ارزیابی بیان مارکرهای پرتوانی در کلونی های سلول هایES-like حاصل از اسپرماتوگونی و سلول های بنیادی جنینی

نویسندگان

دانشگاه علوم پزشکی مازندران، دانشکده پزشکی، گروه آناتومی و بیولوژی سلولی، ساری، ایران

چکیده

هدف:اخیرا ماهیت پرتوانی سلول‏های بنیادی اسپرماتوگونی (Spermatogonial Stem Cells, SSCs) در محیط کشت مورد توجه قرار گرفته است. هدف از تحقیق حاضر تولید سلولهای شبه بنیادی جنینی ES-like cells) (Embryonic Stem like cells, از SSCs و بررسی تغییرات مورفولوژیک و ژنتیکی در این سلول‏ها نسبت به سلول‏های بنیادی جنینی ESCs)  (Embryonic stem cells, است. مواد و روش‏ها: سلول‏های اسپرماتوگونی از بیضه موش نوزاد با استفاده از یک روش هضم مکانیکی و آنزیمی دو مرحله‏ای استخراج شده ودر محیط حاوی DMEM و FBS 15 درصد کشت داده شدند. به‏طوری‏که در پاساژ پنجم کلونی هایES-like cells  حاصل شد. بیان ژن‏های اختصاصی اسپرماتوگونی  Stra8،,DAZLPlzfو ژن‏های پرتوانی Nanog، SOX2،  Klf4 به‏روش RT-PCR، فعالیت آنزیم آلکالین فسفاتاز و نشانگر پرتوانی Oct4 به‏روش ایمونوسیتوشیمی در سلول‏هایES-like cells  بررسی و با سلول‏های ESCs مقایسه شد. نتایج:ماهیتسلول‏های ES-like cells حاصله توسط معیارهای نظیر مورفولوژی، میزان بالای فعالیت آلکالین فسفاتاز و نشانگر پرتوانی Oct4 مورد تایید قرار گرفت. طی تبدیل سلول‏های اسپرماتوگونی به سلول‏های ES-like cells بیان ژن‏های اختصاصی نظیر Stra8،,DAZLPlzfکاهش و بیان ژن‏های پرتوانی نظیر Nanog، SOX2، Klf4 افزایش می‏یابد. نتیجه‏گیری: کشت سلول‏های اسپرماتوگونی منجر به تولید کلونی‏های  ES-like cellsمی شود این فرآیند همراه با تغییرات ژنتیکی گسترده‏ای در بیان ژن‏های اختصاصی اسپرماتوگونی و ژن‏های پرتوانی در سلول‏های ES-like cells می‏باشد. در مجموع سلول‏های اسپرماتوگونی می‏تواند دریچه‏ای به‏سمت دستیابی به سلول‏های پرتوان مورد استفاده قرار گیرد.

کلیدواژه‌ها


مقدمه

سلول‏های بنیادی اسپرماتوگونی(Spermatogonial Stem Cells, SSCs)  از طریق گامت‏زایی اطلاعات ژنتیکی را از نسلی به نسل دیگر منتقل می‏کنند (1). علی‏رغم انتقال اطلاعات ژنتیکی که مهم‏ترین عمل سلول‏های بنیادی اسپرماتوگونی است. مطالعات جدید الگوی تکاملی دیگری را نیز برای این سلول‏ها در نظر می‏گیرند (2). سلول‏های اسپرماتوگونی پس از کشت در محیط In vitro کلونی‏های سلولی ES-like cells) (Embryonic Stem like cells, را شکل می‏دهند که این سلول‏ها به سلول‏های بنیادی جنینی ESCs)  (Embryonic stem cell, شبیه هستند و دارای قابلیت خودترمیمی (Self-renewal) و تولید هر سه نوع لایه زایای اکتودرمی، مزودرمی و آندودرمی می‏باشند (3).

طی تبدیل شدن سلول‏های اسپرماتوگونی به سلول‏های ES-like cells بیان ژن‏ها دستخوش تغییرات گسترده‏ای می‏گردند به‏طوری‏که برخی از ژن‏های پر توانی نظیر ,SOX2,SSEA1 Nanog ،C-myc و Oct4 افزایش می‏یابد که برای برنامه ریزی مجدد  (Reprogramming) فیبروبلاست به‏مرحله پر توانی ضروری است )4). در حالی‏که بیان مارکرهای اختصاصی سلول‏های اسپرماتوگونی شامل Stra8، ,DAZLPlzf کاهش می‏یابد (5).

نظریه‏ی خاصیت پرتوانی سلول‏های اسپرماتوگونی برای نخستین‏بار در سال 2004 پس از کشت سلول‏های بنیادی اسپرماتوگونی موش تازه متولد شده عنوان شد (6).  محققان دیگر پس از کشت سلول‏های اسپرماتوگونی موش بالغ ES-like cells حاصله را به انواع مختلف سلولی تمایز دادند (7). همچنین نتایج مشابهی پس از کشت سلول‏های اسپرماتوگونی انسانی به‏دست آمد (8).

