تحت القای هم‏زمان DMSO و 5-Aza بودند ژن‏های ویژه بافت قلبی را نظیر MLC و α-MHC بیان کردند (شکل 3). 


 

 

شکل 3: ارزیابی بیان ژن‏های اختصاصی قلبی در گروه‏های 5-Aza، DMSO، Aza+DM و کنترل (Co) با روش RT-PCR.   ژن β- actin به‏عنوان کنترل داخلی در نظر گرفته شد.


 


 

بحث

با توجه به اینکه تمایز کاردیومیوسیت‏ها از سلول‏های سرطانی P19 اهمیت ویژه‏ای در شناخت مکانیسم‏های دخیل در بیولوژی تکاملی، پیوند سلولی و درمان دارد لذا دانستن شرایط کشت مطلوب این سلول‏ها جهت القای تمایز به رده سلولی خاص از جمله کاردیومیوسیت‏ها ضروری می‏باشد. در مطالعه حاضر با به‏کارگیری عوامل القاگر مختلف سعی شده تا ویژگی‏های کاردیومیوسیت‏های تمایز یافته معین گردد (6، 16-19). 

به‏منظور ایجاد تمایز در سلول‏های P19 از غلظت 2 میکرومولار 5-Azacytidin استفاده شد نتایج نشان داد که سلول‏های تمایز یافته از لحاظ مورفولوژیکی مشابه کاردیومیوسیت‏ها هستند و برخی از ژن‏ها نظیر Connexin-43 و MLC را بروز دادند در‏حالی‏که هیچ سلول بیان کننده F اکتین مشاهد نشد. همچنین تعداد ضربان به‏تدریج از روز 2+2 تا 10+2 افزایش یافته است. در مطالعه‏ای که Wang و همکارانش (13) به‏منظور تمایز دادن سلول‏های ماتریکس بند ناف انسان انجام دادند توانستند بعد از انکوبه کردن این سلول‏ها با 5-Azacytidin برای 3 هفته، مارکرهای کاردیومیوسیتی را شامل تروپونین  Iقلبی،  کانکسین43 و دسمین را بیان کنند و مورفولوژی میوسیت قلبی را مشاهده کنند.

در همین ارتباط گزارش‏های وجود دارد دال بر اینکه القا سلول‏های استرومایی مغز استخوان با استفاده از داروی 5-Azacytidine به غلظت 10 میکرومولار طی دو هفته جهت تمایز به کاردیومیوسیت‏ها کافی نمی‏باشد و در ادامه بررسی‏ها مشخص شد که سلول‏های مذکور هیچگونه ساختارهای سارکومریک که از ویژگی‏های بارز سلول‏های قلبی است را بروز ندادند (20و 21). گزارش مشابهی توسط Martin Rendom و همکاران (15) وجود دارد مبنی بر اینکه تمایز سلول‏های استرومایی مغز استخوان به کاردیومیوسیت‏ها در غلظت‏های مختلف داروی مذکور صورت نمی‏پذیرد. نتایج مطالعات فوق نشان می‏دهد که داروی مذکور به تنهایی جهت القای تمایز سلول‏های P19 به سلول‏های قلبی کافی نیست بنابراین افزودن عامل القاگر دیگر نیز به محیط کشت سلول‏ها ضروری می‏باشد. تحقیقات اخیر نشان داد که اعضای ابر خانواده TGF-β از طریق برخی مسیرهای سیگنالی در القای تمایز کاردیومیوسیت‏ها و فاکتورهای نسخه برداری قلبی نظیر Nkx2.5 نقش به‏سزایی دارند. یکی از شناخته شده ترین مسیرهای سیگنالی به Wntβ catenin بر می‏گردد. در همین ارتباط Cohen و همکاران (9)، Marvin و همکاران (22) و Tzahor و همکاران (23) گزارش کردند که در صورت افزودن DMSO ،‌ 1 درصد به‏همراه Fibroblast Growth Factor 8 (FGF8) به سلول‏های PC19CL6 در روز اول سبب بیان Wnt3A و Wnt8 می‏گردد اما در روز چهارم از میزان بیان پروتئین‏های سیگنالینگ مذکور کاسته شده است به‏نظر می‏رسد که این فرایند جهت مراحل بعدی تمایز کاردیومیوسیت‏ها ضروری باشد.

