طراحی و ساخت ناقل نوترکیب CRISPR حاوی ژن LRRK2 بیماری پارکینسون

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشگاه شهید باهنر کرمان، دانشکده علوم پایه، گروه زیست شناسی، کرمان، ایران

2 دانشجوی Ph.D، گروه ژنتیک، دانشکده علوم زیستی، دانشگاه تربیت مدرس، تهران، ایران

چکیده

هدف: هدف از این مطالعه تخریب ژن کیناز غنی از لوسین شماره 2 LRRK2))، مهم‌ترین ژن درگیر در بیماری پارکینسون با استفاده از تکنولوژی CRISPR-Cas بود.
مواد و روش‏ها: مراحل همسانه سازی قطعات راهنما در این پژوهش با استفاده از کیت کلونینگ  gRNAسیستم کریسپر (شماره کاتالوگ C8324K شرکت زاور زیست آزما) انجام شد. ابتدا 4 الیگونوکلئوتید برای توالی اگزون 41 ژن LRRK2 توسط نرم افزارساختRNA  راهنمای CRISPR با عنوان  CHOCHOPطراحی شدند. این دو  RNA) gRNAsراهنما) در دو طرف اگزون فوق در نظر گرفته شدند. مولکول‌های دو رشته‏ای DNA بر اساس دستورالعمل استاندارد در آزمایشگاه ساخته شدند. قطعات دو رشته ای 20 جفت بازی راهنما که برای تشکیل کمپلکس Cas9-gRNA استفاده می‌شوند، با استفاده از آنزیم DNA لیگاز به وکتور بیانی یوکاریوتی کریسپر Px459 متصل و پلاسمیدهای نوترکیب به درون باکتری E.Coli DH5aمیزبان با روش شوک حرارتی منتقل شدند. نتایج آزمایشها به‏وسیله روش‏های RCP و تعیین ردیف AND ارزیابی شدند.
نتایج: آزمایشهای چندگانه PCR با استفاده از پلاسمیدهای نوترکیب به‏عنوان AND الگو و توالی‏یابی AND، همسانه سازی قطعه‏های کوچک راهنما در پلاسمید بیانی کریسپر را نشان داد.
نتیجه‏گیری: نتایج حاصل از این مطالعه نشان داد، سیستم CRISPR می‌تواند به‏عنوان یک ابزار قوی فراگیر برای ویرایش و تنظیم بسیاری از ژن‏‌های موثر در بیماری‏ها از جمله بیماری پارکینسون استفاده شود.

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

برخی باکتری‌ها دارای سیستم ایمنی اکتسابی شامل تکرارهای پالیندرومی فاصله‏دار منظم خوش‏هایClustered Regularly Interspaced Short Palindromic Repeats(CRISPR) همراه با ژن پروتئینیCas  می‌باشند. این سیستم مقاومت اکتسابی در برابر هجوم عوامل بیگانه شامل باکتریوفاژ یا هر  DNAخارجی وارد شده را ایجاد می‌کند (1،2،3). CRISPR شامل توالی‏های تکراری محافظت شده در ژنوم می‏باشدکه توسط قطعات DNA متغییر منحصربه‏فرد تحت عنوان فاصله‏انداز (Spacer) که از DNA عامل بیگانه منشا می‏گیرند، از هم جدا شده‏اند. ایمنی در برابر حملات بعدی عوامل بیگانه‏ای که ردیف‌های نوکلئوتیدی یکسان با قطعات ادغام شدهSpacer  مربوط به ژنوم آن‏راحمل می‏کند، ایجاد می‌شود (4،5،6،7) .تا به امروز سه نوع سیستم CRISPR باکتریایی شناسایی شده است. سیستم کریسپر نوع I برای برش از ریبونوکلئوپروتئین‏های Cas1،Cas6  و Cas5 به‏همراه پروتئین‏های متعدد کمکی دیگری استفاده می‏کند. همچنین قادر به برش فقط یک رشته DNA هدف می‏باشد. سیستم کریسپر نوع III نیز برای فعالیت به پروتئین‏های زیادی از جمله Cas2، Cas6 و پروتئین‏های دیگری نیاز دارد. به‏علاوه این نوع سیستم کریسپر فقط DNA تک رشته‏ای و در مواردی RNA را برش می‏دهد. در مقابل سیستم کریسپر نوع II برای فعالیت به پروتئین‏های کمتری از جمله Cas9 نیاز داشته و قادر به برش DNA دورشته‏ای می‏باشد (4،8،10). سیستم CRISPR یک تکنولوژی قدرتمند و یرایش ژنوم است که انقلابی را در زمینه تحقیقات زیست پزشکی ایجاد کرده است (5،11،13). این سیستم امکان انجام انواع تغییرات در سطح ژنوم شامل اصلاح، روشن و خاموش کردن ژن‏ها را بادقت، سرعت، ارزان و نسبتا ساده را به‏وجود آورده است.با استفاده از این تکنولوژی ایجاد انواع مدل‏های سلولی، حیوانی و همچنین بررسی سیستماتیک ژنوم فراهم شده است (14،19).