امروزه استراتژی‏های سلول درمانی فعالیت تکثیری گسترده و پرتوانی سلول‏های بنیادی اسپرماتوگونی را پیشنهاد می‏دهد (9). در واقع این سلول‏ها می‏توانند به حد کافی تکثیر و گسترش یابند که منبع کافی جهت تولید سلولی برای درمان بسیاری از بیماری‏ها و ضایعات ژنتیکی فراهم آورند (10).

منشا سلول‏های بنیادی اسپرماتوگونی سلول‏های اپی‏بلاست جنینی هستند که این سلول‏ها تحت القای BMP4) (Bone Morphogenetic Protein 4, وارد مرحله اختصاصی شدن می‏شوند (11). سپس این سلول‏ها به مزودرم خارج رویانی مهاجرت کرده و در گناد در حال تکامل به سلول‏های رده اسپرماتوگونی تمایز می‏یابند (12و13). سلول‏های بنیادی اسپرماتوگونی مارکرهای ویژه را نظیر Stra8 ,Plzf ,Dazl را بیان می‏کنند که از این مارکرها به‏عنوان مارکرهای اختصاصی اسپرماتوگونی جهت جداسازی این سلول‏ها استفاده می‏شود (14). علاوه بر این تحقیقات جدید نشان می‏دهد که سلول‏های اسپرماتوگونی دارای پتانسیل تشکیل کلونی‏های سلولی ES-like cells تحت شرایط محیط کشت in vitro و حتی بدون دستکاری‏های ژنتیکی می‏باشند (15). این کلونی‏ها از نظر مورفولوژی بسیار شبیه کلونی‏های سلولی بنیادی جنینی هستند. این کلونی‏ها مشابه کلونی‏های مشتق شده از سلول‏های بنیادی جنینی دارای قابلیت خودترمیمی و تولید هرسه نوع لایه زایای جنینی می‏باشند )16-19).

در همین راستا نتایج تحقیقات Huang  و Glasser (20و21) نیز موید ظهور کلونی سلول‏های ES-like cells پس از کشت سلول‏های اسپرماتوگونی بودند که این کلونی‏ها از نظر مورفولوژی مشابه سلول‏های ES-like cells  بوده و مارکرهای پرتوانی و میزان بالای از فعالیت آلکالین فسفاتاز را خود بیان کردند. با توجه به گزارشات مذکور و اهمیت استفاده از سلول‏های اسپرماتوگونی به‏عنوان یک منبع سلولی جدید برای تولید و دستیابی به سلول‏های پرتوان، لذا تحقیقات بیشتری در زمینه کشت سلول‏های اسپرماتوگونی و تولید سلول‏هایES-like cells  ضروری به‏نظر می‏رسد. بنابراین هدف از تحقیق حاضر تولید سلول‏ها ES-like cells پس از کشت سلول‏های اسپرماتوگونی و بررسی تغییرات مورفولوژی و ژنتیکی حاصله در این سلول‏ها و مقایسه با سلول‏های اسپرماتوگونی و سلول‏های بنیادی جنینی است.

 

مواد و روش‏ها

تهیه و جداسازی سلول‏های اسپرماتو گونی:در این تحقیق از سلول‏ها‏ی اسپرماتوگونیموش نوزاد 2 تا 4 روز استفاده شد. بدین ترتیب سلول‏های اسپرماتوگونی از بیضه موش نوزاد توسط دو مرحله هضم مکانیکی و آنزیمی جداسازی می‏شوند (22).

مرحله اول هضم مکانیکی: در این مرحله پس از جداسازی کپسول، بیضه‏های موش های نوزاد 2 تا 4 روزه نژاد NMRIدر محیط کشت حاوی آنزیم‏های لازم جهت هضم آنزیمی به‏طور مکانیکی قطعه قطعه و به مدت 1 ساعت در دمای 37 درجه سانتی‏گراد انکوبه شد. در طی این مدت محیط حاوی بیضه‏ها، هر 10 دقیقه یک بار به آرامی و توسط سمپلر به‏مدت 1 دقیقه به‏هم زده می‏شد. پس از 1 ساعت، محیط حاوی سلول‏ها و قطعات لوله‏های منی‏ساز به‏مدت 5 دقیقه با سرعت RPM1200 سانتریفیوژ شده و محیط بالای رسوب ته لوله با محیط DMEM تازه جایگزین شد. این‏کار باعث حذف بافت بینابینی، از قطعات بیضه شد. حاصل اولین مرحله هضم آنزیمی در انتهای این مرحله قطعات لوله‏های منی‏ساز بودند که برای هضم بیشتر وارد مرحله دوم هضم آنزیمی شدند.

مرحله دوم هضم آنزیمی: به‏منظورجدا شدن سلول‏ها از قطعات لوله‏های منی‏ساز حاصل از اولین مرحله هضم آنزیمی، لوله‏ها در محیطی مشابه مرحله اول به‏مدت 1 ساعت در دمای 37 درجه سانتی‏گراد انکوبه شدند. در طی این مدت هر 10 دقیقه یک بار، محلول حاوی لوله ها توسط سمپلر و به‏مدت یک دقیقه به‏منظور خرد شدن تجمعات سلولی موجود در تعلیق تا حد امکان به‏طور کامل هم زده شد. در انتهای زمان انکوباسیون تعلیق فوق جهت جداسازی قطعات هضم نشده با سرعت معادل  rpm400 و به‏مدت 5 دقیقه سانتریفیوژ شد. قطعات هضم نشده لوله‏های منی‏ساز در ته لوله رسوب کرده و سلول‏های منفرد و برخی از تجمعات سلولی در بالای تعلیق قرار گرفتند. مایع سلولی بالای رسوب از فیلترهای نایلونی 70 میکرومتر عبور داده شد. تعلیق حاصل عمدتا حاوی سلول‏های سرتولی، اسپرماتوگونی بود که در مراحل بعدی از یکدیگر جدا شدند (22).