در تحقیق حاضر علاوه بر این جهت تمایز سلول‏های P19 به کاردیومیوسیت‏ها از غلظت 5/0 درصد DMSO استفاده شد. یافته‏های به‏دست آمده نشان داد که کاردیومیوسیت‏های مشتق شده از لحاظ مورفولوژیک همانند سلول‏های قلبی هستند. آنالیز نتایج RT-PCR نشان داد که سلول‏های تمایز یافته قادر به بیان ژن MLC هستند و حداکثر تعداد ضربان در این گروه در روز 8+2  مشاهده شد که در مقایسه با سایر گروه‏ها از فرکانس کمتری برخوردار بود. 

 در پژوهش حاضر نیز شاید علت بی تاثیر بودن غلظت  DMSO، 5/0 درصد جهت تمایز سلول‏های قلبی از سلول‏های P19 این باشد که DMSO به تنهایی نمی‏تواند در القای فرایند کاردیوژنیک نقش داشته باشد. بنابراین به‏نظر می‏رسد که این فرایند نیاز به همکاری برخی از مسیر‏های سیگنالی باشد که در اثر افزودن ترکیبات مورد نظر به محیط کشت سلول‏ها ایجاد می‏شوند. علاوه بر این گزارشات مشابهی در این زمینه وجود دارد، به‏طوری‏که تیمار سلول‏های کارسینومای جنینی موشی و حتی سلول‏های بنیادی جنینی در حضور هم‏زمان اکسی توسین و DMSO روند تمایز قلبی را تحریک و تسهیل می‏نماید (24 و 25).

در مطالعه حاضر مشخص شده است که هر یک از عوامل القاگر 5-Azacytidine و DMSO به تنهایی قادر به تمایز کاردیومیوسیت‏ها از سلول‏های P19 نیستند. اگر چه که مطالعات پیشین حاکی از آن است که افزودن هر یک از این ترکیبات در شرایط آزمایشگاهی می‏تواند تا حدودی برخی از ویژگی‏های کاردیومیوسیت‏ها را بروز دهند. 

در ادامه مطالعه به‏منظور بهینه سازی شرایط محیط کشت تمایزی کاردیومیوژنزیس از تاثیر هم‏زمان ترکیباتDMSO  و  5-Azacytidin استفاده شد. بررسی‏های میکروسکوپی نشان داد که اولا این سلول‏ها بیشتر به کاردیومیوسیت تمایز پیدا کرده‏اند تا سلول‏های عضلانی دیگر ثانیا بیان F اکتین در کاردیومیوسیت‏ها نشانگر این است که سلول‏های تمایز یافته واجد یک الگوی اتصال سلولی مشابه کاردیومیوسیت‏ها می‏باشند. یافته‏های RT-PCR نشان داد که ژن‏های ویژه بافت قلبی نظیر MLC و α-MHC در کاردیومیوسیت‏ها بیان شدند. یکی از ویژگی‏های اصلی کاردیومیوسیت‏ها پیدایش ضربان در آن‏هاست. یافته‏های به‏دست آمده نشان داد که میزان انقباض پایه در دامنه 28 تا 87 ضربان در دقیقه بوده که به‏ترتیب در روزهای 2+2 و 8+2 ‏مشاهده گردید. علاوه بر این مشخص شد که تعداد ضربان در این گروه نسبت به سایر گروه‏ها بیشتر بود که دال بر وجود کانال های کلسیمی نوع L وابسته به ولتاژ (Ica) در کاردیومیوسیت‏های مشتق شده است. نتایج مشابهی در این زمینه وجود دارد مبنی بر اینکه در حضور ایزوپرنالین کاردیومیوسیت های ضربان‏دار مشاهده می‏شود (26). کاردیومیوسیت‏های تمایز یافته دارای الگوی انقباضی پیوسته می‏باشند که به برخی از مولکول‏های چسبنده نظیر N-cadherin، پروتئین‏های اتصالات شکافدار مثل کانکسین 43 و یون کلسیم وابسته است. یکی از دلایل احتمالی در افزایش بیشتر ضربان در گروه Aza+DM نسبت به سایر گروه‏ها به‏حضور DMSO در محیط القایی بر می‏گردد به‏طوری‏که DMSO سبب آزاد شدن ناگهانی یون کلسیم از ذخایر داخل سلولی می‏شود (21). علاوه بر این -Azacytidin5 نیز با ایجاد کمپلکس‏های پایدار سبب دمتیله شدن DNA می‏شود و بدین ترتیب در روند کاردیومیوژنریس نقش دارد  هر چند تمایز سلول‏ها P19 به کاردیومیوسیت‏ها به‏مدت زمان القا و غلظت بستگی دارد. در همین ارتباط مطالعات نشان می‏دهند که اضافه کردن -Azacytidin5 منجر به افزایش بیان ژن‏های زنجیره سنگین میوزین شود که با نتایج تحقیق حاضر مطابقت دارد (27-29). حتی وجود سرم در محیط کشت بر روی تمایز کاردیومیوسیت‏ها تاثیر می‏گذارد به‏طوری‏که حذف سرم سبب افزایش تعداد نواحی ضربان‏دار در اجسام شبه جنینی می‏گردد (7).