بیماری پارکینسون (PD) یک اختلال عصبی-حرکتی پیشرونده شایع می‏باشد. این بیماری به‏دلیل انحطاط نورون‏های دوپامینرژیک منجر به کاهش سطح انتقال دهنده عصبی دوپامین می‏شود. از ویژگی‏های اصلی کلینیکی این بیماری می‏توان لرزش اعضای بدن از جمله دست و پا در حالت استراحت، کندی حرکات، بی‏ثباتی در راه رفتن و سفتی عضلات را نام برد (20،23). میزان بروز این اختلال مزمن عصبی با بالارفتن سن، افزایش می‌یابد شیوع این بیماری یک درصد در جمعیت بالای 65 سال و4 درصد در جمعیت بالای 85 سال است. PD یک اختلال پیچیده است که احتمالا ناشی از تعاملات بین عوامل خطر محیطی و ژنتیکی است (24،26). با بررسی‌های مولکولی انجام گرفته چندین ژن دخیل در بروز PD شناسایی شده‏اند. ژن‌هایATP13A2 ، PARKIN، PINK1، DJ-1، SNCA و LRRK2 ازجمله مهم‏ترین این ژن‏ها هستند (22).

ژن LRRK2 ژن بزرگی است که برروی کروموزوم شماره 15 موش قرار گرفته است. شامل 51 اگزون و طولی به اندازه‏ی 7584 نوکلئوتید دارد .این ژن پروتئینی را شامل 2527 آمینواسید همراه با دومین‌های عملکردی متعدد کد‌گذاری می‌کند (27،28). در بیماران پارکینسونی حاصل از جهش در این ژن معمولا میزان بیان آن بالا می‌رود. LRRK2 یک پروتئین سیتوزولی است که در رشد نورونی، فرایندهای سلولی پیچیده در نورون‌ها و همچنین به‏علت داشتن تعداد زیادی دومین‌ به‏عنوان مرکز مسیرهای متعدد سیگنالینگ که برای عملکرد نورون‌ها حیاتی است، دخیل می‌باشد. این ژن در مغز و دیگر اندام‏ها بیان می‏شود. ‌بیان آن عمدتا در مناطق گره‌های قاعده‌ای که با اختلالات حرکتی در بیماری پارکینسون ارتباط دارد و همچنین در داخل نواحی غیرحرکتی مثل هیپوکامپ صورت می‏گیرد. در بیماری پارکینسون حاصل از جهش در ژن LRRK2، تجمع نوروفیبریلاری، آسیب به سلول‌های شاخه‌ای قدامی و تخریب مسیرهای عصبی در بخش جسم سیاه مغز رخ می‌دهد (29،32).

با استفاده از سیستم CRISPR ژن LRRK2 در رده سلولی انسانی دچار جهش کسب عملکرد شد. در مقایسه با نمونه‏های کنترل اثرات مخرب سلول‏های ترانسفورم شده بر فرایند سیستم عصبی مشاهده شد. این امر نقش مهم ژن فوق را در مکانیزم بیماری پارکینسون نشان داد. همچنین اهمیت سیستم ویرایشی کریسپر را در ایجاد مدل‏های سلولی و حیوانی به‏منظور کاربردهای احتمالی درمانی مشخص کرد (33،34). تعداد 28 لکوس ژنی به‏عنوان فاکتورهای اصلی درگیر در بیماری پارکینسون دخالت دارند. از میان این ردیف‏های ژنی، موتاسیون‏های ویژه ژن LRRK2 به‏عنوان اصلی‏ترین عوامل ایجاد بیماری فوق شناخته شده اند. با توجه به پیچیدگی مکانیزم ایجاد بیماری پارکینسون، دخالت ژن‏های متعدد و الگوهای متفاوت وراثت غالب و مغلوبی ژن‏های فوق، سیستم ویرایشی کریسپر برای غربالگری، تشخیص و استفاده‏های احتمالی دارویی برای این بیماری و سایر بیماری‏های مشابه تحلیل برنده سیستم عصبی پیشنهاد شده است (35،38). در پژوهش حاضر هدف ساخت ناقل نوترکیب CRISPR ویژه ژنLRRK2  با طراحی gRNA برای ناحیه‌ای از اگزون 41 ژن فوق و کلونینگ آن در باکتریE.coli DH5α  می‌باشد.