جداسازی سلول‏های سرتولی: جداسازی سلول‏های سرتولی از تعلیق سلولی حاصل از مرحله دوم هضم آنزیمی با استفاده از روش اسکارپینو و همکاران (22) انجام شد. برای این منظور از 5  میکرو گرم بر میلی‏لیتر لکتین داچورا استرامونیوم اگلوتینین (DSA, Sigma, USA) در بافر فسفات استفاده شد پتری دیش حاوی این محلول به‏مدت یک ساعت در دمای 37 درجه سانتی‏گراد انکوبه شد. پس از شستشوی پتری دیش با بافر فسفات سالین (Phosphate Buffered Saline, PBS) حاوی 5/0 درصد سرم آلبومین گاوی (Bovine Serum Albumin,BSA) محصولات شرکت Sigma تعلیق سلولی به پتری دیش پوشیده با لکتین DSA منتقل شده و به‏مدت یک ساعت در دمای 32 درجه سانتی‏گراد و فشار 5 درصد CO2، انکوبه شد. پس از یک ساعت انکوباسیون سلول‏های شناور به‏عنوان سلول‏های اسپرماتوگونی در نظر گرفته شدند درحالی‏که سلول‏های چسبیده به کف پتری به‏عنوان سلول‏های سرتولی شناخته شدند. (22).

 کشت سلول‏های اسپرماتوگونی: سلول‏های اسپرماتوگونی در محیط  ES medium که حاوی DMEM، FBS 15 درصد، (1000 IU/ml; Chemicon) LIF، 1 درصد اسید‏های آمینه غیر ضروری، بتا مرکاپتواتانول mM1 و 1 درصد پنی سیلین/ استرپتومایسین بوده  کشت داده شدند. پاساژ سلول‏های اسپرماتوگونی هر سه روز یک‏بار و با استفاده از تریپسین-EDTA و پیپتاز انجام شد. در هر گروه به تعداد پنج بار مراحل کشت سلولی تکرار شد.

ایجاد ES-like cell: سلول‏های اسپرماتوگونی در محیط   ES mediumبه‏مدت دو تا سه هفته کشت داده شدند. سلول‏ها هر هفته دو بار پاساژ داده شده و در پاساژ پنجم معادل هفته 3  کشت کلونی‏های ES-like cells حاصل شد.

کشت سلول بنیادی جنینی موش(ESC) : در پژوهش فوق از رده سلولی بنیادی جنینی موشی (CGR8) مشتق از گونه موش SV/129،  اهدائی از طرف دکتر سلیمانی (دانشگاه تربیت مدرس) استفاده شد. کشت اولیه سلول‏های بنیادی جنینی در محیط کشتES mediumبوده که پس ازبررسی سلول‏ها در زیر میکروسکوپ، به‏صورتروزانهتعویض محیط کشت انجام شد

 ارزیابی سلول‏هایES-like Cells : در مطالعه حاضر سعی شد با به‏کارگیری روش‏های متفاوتی حضور سلول‏های ES-like cells حاصله مشخص گردید که شامل ارزیابی‏های مورفولوژیک، ایمونوسیتوشیمی و مولکولی بود. ماهیت پر توانی سلول‏های ES-like cells از طریق مقایسه با سلول‏های بنیادی جنینی ذکر شده به‏عنوان کنترل مثبت انجام شد. 

ارزیابی‏های مورفولوژیک: پس از گذشت 3 تا 4 روز از کشت سلول‏های اسپرماتوگونی به‏تدریج کلونی‏های اسپرماتوگونی ظاهر شدند. این کلونی‏ها از نظر ویژگی‏های مورفولوژیک و شکل ظاهری توسط میکروسکوپ معکوس مورد ارزیابی قرار گرفتند. همچنین کلونی‏های ES-like cells حاصله از کشت سلول‏های اسپرماتوگونی در هفته چهارم نیز از نظر ویژگی مذکور مجددا مورد ارزیابی و مقایسه با کلونی های سلولی اسپرماتوگونی و ESC قرار گرفتند.

  هیستوشیمی آلکالین فسفاتاز: برای ارزیابی آلکالین فسفاتاز (Sigma) ابتدا سلول‏های حاصل از کلونی‏های اسپرماتوگونی، ES-like cells و سلول بنیادی جنینی به‏وسیله PBS سه مرتبه شستشو شدند. ابتدا سلول‏ها در محلول تثبیت کننده که حاوی استن، فرمالدئید و سیترات به‏مدت 10 دقیقه فیکس شدند. در مرحله بعد سلول‏ها توسط محلول Tris 0.1 M دو مرتبه شستشو داده شدند. سپس سلول‏های فیکس شده در محلولی که حاوی Violet (Sigma) 0.5 mg/ml Fast Red و 40 μl/ml Naphtol Phosphate به مدت 45 دقیقه در دمای اتاق، نسبتا مرطوب و تاریک انکوبه شدند. در نهایت سلول‏ها با آب مقطر شستشو شدند و محل‏های فعالیت آنزیم آلکالین فسفاتاز توسط میکروسکوپ نوری Olympus  مشاهده و عکس‏برداری شدند (23).