 نتیجه گیری

با توجه به مشاهدات انجام شده در این تحقیق و مقایسه آن با سایر مطالعات می‏توان نتیجه گرفت که سلول‏های کارسینومای P19 یکی از بهترین رده‏ها جهت تمایز کاردیومیوسیت‏ها می‏باشند. به‏طوری‏که کاربرد هم‏زمان ترکیبات DMSO و 5-Azacytidin موجب بهینه سازی محیط کشت تمایزی کاردیومیوسیت‏ها از سلول‏های P19 می‏گردد.

1. Rosenstrauch D, Poglajen G, Zidar N, Gregoric ID. Stem cell therapy for ischemic heart failure. Texas Heart Institute Journal. 2005; 32(3): 339-347.

2. Wang J-S, Shum-Tim D, Galipeau J, Chedrawy E, et al. Marrow stromal cells for cellular cardiomyoplasty: feasibility and potential clinical advantages. The Journal of thoracic and cardiovascular surgery 2000; 120(5): 999-1006.

3. Gepstein L, Ding C, Rehemedula D, Wilson EE, et al. In vivo assessment of the electrophysiological integration and arrhythmogenic risk of myocardial cell transplantation strategies. Stem Cells. 2010; 28(12): 2151-2161.

4. Barbash IM, Chouraqui P, Baron J, Feinberg MS, et al. Systemic delivery of bone marrow–derived mesenchymal stem cells to the infarcted myocardium feasibility, cell migration, and body distribution. Circulation 2003; 108(7): 863-868.

5. McBurney MW, Rogers BJ. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental biology. 1982; 89: 503-508.

6. Zwi-Dantsis L, Huber I, Habib M, et al. Derivation and cardiomyocyte differentiation  of induced pluripotent stem cells from heart failure patients. European Heart Journal . 2012; 10: 1093.

7. Martin GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proceedings of the National Academy of Sciences. 1981; 78 (12): 7634-7638..

8. Motamedi  R, Azadbakht M, Fathi F, Amini A, et al. In Vitro  Differentiation of Human Bone Marrow-Derived Mesenchymal Stem Cells into Cardiomyocyte- like Cells. Yakhteh. 2010; 12(3): 387-394.

 

9. Cohen ED, Tian Y, Morrisey EE. Wnt signaling: an essential regulator of cardiovascular differentiation, morphogenesis and progenitor self-renewal. Development. 2008; 135(5): 789-798.

10. Makino S, Fukuda K, Miyoshi S, Konishi F, et al. Cardiomyocytes can be generated from marrow stromal cells in vitro. Journal of Clinical Investigation 1999; 103(5): 697-705.

11. Shim WS, Jiang S, Wong P, Tan J, et al. Ex vivo differentiation of human adult bone marrow stem cells into cardiomyocyte-like cells. Biochemical and biophysical research communications 2004; 324(2): 481-488.

