بررسی بیان ژن‏های گلوتاتیون پراکسیداز و گلوتاتیون ردوکتاز بر روی رده‏ی سلولی سرطان پستان (MCF-7) تیمار شده با نانو ذرات اکسید روی

نوع مقاله: علمی - پژوهشی

نویسندگان

- گروه زیست شناسی، واحد تهران مرکزی، دانشگاه آزاد اسلامی، تهران، ایران

چکیده

هدف: هدف از این تحقیق، ارزیابی اثرات ضدسرطانی نانو ذرات اکسید روی با کمک ارزیابی بیان ژن‏های گلوتاتیون  پراکسیداز و گلوتاتیون ردوکتاز در رده سلولی سرطان پستان می‏باشد.
مواد و روش‏ها:در این مطالعه رده‏های سلولی سرطانی پستان (MCF-7) و نرمال (HEK293) تحت تیمار نانو ذرات اکسید روی تحت غلظت‏های مختلف طی زمان 24 ساعت قرار گرفتند. درصد زنده‏مانی نانو ذرات بر روی رده‏های سلولی سرطانی و نرمال با کمک روش رنگ سنجی MTT(3-(4, 5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) ارزیابی شد. بیان کمی ژن‏ها نسبت به ژن کنترل داخلی GAPDH با کمک تکنیک real time PCR بررسی شد.
نتایج:نتایج تست MTT نشان داد که نانو ذرات اکسید روی میزان زنده مانی سلولهای سرطانی را نسبت به سلولهای نرمال به طور معنی داری کاهش می دهد. همچنین، بیان ژنهای گلوتاتیون پراکسیداز و گلوتاتیون ردوکتاز بعد از تیمار با نانو ذرات به ترتیب به میزان 70/0±13/2 (100/0p < ) و 05/0±22/1 (50/0p < ) برابر نسبت به ژن کنترل داخلی افزایش یافت.
نتیجه‏گیری:داده‏های این تحقیق نشان داد افزایش بیان ژن‏های گلوتاتیون پراکسیداز و گلوتاتیون ردوکتاز به ‏عنوان عوامل کلیدی سیستم گلوتاتیون علیه رده‏ی سلولی سرطانی پستان MCF-7 در حذف گونه‏های فعال اکسیژن با تیمار نانو ذرات اکسید روی افزایش می‏یابد.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

سرطان پستان یکی از فراوان­ترین سرطان­های بدخیم غیرپوستی در میان زنان تشخیص داده شده است .براساس گزارشات در سال 2018، 1/18 میلیون مورد جدید و 6/9 میلیون مرگ مرتبط با سرطان پستان مشاهده شده است که انتظار می‏رود تا سال 2030، تقریبا تا 26 میلیون مورد جدید ابتلا به این بیماری افزایش پیدا کند(1).

جراحی، یک راه پیش‏گیری برای پیشرفت سرطان پستان در زنان است. در بیمارانی که تومور پستان شناسایی می‏شود، از استراتژی های مختلفی مانند درمان هدفمند، هورمون درمانی، پرتودرمانی، جراحی و شیمی درمانی استفاده می‏شود. عواض جانبی نامطلوب درمان سرطان پستان یکی از فاکتورهای موثر در یافتن روش‏های جایگزین است (2). با توجه به بالا بودن میزان زنان مبتلا به سرطان پستان و افزایش نرخ ابتلا به این سرطان در دهه اخیر، اهمیت مطالعه پیرامون این سرطان مشخص می‏شد. علاوه بر این روش درمان و داروهای موثر بر سرطان پستان نیز اهمیت ویژه‏ای دارد چرا که بسیاری از بیماران پس از درمان با یک دارو یا روش خاص دچار مقاومت به آن شده و بیماری عود می نماید(3).