 ارزیابی ایمونوسیتوشیمی: در ابتدا سلول‏های حاصل از کلونی‏های اسپرماتوگونی، ES-like cells و سلول بنیادی جنینی توسط  PBSسه مرتبه شستشو شدند. سلول‏های مذکور در محلول پارافرمالدئید 4 درصد در دمای اتاق به‏مدت یک شب تثبیت شدند. سپس سلول‏ها با محلول Tween 20  0.05% + PBS شستشو داده شده و با محلول Triton X-100 0.2% نفوذپذیر شده و مجددا توسط محلول Tween 20  0.05% +  PBS به‏مدت 5 دقیقه شسته شدند و سلول‏ها به‏مدت 60 دقیقه در دمای اتاق با سرم بز پوشانده شدند. آنتی بادی اولیه Oct4 (Goat polyclonal IgG, ab764, abcam system) به رقت 200/1 در محلول Tween 20  0.05% +  PBS+ BSA 1% به‏مدت یک شب در دمای 4 درجه سانتی‏گراد به سلول‏های مذکور اضافه شد. پس از سه مرتبه شستشو با PBS، سلول‏های مذکور توسط آنتی‏بادی ثانویه (Phycoerythrin (PE) -conjugated Donkey polyclonal to Goat IgG, ab976,abcam system) به رقت 100/1 در محلول Tween 20 0.05% +  PBS+ BSA 1% به‏مدت یک ساعت در دمای اتاق و در شرایط تاریکی انکوبه شدند. رنگ آمیزی هسته سلول‏ها با استفاده از DAPI محصول شرکت سیگما صورت پذیرفت و در انتها بررسی نمونه‏ها با استفاده از میکروسکوپ فلورسانسOlympus phase contrast microscope (BX51, Olympus, Tokyo, Japan) صورت گرفت (24و25).

ارزیابی مولکولی: به‏منظور ارزیابی بیان ژن‏هایStra8 ، Plzf،Dazl ،Nanog ، Klf4، SOX2 از روش نسخه برداری معکوس واکنش زنجیره‏ای پلی مراز (RT-PCR) استفاده شد. بدین ترتیب که  RNA کل با استفاده از کیت RNA Plus (محصول شرکت فرمنتاز) از کلونی‏های حاصل از اسپرماتوگونی، ES-like cells و سلول بنیادی جنینی استخراج شده و پس از اطمینان یافتن از کیفیت RNA استخراج شده، جهت تبدیل mRNA مورد نظر به  cDNAاز پرایمر الیگو dT (MWG-Biotech AG) و آنزیم نسخه بردار معکوس (Gibco BRL, M-MLV)  استفاده شد. لازم به‏ذکر است که پرایمرهای مورد استفاده تحقیق مذکور در جدول 1 آورده شدند (28-26).

 

 

 

 

جدول 1: ویژگی‏ها و توالی پرایمر‏های ذکر شده در تحقیق حاضر.

     Primer (forward/reverse)                                                         Significance                   

Gene

5'- ACGACGCGTCGCTATTCCCTCTCACATCTTC-3'                       Spermatogonial marker

5'- AGCGAGCTCGATGCACCTTCGACACTTG -3'

5'- CCACCACAGTTCCAGAGTGTTTGG-3'                                          Spermatogonial marker

5'- CTTGAGTAACAAGAGAGTTTCTCAG-3'

5'-CAAGAAGTTCAGCCTCAAGCA-3'                                                  Spermatogonial marker

5'-CACTCAAAGGGCTTCTCACC-3'

5'-CTGGGAACGCCTCATCAA-3'                                                          Pluripotency marker

5'-CGCATCTTCTGCTTCCTGG-3'

5'-CAGCTCGCAGACCTACATGA-3'                                                     Pluripotency marker

5'-TGGAGTGGGAGGAAGAGGTA-3'

5'-GAAATTCGCCCGCTCCGATGA-3'                                                   Pluripotency marker

5'-CTGTGTGTTTGGTAGTGCC-3'

5'- CTTCTTGGGTATGGAATCCTG -3'                                                  Internal control

5' - GTGTTGGCATAGAGGTCTTTAC-3

Stra8

 

DAZL

 

Plzf

 

Nanog

 

Sox2

 

Klf4

 

β actin

 

 

 

نتایج

تاییدهویت سلول‏هایES-like cells  

مورفولوژی

کلونی‏های ES-like cellsبه لحاظ مورفولوژیک بسیار شبیه کلونی‏هایسلول‏های بنیادی جنینیو دارای شکلکروی تا بیضی با محدود سلولی نامشخص بودند.