12. Oh H, Bradfute SB, Gallardo TD, Nakamura T, et al. Cardiac progenitor cells from adult myocardium: homing, differentiation, and fusion after infarction. Proceedings of the National Academy of Sciences 2003; 100: 12313-12318.

13. Wang HS, Hung SC, Peng ST, Huang CC, et al. Mesenchymal stem cells in the Wharton's jelly of the human umbilical cord. Stem Cells 2004; 22(7): 1330-1337.

14. Hamidabadi HG, Pasbakhsh P, Amidi F, Soleimani M, et al. Functional Concentrations of BMP4 on Differentiation of Mouse Embryonic Stem Cells to Primordial Germ Cells. IJFS. 2011; 5: 104-109.

15. Martin‐Rendon E, Sweeney D, Lu F, Girdlestone J, et al. 5‐Azacytidine‐treated human mesenchymal stem/progenitor cells derived from umbilical cord, cord blood and bone marrow do not generate cardiomyocytes in vitro at high frequencies. Vox sanguinis. 2008; 95: 137-148.

16. Dambrot C, Passier R, Atsma D, Mummery C. Cardiomyocyte differentiation of pluripotent stem cells and their use as cardiac disease models. Biochem J. 2011; 434(1): 25-35.

17. Baharvand H, Azarnia M, Parivar K, Ashtiani SK. The effect of extracellular matrix on embryonic stem cell-derived cardiomyocytes. J mol and cell cardiol. 2005; 38(3): 495-503.

18. Kehat I, Kenyagin-Karsenti D, Snir M, Segev H, et al.  Human embryonic stem cells can differentiate into myocytes with structural and functional properties of cardiomyocytes. Journal of Clinical Investigation 2001; 108: 407-414.

19. Huber I, Itzhaki I, Caspi O, Arbel G, et al. Identification and selection of cardiomyocytes during human embryonic stem cell differentiation. The FASEB Journal 2007; 21: 2551-2563.

20. Antonitsis P, Ioannidou-Papagiannaki E, Kaidoglou A, Papakonstantinou C. In vitro cardiomyogenic differentiation of adult human bone marrow mesenchymal stem cells the role of 5-azacytidine. Interactive cardiovascular and thoracic surgery. 2007;  6(5): 593-597.

21. Balana B, Nicoletti C, Zahanich I, Graf EM, et al. 5-Azacytidine induces changes in electrophysiological properties of human mesenchymal stem cells. Cell Research. 2006; 16: 949-960.

22. Marvin MJ, Di Rocco G, Gardiner A, Bush SM, et al. Inhibition of Wnt activity induces heart formation from posterior mesoderm. Genes & development. 2001; 15: 316-327.

23. Tzahor E, Lassar AB. Wnt signals from the neural tube block ectopic cardiogenesis. Genes & development. 2001; 15: 255-260.

24. Klug MG, Soonpaa MH, Koh GY, Field LJ. Genetically selected cardiomyocytes from differentiating embronic stem cells form stable intracardiac grafts. Journal of Clinical Investigation. 1996; 98(1): 216-224.

25. Segev H, Kenyagin‐Karsenti D, Fishman B, Gerecht‐Nir S, et al. Molecular analysis of cardiomyocytes derived from human embryonic stem cells. Development, growth & differentiation 2005; 47(5): 295-306.

26. Xu W, Zhang X, Qian H, Zhu W, et al. Mesenchymal stem cells from adult human bone marrow differentiate into a cardiomyocyte phenotype in vitro. Experimental Biology and Medicine. 2004; 229: 623-631.

27. Cai C-L, Liang X, Shi Y, Chu P-H, et al. Isl1 identifies a cardiac progenitor population that proliferates prior to differentiation and contributes a majority of cells to the heart. Developmental cell. 2003; 5: 877-889.

28. Xu C, Police S, Rao N, Carpenter MK. Characterization and enrichment of cardiomyocytes derived from human embryonic stem cells. Circulation research. 2002; 91(6): 501-508.

29. Snir M, Kehat I, Gepstein A, Coleman R, et al. Assessment of the ultrastructural and proliferative properties of human embryonic stem cell-derived cardiomyocytes. American Journal of Physiology-Heart and Circulatory Physiology. 2003; 285(6): H2355-H2363.