در سال‏های اخیر نانوتکنولوژی به‏عنوان یکی از اهداف بزرگ در درمان سرطان‏ها مطرح شده است. از مزایای آن در طراحی دارو می‏توان به افزایش حساسیت به رادیودرمانی، محافظت از آثار سو رادیودرمانی و افزایش سلول‏کشی تومورها می‏توان اشاره کرد. در این میان نانو ذرات اکسید فلزات توجه زیادی را برای درمان سرطان به‏خود اختصاص داده است. اکسید طبیعی فلزات در مقادیر بسیار فراوانی در طبیعت موجودند و تولید آن‏ها هزینه زیادی ندارد، لذا پژوهش در این زمینه را به‏سمت تولید فرآورده های دارویی مقرون به‏صرفه پیش می‏برد و فرآوری و سنتز این نانو ذرات جز کم‏ هزینه‏ترین دستورالعمل‏های سنتز می‏تواند باشد(4،5).نانو ذرات اکسید روی در سال‏های اخیر به‏دلیل اثرات آن در درمان سرطان مورد توجه ویژه‏ای قرار گرفته است. این ترکیب به‏واسطه برداشت بیشتر یون‏های روی توسط سلول‏های سرطانی، اثرات درمانی خود را اعمال می‏کند(6).

سیستم گلوتاتیون در حفاظت بدن از استرس‏های اکسیداتیو نقش حیاتی دارد. این سیستم، پراکسیدهای هیدروژن حاصل از فعالیت آنزیم سوپراکسید دیسموتاز بر روی یون سوپراکسید که یک گونه اکسیژن واکنش پذیر (ROS) خطرناک است را به آب تبدیل می‏کند. گلوتاتیون پراکسیداز و گلوتاتیون ردوکتاز آنزیم‏هایی هستند که در این چرخه نقش حیاتی داشته و بیان ژن‏های آن‏ها در صورت بالارفتن ROSها و قرار گرفتن بدن در حالت استرس اکسیداتیو بالا می‏رود. استرس اکسیداتیو القا شده با گونه‏های فعال اکسیژن باعث القای آپوپتوزیس در سلول‏های سرطانی و غیرسرطانی و از بین رفتن آن‏ها می‏شود(7و8).

در این تحقیق با توجه به احتمال عوارض نامطلوب نانواکسید روی بر روی سلول‏های غیرسرطانی و نیز ضروری بودن تعیین عامل القا کننده آپوپتوزیس ناشی از نانواکسید روی، به بررسی میزان بیان ژن‏های گلوتاتیون پراکسیداز و گلوتاتیون ردوکتاز  در سطح mRNA که شاخص‏هایی از بالا رفتن ROS و استرس اکسیداتیو بوده و القا کننده آپوپتوزیس میباشد، پرداخته می شود.

 

مواد و روش‌ها

­­تهیه نانو ذرات اکسید روی:در این تحقیق نانو ذرات اکسید روی (ZnONPs) خریداری شده از شرکت پیشگامان نانومواد ایرانیان با اندازه بین 10 تا 30 نانومتر و 99 درصد خلوص از شرکت آمریکایی US Research Nanomaterialsبود. ارزیابی ریخت شناسی و اندازه نانو ذرات با کمک میکروسکوپی الکترونی گذاره (TEM) مدلZeiss-EM10C-100 KVساخت کشور آلمان مورد بررسی قرار گرفت (شکل 1).

 

 

شکل1: میکروگراف میکروسکوپی الکترونی گذاره (TEM) از نانو ذرات اکسید روی استفاده شده در این پژوهش

 

کشت سلولی: در این تحقیق از دو رده‏ی سلولی سرطان پستان  MCF-7و رده‏ی سلولی نرمال  HEK293استفاده شد که از انستیتو پاستور ایران تهیه شد. محیط کشت RPMI1640 مکمل شده با 10 درصد سرم FBS برای کشت سلولی مورد استفاده قرار گرفت و در دمای 37 درجه سانتی‏گراد، 5 درصد دی­اکسید کربن و 95 درصد رطوبت انکوباتور تیمار شد. درصد سلول‏های زنده  با رنگ آمیزی سلول توسط تریپان بلو تعیین ­شد. هنگامی که تعداد سلول­ها در داخل فلاسک به تراکم در حدود 80 درصد رسید،  پاساژ داده شدند.