توانایی تولید اجسام شبه جنینی

سلول‏هایES-like cells در صورت کشت معلق قادر به تشکیل دستجات و تولید اجسام شبه جنینی (Embryoid Bodies, EBs) هستند.

سنجش آنزیم آلکالین فسفاتاز

بررسی هیستوشیمی آنزیم آلکالین فسفاتاز نشان داد که سلول‏هایES-like cells مشابه ESC دارای فعالیت آلکالین فسفاتازی نسبتا بالای هستند. به‏طوری‏که محل‏های فعالیت آنزیم به‏صورت نقاط صورتی تا قرمز قابل مشاهده است. علاوه بر این سلول‏های مشتق شده از اسپرماتوگونی نیز دارای فعالیت آلکالین فسفاتاز می‏باشند (شکل 1،A  و (B.

ردیابی نشانگر سلولی Oct4

به‏کارگیری آنتی‏بادی ضد  Oct4به‏روش ایمونویستوشیمی بیان این نشانگر را در سلول‏های ES-like cells مذکور به اثبات رسانید (شکل 2‌، (B، علاوه بر این بیان این پروتئین در ES-like cells مشابه سلول‏های بنیادی جنینی بوده (شکل 2، (D که این امر دال بر فعالیت پرتوانی سلول‏های ES-like cells است. هر چند که در کلونی‏های حاصل از اسپرماتوگونی این نشانگر ظهور پیدا نکرد (شکل 2، (F.

 

 

 

شکل 1: ارزیابی هیستوشیمی آنزیم آلکالین فسفاتاز. (A). کلونی‏های حاصل از ESC و(B)  کلونی‏هایES-like cells  مشتق از سلول‏های بنیادی اسپرماتوگونی، بزرگنمایی ×400.

 

 

 

شکل2:روش ایمونوسیتوشیمی برای تعیین محل Oct4 در کلونی‏های ES-like. (A)، کلونی‏های حاصل از سلول‏های بنیادی جنینی، (B)، کلونی‏های حاصل از سلول‏های بنیادی جنینی، (C)  در کلونی‏های حاصل از اسپرماتوگونی ،(D) در کلونی‏های حاصل از اسپرماتوگونی، (E) توسط DAPI به رنگ آبی در آمده اند، (F) همچنین هسته سلول‏ها به‏ترتیب برای کلونی‏های ES-like ، بزرگنمایی ×400.

 

بررسیمولکولی

بررسی مولکولی با روش  RT-PCR نشان داد که ژن‏های اختصاصی اسپرماتوگونی نظیرStra8 ,Plzf ,Dazl  در کلونی‏های اسپرماتوگونی به‏طور واضحی بیان می شوند  در حالی‏که ژن‏های فوق در کلونی‏های ES-like cells و ESC بیان نمی شوند. ‏علاوه بر این میزان بیان ژن‏های پرتوانی نظیر  Nanog ,Klf4 SOX2 ، در کلونی‏های ES-like cells مشابه ESC بیان شد درحالی‏که ژن‏های مذکور در کلونی‏های حاصل از اسپرماتوگونی بیان نگردید (شکل 3).

 

شکل3: ژل الکتروفورز بیان ژن‏های اختصاصی اسپرماتوگونی و ژن‏های پرتوانی در کلونی‏های حاصل از اسپرماتوگونی، ES-like cells و ESC. همچنین ژن actinβ به‏عنوان کنترل داخلی در نظر گرفته شد.

 

بحث

سلول‏های بنیادی اسپرماتوگونی جمعیت زایای در بیضه‏ها هستند که بر روی غشای پایه لوله‏های منی ساز قرار گرفته و با عمل اسپرماتوژنز وظیفه انتقال ژنتیکی را بر عهده دارند (29). این سلول‏ها دارای ویژگی‏هایی نظیر قابلیت خودترمیمی و تکثیر سلولی هستند (30). به‏طوری‏که این ویژگی منجر به تولید کلونی‏های اسپرماتوگونی در شرایط in vitro می‏شود. در تحقیق حاضر 3 الی 4 روز پس از جداسازی و کشت سلول‏های اسپرماتوگونی، کلونی‏های فوق ظاهر شدند. پس از بررسی‏های مولکولی ثابت شد که این سلول‏ها مارکرهای اختصاصی اسپرماتوگونی نظیر Stra8 ,Plzf ,Dazl را بیان کردند. در همین ارتباط Sadri ardekani و  Yamazaki(31و32) اظهار داشتند که کلونی‏های  ES-likeمشتق شده از سلول‏های اسپرماتوگونی تمامی مارکرهای پرتوانی را طی تمایز بروز دادند و در ادامه مطالعات پیوند (Transplantation) ویژگی تومورزایی سلول‏های مذکور را نشان دادند که خود دال بر ویژگی پرتوانی و برنامه ریزی مجدد این سلول‏ها به سلول‏های ES-like می‏باشد و در ادامه امکان ایجاد موجود کایمرا (chimaeric animal) نیز از این سلول‏ها حاصل گردید. بنابراین این فرآیند یک مثال واضحی از تمایز سلول‏های پرتوان از سلول‏های پستانداران بالغ می باشد که احتمالا برای مطالعات پایه بیولوژیک و درمان بیماری‏های ژنتیکی (Genetic Diseases) مفید می‏باشد.