آزمون MTT: روش رنگ سنجی MTT یکی از آزمون‏هایی است که براساس احیا شدن و شکسته شدن کریستال­های زرد رنگ تترازولیوم به‏وسیله آنزیم سوکسینات دهیدروژناز و تشکیل کریستال­های آبی رنگ نامحلول انجام می­شود. ارزیابی زیستایی سلول‏های سرطانی و نرمال مورد بررسی قرار گرفت. بعد از کشت سلولی، سوسپانسیون سلولی (104 سلول در هر میلی‏لیتر) در میکروپلیت­های 96 خانه کاشته شدند و به‏مدت 24ساعت در انکوباتورCO2دار و دمای 37 درجه سانتی‏گراد تیمار شدند. سپس غلظت­های مختلف تهیه شده از نانو ذرات اکسید روی به چاهک­های حاوی سلول‏ها افزوده شد. از محیط کشت حاوی یک درصد DMSO (دی‏متیل سولفوکساید) بدون تیمار نانو به‏عنوان کنترل منفی استفاده شد. چاهک­های حاوی سلول و نانو ذرات به‏مدت 24 ساعت انکوبه شدند. سپس 20 میکرولیتر محلول MTT (سیگما آلدریج، آلمان) (5 میلی‏گرم بر میلی‏لیتر) به‏هر چاهک اضافه شد و به‏مدت 3 ساعت دیگر انکوبه شد. به‏هر چاهک 100 میکرولیتر محلول DMSO اضافه شد و برای حل کردن رسوب بنفش MTT، پلیت کشت به‏مدت 10 دقیقه تکان داده شد. سپس توسط قرائت گرالایزا جذب نوری نمونه­ها در طول موج 570 نانومتر اندازه‏گیری شد (9). درصد میزان زنده‏مانی سلول­ها نیز از فرمول زیر محاسبه شد:

 

ODT : جذب نوری سلول­های تیمار شده با نانو ذرات اکسید روی؛

ODC : جذب نوری سلول­های تیمار شاهد.

غلظتی از ترکیبات مورد آزمایش که درصد حیات سلولی را به نصف تقلیل دهد، به‏عنوان IC50 در نظر گرفته شد.

ارزیابی بیان ژن های گلوتاتیون پراکسیداز و گلوتاتیون ردوکتاز با کمک تکنیک :Real time PCRاستخراج RNA کل سلولی با کشت تعداد 106×1 سلول انجام گرفت. پس از تیمار با نانو ذرات اکسید روی، پلیت‏ها در انکوباتور CO2دار با دمای 37 درجه سانتی­گراد انجام گرفت. استخراج RNA با کیفیت و کمیت­ مناسب از سلول‏ها با کمک کیت استخراج RNA شرکت ترنس، مطابق دستورالعمل شرکت سازنده انجام گرفت. غلظت تمامی RNAهای استخراج شده با استفاده از دستگاه بایوفتومتر کمپانی شرکت اپندورف با طول موج A260/A230 مورد بررسی قرار گرفت.

به‏منظور سنتز cDNA، از مولکول‏های RNA استخراج شده با کمک دستورالعمل کیت شرکت فرمنتازRevert AidTM First Strand cDNA Synthesis محصول کشور آمریکا استفاده شد. مخلوط واکنش PCR شامل 5/0 میکرولیتر پرایمر هگزامر تصادفی، 5 میکرولیتر بافر واکنش5x، یک میکروگرم RNA، 5/0 میکرولیتر پرایمر الیگو (dT)، یک میکرولیتر مهارکننده آنزیم RNase (20 واحد در میکرولیتر)، 1 میکرولیتر آنزیم M-MulV، دو میکرولیتر مخلوط داکسی نوکلئوتید تری­فسفات (10 میلی­مولار)، و آب عاری از آنزیمDNase  (تا حجم نهایی 20 میکرولیتر) به‏هر لوله اضافه شد. نمونه‏ها به‏مدت 5 دقیقه در 65 درجه سانتی‏گراد قرارداده شد. سپس بلافاصله در یخ گذاشته شد. لوله‏ها به‏مدت 1 ساعت در 42 درجه سانتی‏گراد قرار داده شدند.

جهت طراحی پرایمرهای  مورد استفاده از پایگاه اینترنتی www.ncbi.nlm.nih.gov استفاده شد (جدول 1). توالی پرایمرهای طراحی شده با استفاده از نرم افزار BLAST در توالی ژنوم انسان جستجو شد تا از ویژگی توالی و یکتا بودن محل اتصال آن‌ها اطمینان حاصل شود.در این پژوهش از ژن گلیسرآلدهیدفسفات دهیدروژناز (GAPDH) به‏عنوان کنترل داخلی استفاده شد.

 

جدول 1: آغازگر­های استفاده شده برای این پژوهش

ژن ها

پرایمرها

 

 

گلوتاتیون پراکسیداز

ˈ F:3- AGAAGTGCGAGGTGAACGGT ˈ5

 

 

 

ˈR:3- CGATGTCAATGGTCTGGAAGCˈ 5

 

 

گلوتاتیون ردوکتاز

ˈF:3- CCTTCTTTGGTGGCAATTCTATCT ˈ5

 

 

 

ˈR:3- CCCCTTCAGAGCCCATAGTCA  ˈ5

 

 

GAPDH

ˈF:3- AAGGGCCCTGACAACTCTTT ˈ5

 

 

 

ˈR:3- CTCCCCTCTTCAAGGGGTCT ˈ5

 

 

 

روش کمیت ­سنجی ژن‏ها با کمک دستگاه RealTime PCR مدل ABI 7300 (Applied Biosystems, Foster City, CA, USA) انجام گرفت. محلول واکنش شامل 5 میکرولیتر cDNA، 5/12میکرولیتر مخلوط واکنش PCR حاوی سایبرگرین (SYBER-Green PCR Master Mix)، 1 میکرولیتر از هر پرایمر جلویی و برگشتی و 5/5 میکرولیتر آب مقطر دیونیزه فاقد نوکلئاز بود. همچنین برنامه زمانی-گرمایی دستگاه برای تکثیر ژن‏ها شامل بازشدن اولیه DNA در دمای 95 درجه سانتی­گراد به‏مدت 30 ثانیه و واسرشتگی در دمای 95 درجه سانتی­گراد به مدت 20 ثانیه طی تکرار 40 چرخه، اتصال پرایمرها به DNA الگو 62 درجه سانتی­گراد به‏مدت 60 ثانیه و طویل شدن رشته الگو در مدت  زمان 30 ثانیه در دمای 72 درجه سانتی­گراد انجام شد. پس از انجام واکنش PCR، اختلاف چرخه آستانه (Ct) سلول‏های تیمار شده و تیمار نشده با نانو ذرات به‏دست آمد. همچنین با استفاده از فرمول DDCt، نسبت ژن هدف به ژن مرجع از طریق فرمول 2-DDCt محاسبه شد.

 

 

تحلیل آماری

داده‏های این تحقیق با کمک نرم افزار SPSS ویرایش 22 مورد تجزیه و تحلیل آماری قرار گرفتند. آنالیز آماری داده‏ها از آزمون T استفاده شد و 05/0p< به‏عنوان سطح معنی‏داری مورد استفاده قرار گرفت.

 

نتایج

بررسی ریخت‏شناسی اثر نانو ذرات اکسید روی با کمک میکروسکوپ در رده سلولی سرطانی پستان MCF-7 مورد بررسی قرار گرفت. بررسی ریخت شناسی حاصل از اثر نانو ذرات بر روی رده‏ی سلولی  MCF-7نشان داد که تعداد و اندازه سلول‏های تحت تیمار در مقایسه با گروه کنترل کاهش یافته است، که نشان دهنده اثرات توکسیک نانو ذرات بود. در شکل 2 نشان داده شده که با اثر نانو ذرات، علاوه‏ بر کاهش تعداد سلول‏ها، تغییراتی مانند کاهش سیتوپلاسم سلولی نیز مشاهده می‏شود.

 

الف)

  ب)

 

شکل 2: بررسی ریخت شناسی اعمال اثر سمیت نانو ذرات اکسید روی با کمک میکروسکوپ: سلول‏های رده‏ی سرطان پستان MCF-7 قبل از تیمار (الف) و  بعد از تیمار 24 ساعت با نانو ذرات اکسید روی(ب).