 در همین راستا نتایج تحقیقات Guan و همکاران (16) نشان داد که کلونی‏های سلول‏های اسپرماتوگونی توسط مارکرهای SSEA1 و Oct4 مشخص می‏شوند. علاوه بر این برای شناسایی کلونی‏های سلول‏های اسپرماتوگونی از مارکرهای Stra8 و Mvh  استفاده شد. در ادامه پس از 3 هفته کشت سلول‏های اسپرماتوگونی به‏تدریج کلونی‏هایES-like  ظاهر شدند. این کلونی‏ها متشکل از سلول‏های متراکم و با حاشیه سلولی کاملا مشخص و واضح مشابه کلونی‏های حاصل از سلول‏های بنیادی جنینی هستند. در تحقیق حاضر از یک روش کشت ساده و کوتاه به‏منظور ایجاد سلول‏های ES-like از سلول‏های بنیادی اسپرماتوگونی در شرایط محیط کشت استفاده شد. هر چند که در این راستا روش‏ها و فاکتورهای مختلفی گزارش شده است. اهمیت روش فوق زمانی مشخص می‏گردد که با پروتکول‏های طولانی مدت و وقت‏گیر به‏کار رفته دیگر مقایسه گردد.  به‏منظور شناسایی ماهیت کلونی‏های ES-like از ارزیابی‏های مولکولی و ایمونوسیتوشیمی استفاده شد. در سطح مولکولی مشخص شد که این سلول‏ها مارکرهای پرتوانی نظیر SOX2, Klf4,Nanog را بیان می‏کنند. بررسی‏های مولکولی کلونی های ESC نیز موید بیان ژن‏های فوق در این کلونی هستند که این امر دال بر ماهیت پرتوانی سلول‏های فوق است. علاوه بر این نتایج پژوهش حاضر نشان داد که طی تبدیل سلول‏های اسپرماتوگونی به سلول‏های ES-like، بیان ژن‏های اسپرماتوگونی Stra8, DAZLPlzf کاهش و در عوض بیان ژن‏های سلول‏های بنیادی افزایش می‏یابد. این مساله همراستا با نتایج Guan وShinohara  (6 و 16) است که تغییرات گسترده‏ای از ژن‏ها‏ی را طی تبدیل سلول‏های اسپرماتوگونی به سلول‏های ES-like گزارش کردند. به‏طوری‏که طی تبدیل سلول‏های ES-like از سلول‏های اسپرماتوگونی ژن‏های پرتوانی افزایش و ژن‏های احتصاصی اسپرماتوگونی کاهش می‏یابند. به‏منظور ارزیابی اینکه آیا کلونی‏های ES-like ویژگی پرتوانی را دارند از ایمونوسیتوشیمی Oct4 استفاده شد. سلول‏های بیان کننده Oct4 در کلونی‏های سلول‏های ES-like و ESC به‏وضوح مشاهده شدند که بیانگر خاصیت پرتوانی هر دو تیپ سلولی می‏باشد. یکی از مهم‏ترین فاکتورها در عامل ایجاد خودترمیمی فاکتور نسخه برداری(Pou5f1)  Oct4 است که جهت حفظ پرتوانی این سلول‏ها ضروری می‏باشد. همچنین تحقیقات اخیر نشان داد که تمایز اولیه اپی‏بلاست‏ها به سه لایه زایای جنینی طی گاسترولاسیون به مقادیر مشخص فاکتور نسخه‏برداری(Pou5f1)  Oct4 وابسته است. بنابراین طی تمایز سلولی Oct4  در تعیین سرنوشت سلولی (Cell Fate) سلول‏های در حال تمایز نقش مهمی دارد (24). با توجه ظهور سلول‏های ES-like از سلول‏های اسپرماتوگونی و بیان فاکتور  نسخه برداری  Oct4در این سلول‏ها، به‏نظر می‏رسد برخی از فاکتورهای موجود در محیط کشت از جمله سرم بتواند از طریق مسیرهای سیگنالی داخل سلولی   PI3k/Aktویژگی‏های خودترمیمی و بنیادی بودن (Stemness) را در سلول‏های ES-like حفظ کند (32) که با نتایج تحقیق حاضر مطابقت دارد.

 با توجه به پروفایل سلولی و مولکولی مشترکی که سلول‏های ES-like با سلول‏های ES دارند لذا می‏توان از این سلول‏ها به‏عنوان یک منبع سلولی جدید برای دستیابی به سلول‏های پرتوان استفاده کرد. به‏نظر می‏رسد که این منبع سلولی جدید قابلیت تمایز به هر سه رده لایه زایای اکتودرمی، مزودرمی و اندودرمی  را در شرایط in vitro داشته باشد (32). در مجموع ایجاد کلونی‏های ES-like پرتوان از سلول‏های اسپرماتوگونی و شناسایی آن‏ها در شرایط محیط کشت می‏تواند یک قدم اولیه و ضروری در زمینه تولید سلول‏های پرتوان باشد که خود می‏تواند در تحقیقات پایه‏ای و سلول درمانی مفید و موثر باشد. 