 

 

 

به‏منظور بررسی اثر سمیت نانو ذرات اکسید روی ابتدا سلول‏ها کشت داده شدند و با غلظت‏های مختلف از نانو ذرات تیمار شدند. بعد ازگذشت 24 ساعت میزان زنده‏مانی سلول‏ها با کمک آزمون MTT مورد ارزیابی قرار گرفت.

طبق نمودار1نتایج سمیت به‏دست آمده برای رده سلولی MCF-7 حاکی از آن است که نانو ذرات اکسید روی پس از بازه زمانی24ساعت در غلظت­های 125، 250 و 500 میکروگرم در میلی‏لیتر دارای اثرکاهنده‏ای بر بقای سلولی در رده سلولی MCF-7دارند.

 

 

نمودار 1: درصد زنده مانی سلول­ها در رده سلولی سرطانی پستان MCF-7. نتایج به‏صورت درصد بقا در مقایسه با نمونه‏های کنترل گزارش شده است(*:05/0­p<­، **: 01/0p<، ***: 001/0p<،n=3).

 

به‏طوری‏که غلظت500میکروگرم از نانو ذرات باعث مرگ بیش از 60 درصد از سلول‌هایMCF-7 شد و از لحاظ آماری معنی‏دار بوده است (001/0p<) این درحالی بود که در تمامی غلظت‏های نانو ذرات بر روی رده‏ی سلولی نرمال HEK293نسبت به گروه کنترل اختلاف معنی‏داری نشان نداد (نمودار 2).

 

 

نمودار 2: درصد زنده‏مانی سلول­ها در رده سلولی نرمال HEK293. نتایج به‏صورت درصد بقا در مقایسه با نمونه‏های کنترل گزارش شده است

 

بررسی میزان بقا سلولی با استفاده از روش MTT نشان داد که نانو ذرات اکسید روی رشد سلول‏های MCF-7 را به‏صورت وابسته به دوز کاهش می‏دهد. به‏منظور تایید این‏که آیا قطعات ژنی به‌صورت اختصاصی، بدون آلودگی و دایمر پرایمر تکثیر شده است، از آنالیز منحنی ذوب استفاده شد. طبق نمودار 3 وجود تنها یک پیک برای ژن­­های گلوتاتیون پراکسیداز و گلوتاتیون ردوکتاز در دمای ذوب ویژه آن‌ها، تاییدکننده اختصاصی بودن محصول تکثیر واکنش می‌باشد.

 

 

نمودار 3: منحنی ذوب ژن‏های گلوتاتیون پراکسیداز و گلوتاتیون ردوکتاز . وجود یک نقطه حداکثری که عدم اتصال پرایمر دایمر و خلوص بالای واکنش‌ها را تایید می‏کند. الگوی منحنی ذوب ژن گلوتاتیون پراکسیداز (نمودار راست) در دمای 5/82 درجه سانتی‏گراد نشان می‏دهد. همچنین الگوی منحنی ذوب ژن گلوتاتیون ردوکتاز (نمودار چپ) در دمای 4/82 درجه سانتی‏گراد نشان می‏دهد. محور افقی دما و محور عمودی مشتق سیگنال فلئورسانت را نشان می‏دهد.

 

 

تغییر در بیان ژن‏های گلوتاتیون پراکسیداز و گلوتاتیون ردوکتاز در سلول‏های MCF-7 تیمار شده با نانو ذرات اکسید روی با استفاده از روش real time PCR بعد از 24 ساعت مورد ارزیابی قرار گرفت. بدین ترتیب نسبت بیان ژن‏های گلوتاتیون پراکسیداز و گلوتاتیون ردوکتاز به ژن کنترل داخلی در رده سلولی به‏ترتیب به‏میزان 07/0±13/2(001/0p<) و 05/0±22/1(05/0p<) برابر افزایش یافت که نشان دهنده تاثیر مثبت نانو ذرات در افزایش بیان ژن‏ها می‏باشد.

 

(الف)

 

 

(ب)

 

نمودار4: میزان بیان ژن‏های گلوتاتیون پراکسیداز (الف) و گلوتاتیون ردوکتاز (ب) نسبت به گروه کنترل.

 

بحث

امروزه، شیمی درمانی یکی از بیش‏ترین روش‏های درمان است که برای جلوگیری از پیشرفت سرطان‏ها مورد استفاده قرار گرفته است، که دارای اثرات جانبی تهدید کننده برای بیمار بوده و از طرفی منجر به مقاومت دارویی، شکست درمان و اثر بخشی کم بر گسترش سلول‏های سرطانی مقاوم به دارو می‏شود (10). از طرفی، اثرات ضدسرطانی ترکیبات نانو ذرات اکسید روی در سال های اخیر به‏دلیل اثرات آن در درمان مشخص شده است.

نتایج حاصل از آزمون MTT سلول‏های رده‏ی  MCF-7این تحقیق نشان داد که نانو ذرات اکسید روی علیه این سلول‏ها سمی و کشنده بوده و هر چقدر که غلظت این ترکیب بیشتر می‏شود، میزان بقای سلول‏ها کاهش می‏یابد. در مقابل این ترکیب برای سلول‏های نرمال، سمی و کشنده نیست. این تفاوت سمیت در سلول‏های سرطانی و نرمال نشان دهنده‏ی تفاوت نفوذ نانواکسید روی توسط این سلول‏هاست. این موضوع در تحقیقات مشابه مورد اشاره و حتی اثبات شده است. برای مثال می‏توان به تحقیق پاتل و همکاران (11)اشاره نمود. آن‏ها میزان برداشت نانو ذرات اکسید روی توسط سلول‏ها و نیز در مراحل مختلف چرخه سلولی بررسی کردند و دریافتند برداشت یون‏های نانو ذرات اکسید روی توسط سلول‏های سرطانی به‏طور چشمگیری بیشتر از سلول‏های نرمال است.

طی تحقیقی که اختر و همکاران (6) انجام دادند مشخص شد که نانو ذرات اکسید روی باعث القای آپوپتوزیس در سلول‏های سرطانی کبد انسانی HepG2 می‏شود. آن‏ها نشان دادند اثر نانو ذرات اکسید روی بر روی افزایش بیان ژن‏های P53 و bax می‏شود. همچنین نشان دادند که ROS منجر به این تاثیرات می‏شود.

هاو و همکاران (12)بر روی اثرات تیمار سلول‏های ماهی کپور با نانو ذرات اکسید روی انجام دادند و نشان دادند بیان ژن‏ها و فعالیت آنزیم‏های آنتی اکسیدانتی نظیر سوپراکسید دیسموتاز و گلوتاتیون پراکسیداز با افزایش غلظت نانو ذرات افزایش می‏یابد. این تاثیرات متعاقب تولید ROS بوده که در غلظت‏های بالا می‏تواند باعث آپوپتوزیس و مرگ سلول شوند. همچنین شارما و همکاران (7) عنوان کردند که نانو ذرات روی باعث تولید ROSو بالا رفتن نسبت Bax به Bcl-2 و افزایش آپوپتوزیس می‏شود.

پژوهش‏های مختلفی در رابطه با ارزیابی خواص آنتی اکسیدانتی نانو ذرات فلزی ارائه شده است. در پژوهشی که توسط دانتهال و همکاران (13)انجام گرفت، فعالیت آنتی اکسیدانتی نانو ذرات نقره سنتز شده با روش زیستی از طریق تست DPPH و ABTS مورد ارزیابی قرار گرفته و نشان دادند که در غلظت‏های 12/7 و 17/16 میکروگرم بر میلی لیتر قادر به مهار 50 درصد از رادیکال‏های آزاد شدند.

خاصیت آنتی اکسیدانتی نانو ذرات اکسید روی سنتز شده با روش زیستی با کمک ارزیابی جذب رادیکال‏های DPPH و آنیون سوپراکسید که در غلظت 200 میکروگرم بر میلی‏لیتر دارای مهار 50 درصدی رادیکال‏های آزاد بود (14).