در مطالعه حاضر کلونی‏های ES-like از برخی جنبه‏ها مشابه سلول‏های بنیادی جنینی هستند از جمله اینکه دارای فعالیت نسبتا بالای آنزیم آلکالین فسفاتاز هستند در حالی‏که میزان فعالیت آنزیم آلکالین فسفاتاز در SSCs نسبتا پایین مشاهده شد. همچنین کلونی‏های ES-like مشابه ESC فاکتور نسخه‏برداری(Pou5f1)  Oct4 را بیان کردند درحالی‏که این فاکتور در SSCs بروز پیدا نکرد. علاوه بر این مطالعات بیان ژن نشان داد که افزایش بیان ژن‏های پرتوانی نظیر ,Nanog  Klf4 ,SOX2 و همزمان کاهش بیان ژن های احتصاصی اسپرماتوگونی نظیرStra8  Plzf ,Dazl در کلونی‏های ES-like حاصله می‏تواند دال بر برنامه ریزی مجدد (Reprogramming) سلول‏های اسپرماتوگونی در شرایط محیط کشت باشد به‏نظر می‏رسد برخی از فاکتورهای محیط کشت نظیر سرم در کنترل مکانیسم این فرآیند نقش داشته باشند که همگی دال بر خاصیت پرتوانی کلونی‏های ES-like می‏باشد.

از سوی دیگر پیشرفت‏های جدید در سلول درمانی منجر به بروز روش‏های نوین علمی در درمان بسیاری از بیماری‏ها و ضایعات ژنتیکی شده است )8). امروزه استراتژی‏های سلول درمانی متعددی با استفاده از منابع مختلف مانند سلول‏های بنیادی مغز استخوان، سلول‏های بنیادی خونی و سلول‏های بنیادی جنینی در دست بررسی و مطالعه‏اند (9).

در مجموع به‏نظر می‏رسد کشت سلول‏های اسپرماتوگونی در شرایط In vitro باعث ایجاد تغییرات گسترده‏ای در بیان ژن‏ها و مارکرهای اسپرماتوگونی و پرتوانی می‏شود. به‏طوری‏که عناصر محیط کشت سرنوشت این سلول‏ها را به سمت سلول‏های پرتوان سوق می‏دهند. لذا بررسی‏های دقیق تر و جزیی‏تر این تغییرات امری ضروری است که باید مورد توجه محققین قرار گیرد.

شواهد متعددی از جمله یافته‏های مطالعه حاضر فعالیت تکثیری گسترده و پرتوانی سلول‏های بنیادی اسپرماتوگونی را پیشنهاد می‏دهد (10) درواقع این سلول‏ها می‏توانند به حد کافی تکثیر و گسترش یابند که منبع کافی برای تولید سلولی برای درمان بسیاری از بیماری‏ها و ضایعات ژنتیکی باشند (6) این ویژگی‏های اسپرماتوگونی استفاده این سلول‏ها را برای درمان های ترمیمی میسر می‏سازد.

 

نتیجه گیری

در مطالعه حاضر کلونی‏های ES-like از برخی جنبه‏ها مشابه سلول‏های بنیادی جنینی هستند از جمله اینکه دارای فعالیت نسبتا بالای آنزیم آلکالین فسفاتاز هستند در حالی‏که میزان فعالیت آنزیم آلکالین فسفاتاز در SSCs نسبتا پایین مشاهده شد. همچنین کلونی‏های ES-like مشابه ESC فاکتور نسخه‏برداری(Pou5f1)  Oct4 را بیان کردند درحالی‏که این فاکتور در SSCs بروز پیدا نکرد. علاوه بر این مطالعات بیان ژن نشان داد که افزایش بیان ژن‏های پرتوانی نظیر ,Nanog  Klf4 ,SOX2 و هم‏زمان کاهش بیان ژن‏های احتصاصی اسپرماتوگونی نظیرStra8  Plzf ,Dazl در کلونی های ES-like حاصله می‏تواند دال بر برنامه ریزی مجدد (Reprogramming) سلول‏های اسپرماتوگونی در شرایط محیط کشت باشد به‏نظر می‏رسد برخی از فاکتورهای محیط کشت نظیر سرم در کنترل مکانیسم این فرآیند نقش داشته باشند که همگی دال بر خاصیت پرتوانی کلونی‏های ES-like می‏باشد.

1. Olive V, Cuzin F. The spermatogonial stem cell: from basic knowledge to transgenic technology. Int J Biochem  Cell  Biol .2005; 37(2): 246–250.

2. Mardanpour P,  Guan K , Nolte J, Lee J , et al. Potency of germ cells  and its relevance for regenerativemedicine. J Anat. 2008; 213(1): 26–29.

3. Nayernia K, Lee J, Wolfgang E, Nolt J, et al. From stem cells to germ cells and from germ cells to stem cells. Iranian J Reprod Med. 2005; 5(2): 41-44.

4. Stevens LC. Origin of testicular teratomas  from  primordial germ cells in mice. J Nat Cancer.  1967; 38(4): 549-552.

5. Nayernia K. Stem cells derived from testis show promise for treating a wide variety of medical conditions. Cell Res. 2007; 17: 895-897.