تحقیقی توسط موتورامان و همکارن (15) برروی اثرات ضدسرطانی نانو ذرات روی سنتز شده با روش شیمیایی پیرولیز بود. آن‏ها نشان دادند نانو ذرات اکسید روی منجر به افزایش ROS، پراکسیداسیون لیپیدها،  کاهش گلوتاتیون، بیان ژن‏های آنزیم‏های آنتی اکسیدانتی و همچنین فعالیت آنزیم‏های آن در سلول‏ها می‏شود. 

همچنین طی تحقیقی که توسط پاندورانگان و همکاران (16) پیرامون اثرات نانو ذرات اکسید روی بر روی فعالیت آنزیمهای آنتی اکسیدانتی و بیان mRNAها در سلول‏های C2C12 و3T3-L1 انجام گرفت و مشخص شد که تیمار این سلول‏ها با نانواکسید روی باعث کاهش سطح گلوتاتیون، افزایش ROS، پراکسیداسیون لیپیدها و مرگ تقریبا تمامی سلول‏ها می‏شود.

مطالعات نشان داده است که تیمار نانواکسید روی باعث ایجاد ROS می‏شود و این ROSها هستند که با تخریب DNA و سایر ترکیبات حیاتی سلول باعث القا آپوپتوز در سلول می‏شد. ROSهای حاصل از اثرات نانو اکسید روی با کاهش پتانسیل بار غشا اندامک میتوکندری و افزایش نسبت Bax به Bcl-2 فرایند مرگ سلولی را تشدید می‏کنند. تولید گونه‏های فعال اکسیژن با روش‏های مختلفی از جمله فعال‏سازی آبشار کاسپازی و اسفنگومیلیناز باعث خروج سیتوکروم C از غشا داخلی میتوکندری و فعال‏سازی مسیر داخلی آپوپتوزیس می‏شوند (17).

در پژوهش حاضر، اثرات سمیت غلظت‏های مختلف نانو ذرات اکسید روی بر علیه رده سلولی سرطان پستان MCF-7 و سلول نرمال HEK293 مورد ارزیابی قرار گرفت. نتایج بررسی زنده ماندن رده سلولی نشان داد که پس از 24 ساعت تیمار نانو ذرات اکسید روی باعث کاهش معنی‏دار زنده مانی سلول‏های سرطانی تحت تاثیر نانو ذرات شدند. در حالی‏که در سلول‏های نرمال تیمار شده با غلظت‏های مختلف نانو ذرات، اختلاف معنی‏داری مشاهده نشد.

مطابق بیشتر پژوهش‏ها، نانو ذرات اکسید فلزی در درمان سرطان مورد استفاده قرار گرفته شده است. نتایج این یافته نیز توانست همین عمل را نشان دهد. در این پژوهش علاوه بر سمیت نانو ذرات اکسید روی، ارزیابی بیان ژن‏های گلوتاتیون پراکسیداز و گلوتاتیون ردوکتاز در رده­ی سلولی  MCF-7انجام گرفت که به طور معنی داری افزایش نشان داد. فعالیت سیستم گلوتاتیون با افزایش میزان ROS افزایش می‏یابد تا با حذف آن‏ها از آسیب بیشتر به سلول‏ها جلوگیری کند. بنابراین، افزایش فعالیت سیستم گلوتاتیون وابسته به افزایش فعالیت آنزیم‏های گلوتاتیون پراکسیداز و گلوتاتیون ردوکتاز به‏عنوان مارکری برای افزایش تولید  ROSمی‏تواند مورد توجه قرار گیرد.

 

نتیجه­گیری

در این پژوهش اثرات ضدتوموری نانو ذرات اکسید روی در افزایش بیان ژن‏های گلوتاتیون پراکسیداز و گلوتاتیون ردوکتازدر رده سلولی سرطانی پستانMCF-7 نشان داده شد. این افزایش به‏عنوان مارکری برای افزایش تولید ROSو متعاقب آن آپوپتوزیس می‏باشد. بنابراین،رویکرد بالقوه دارویی نانو ذرات نیازمند توجه بیشتر در تحقیقات مدل‏های حیوانی و داروسازی می‏باشد که می‏تواند جهت کمک درمانی در زمینه‏های مختلف درمانی از جمله سرطان باشد.

 

تشکر وقدردانی

این مقاله حاصل پایان‏نامه نویسنده اول است. بدین وسیله از دانشگاه آزاد اسلامی واحد تهران مرکزی وتمامی افرادی که در انجام این پروژه همکاری داشته‏اند، قدردانی می‏شد.

 

 

 

1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, et al. Global cancerstatistics 2018:GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in185 countries. CA Cancer J Clin. 2018; 68(6): 394-424.
2. Mitra S, Dash R. Natural Products for the Management and Prevention of Breast Cancer. Evidence-Based Complementary and Alternative Medicine 2018: 8324696.
3.Singh R, Lillard JW. Nanoparticle-based targeted drug delivery. Exp Mol Pathol. 2009; 86(3): 215–23.
4.Levenson AS, Jordan VC. MCF-7: the first hormone-responsive breast cancer cell line. Cancer Res. 1997; 57(15): 3071-8.
5.Djurišić AB, Leung YH, Ng A, Xu XY, et al. Toxicity of metal oxide nanoparticles: mechanisms, characterization, and avoiding experimental artefacts. Small. 2015;11(1): 26-44.
6. Akhtar MJ, Ahamed M, Kumar S, Majeed Khan MA, et al. Zinc oxide nanoparticles selectively induce apoptosis in human cancer cells through reactive oxygen species. Int J Nanomed. 2012; 7: 845-857.
7. Sharma V, Anderson D, Dhawan A. Zinc oxide nanoparticles induce oxidative DNA damage and ROS-triggered mitochondria mediated apoptosis in human liver cells (HepG2). Apoptosis 2012; 17(8): 852-870.
8. Nelson DL, Michael M Cox. Lehninger principles of biochemistry, 2020, Macmillan. ISBN-13: 978-1429234146.
9. Ghanbar F, Mirzaie A, Ashrafi F, Noorbazargan H, et al.Antioxidant, antibacterial and anticancer properties of phyto-synthesised Artemisia quttensis Podlech extract mediated AgNPs. IET Nanobiotechnol. 2017; 11(4): 485-492.
10. Shiovitz S, Korde L. Genetics of breast cancer: a topic in evolution. Ann Oncol. 2015; 26(7): 1291-9.
11. Patel PKansara KSenapati VAShanker R, et al. Cell cycle dependent cellular uptake of zinc oxide nanoparticles in human epidermal cells. Mutagenesis. 2016;31(4):481-90.
12. Hao L, Chen L. Oxidative stress responses in different organs of carp (Cyprinus carpio) with exposure to ZnO nanoparticles. Ecotoxicol Environ Saf. 2012; 80: 103-110.
13. Dauthal P, Mukhopadhyay M. In-vitro free radical scavenging activity of biosynthesized gold and silver nanoparticles using Prunus armeniaca (apricot) fruit extract. J Nanopart Res. 2013;15(1):1366.
14.Singh BN, Rawat AK, Khan W, Naqvi AH, et al. Biosynthesis of stable antioxidant ZnO nanoparticles by Pseudomonas aeruginosa rhamnolipids. PLoS One. 2014;9(9):e106937.
15. Muthuraman PK, Ramkumar, Kim DH. Analysis of dose-dependent effect of zinc oxide nanoparticles on the oxidative stress and antioxidant enzyme activity in adipocytes. Appl biochem biotechnol. 2014; 174(8): 2851-2863.
16. Pandurangan M, Veerappan M, Kim DH.Cytotoxicity of zinc oxide nanoparticles on antioxidant enzyme activities and mRNA expression in the cocultured C2C12 and 3T3-L1 cells.ApplBiochemBiotechnol. 2015; 175(3): 1270-1280.
17.Trachootham DJ, Alexandre J, Huang P. Targeting cancer cells by ROS-mediated mechanisms: a radical therapeutic approach? Nature reviews Drug discovery 2009;8(7): 579-91.