6. Shinohara M, Inoue K, Lee J, Yoshimoto M, et al. Generation of pluripotent stem cells from neonatal mouse Testis. Cell. 2004; 119(7): 1001–1012.

7. Ehmcke J, Wistuba J,  Schlatta S.  Spermatogonial stem cells: questions, models and

perspectives.Hum Reprod. 2006; 3: 275–282.

8. Kossack N, Meneses J, Shefi S, Nguyen H, et al. Isolation and characterization of cluripotent human spermatogonial stem cell-derived cells. Stem cells. 2009; 27: 138–149.

9.  Donovan P, Miguel M. Turning germ cells into stem cells. Gen  Dev. 2003; 13: 463–471.

10.  Niels G, Lean J. Seminal discoveries in regenerative medicine: contributions of the male germ line to understanding pluripotency. Hum Mol. 2008; 17: 16-22.

11. Toyooka Y, Tsunekawa N, Akasu R, Noce T. Embryonic stem cells can form germ cells in vitro. Proc Nat Acad Sci U S A. 2003; 100(20):11457–11462.

12. McLaren A. Germ and somatic cell lineages in the developing gonad. Mol Cell Endocrinol. 2000; 163(1-2): 3–9.

13.  Bowles J, Knight D, Smith C, Wilhelm D, et al. Retinoid signaling determines germ cell fate in mice. Sci. 2006;  312: 596–600.

14. Baba S, Heike T, Umeda K, Iwasa T, et al. Generation of cardiac and endothelial cells from neonatal mouse testis-derived multipotent germline stem cells. Stem Cells. 2007;25: 1375-1383.

15. Guan G, Nayernia  K, Lars M, Wagner S, et al. Pluripotency of spermatogonial stem  cells from adult mouse testis. Nature. 2006; 440:1199-1203.

16. Guan K, Wanger S, Unsold B, Lars S, et al. Generation of functional cardiomyocytes from adult mouse spermatogonial stem cells. Circ Res. 2008; 100: 1615-1625.

17. De Rooij DG. Rapid expansion of the spermatogonial stem cell tool box. Proc. Natl. Acad. Sci. USA. 2006; 103(21): 7939-7940.

18. Huleihel M, Abuelhija M, Lunenfeld E. In vitro culture of testicular germ cells: regulatory factors and limitations. Growth Factors. 2007; 25(4): 236-52.

19. De Rooij DJ, Mizrak C. Deriving multipotent stem cells from mouse spermatogonial stem cells: a new tool for developmental and clinical research. Development. 2008; 135: 2207–2213.

20. Glaser T, Opitz T, Kischlat T, Konang R, et al. Adult germ line stem cells as a source of functional neurons and glia. Stem Cells. 2008;26:2434–2443.

21. Huang YH,Chin CC, Ho HN, Chou CK, et al. Pluripotency of mouse spermatogonial stem cells maintained by IGF-1- dependent pathway.  The FASEBJ. 2009; 23(7): 2076-2087.

22.Scarpino S, Morena AR, Petersen C, Fröysa B, et al. A rapid method of Sertoli cell isolation by DSA lectin, allowing mitotic analyses. Mol Cell Endocrinol. 1998; 146(1-2): 121-7.

23.Mirzapour T, MovahedinM, Tengku IbrahimTA, Koruji M, et al. Effects of basic fibroblast growth factor and leukaemia inhibitory factor on proliferation and short-term culture of human spermatogonial stem cells. Andrologia. 2012; 441: 41-55.

24. Hobbs R, Seandel M, Falciatori I, Rafii S, et al. Plzf regulates germline progenitor self-renewal by opposing mTORC1. Cell. 2010; 142(3): 468–479.

25.Ghasemi HH, Pasbakhsh P, Amidi F, Soleimani M, et al. Functional Concentrations of BMP4 on Differentiation of Mouse Embryonic Stem Cells to Primordial Germ Cells.IJFS. 2011; 5(2):104-109.

26.Saitou M, Payer B, Lange UC, Erhardt S, et al. Specification of  germ cell fate in mice. Biol  Sci. 2003; 358: 1363–1370.

27. Izadyar F, Pau F, Marh J, Slepko N, et al. Generation of multipotent cell lines from a distinct population of male germ line stem cells. Reprod. 2008; 135: 771–784.

28. Nayernia K, Nolte J, Michelmann H, Lee J, et al. In vitro-differentiated embryonic stem cells give rise

 

to male gametes that can generate offspring mice. Dev cell. 2006; 11(1): 125-132.

29. Izadyar F, Den Ouden K, Stout  TA, Stout J, et al. Autologous and homologous transplantation of bovine spermatogonial stem cells. Reprod. 2003; 126(6): 765–774.

30. Hayashi K, Ohta H, Kurimoto K, Aramaki S, et al. Reconstitution of the mouse germ cell specification pathway in culture by pluripotent stem cells. Cell. 2011; 146(4): 519–532.

31. Yamazaki  Y. Adult mice cloned from migrating primordial germ cells. Proc. Natl Acad. Sci. USA. 2005;102: 11361–11366.

32. Sadri-Ardekani H, Akhondi MA, van der Veen F, Repping S, et al. In vitro propagation of human prepubertal spermatogonial stem cells. JAMA2011; 305: 2416–2418.