 

مواد و روش‌ها

سویه باکتری، طراحی پیش سازهای قطعه راهنما، پرایمرها و پلاسمید: درمطالعه حاضر، از سویه اشرشیاکلی DH5α از بخش زیست‏شناسی دانشگاه شهید باهنرکرمان به‏عنوان میزبان بیانی کلونینگ و همچنین از پلاسمید  pSpCas9(BB)-2A-Puro (Add gene) به عنوان ناقل کلونینگ و بیان ژن LRRK2 استفاده شدند. برای طراحی پیش‏سازهای gRNAها، ناحیه‏ای از اگزون 41 ژن LRRK2 از ژنوم موش سویه CL57BL6 استفاده شد. در ابتدا به‏منظور یافتن توالی اگزون 41 از سایت‏های ENSEMBL و NCBI انتخاب شد. پس از بارگذاری توالی ژن مورد نظر به‏منظور تایید صحیح بودن ردیف بازی توالی، از سایت CLUSTALW2 برای بررسی هم‏ردیفی استفاده شد. سپس با استفاده از نرم‏افزارCHOPCHOP  طراحی پیش‏سازهاgRNA ها انجام شد. این سایت تعدادی gRNA را معرفی می‏نماید که از این بین، بایستی gRNA مناسبی که دارای ویژگی‌هایی همچون بالابودن Score و کم بودن تعدادOff target  را انتخاب نمود. gRNAهای انتخاب شده دارایScore   برابر با96 بودند. توالی پرایمرهای پیش‏ساز gRNA درجدول1 نشان داده شده است. به‏منظور تایید همسانه سازی قطعه DNA با اندازه 20 جفت بازی مربوط به  gRNAدر ناقل و تکثیر آن در باکتری میزبان واکنش PCR انجام شد. علاوه بر الیگونوکلئوتیدهای مکمل رفت و برگشت gRNA، آغازگرهای لازم برای تکثیر یک قطعه حدود 400 جفت بازی در دو طرف DNA مربوط به gRNA برروی پلاسمید نیز با عناوین PPF و PPR طراحی شدند. از ترکیب متفاوت آغازگرهای قطعه فوق و پرایمرهای راهنما در واکنش PCR در صورت تکثیر قطعات سه‏گانه با اندازه‏های مورد انتظار (400، 150 و 270 جفت بازی) همسانه سازی اثبات می‏شود (جدول 1).

 

جدول 1: الیگونوکلئوتیدهای لازم برای پیش سازgRNA و تکثیر قطعات پلاسمید نوترکیب طراحی شده برای دست ورزی در ژن LRRK2

Amplicon size (dsDNA)

Score

(5' →3')

نام

20 bps, guide fragment

96

GTTGCGAAGATTGCGGACTA

TAGTCCGCAATCTTCGCAAC

gRNAF

gRNAR

~ 400 bps

 

GGGCCTATTTCCCATGATTCCT

CGCGCTAAAAACGGACTAGC

PPF

PPR

~150 bps

 

GTTGCGAAGATTGCGGACTA CGCGCTAAAAACGGACTAGC

gRNAF

PPR

~270 bps

 

GGGCCTATTTCCCATGATTCCT

TAGTCCGCAATCTTCGCAAC

PPF

gRNAR

طراحی پرایمرهای مربوط به پلاسمید با استفاده از نرم افزار Primer 3 صورت گرفت. اختصاصیت پرایمرهای طراحی شده با نرم افزار BLAST در پایگاه NCBIتاییدشد. توالی پرایمرهای پلاسمید در جدول 1 نشان داده شده است.

آنیلینگ یا اتصال پرایمرهای پیش‏ساز gRNA:فرایند ساخت ناقل نوترکیب کریسپر در این مطالعه با استفاده از کیت کلونینگgRNA  سیستم کریسپر شرکت زاور زیست آزما (شماره کاتالوگ C8324K، شماره ثبت اختراع 98785) انجام شد. به‏طور خلاصه، مقدار 3 میکرولیتر پرایمر رفت با غلظت 100 میکرومولار، 3 میکرولیتر پرایمر برگشت با غلظت 100 میکرومولار مربوط به پیش‏سازهایgRNA ، 4 میکرولیتر نمک  NaClنیم‏مولار، 3 میکرولیتر بافر آنزیم T4 DNA Ligase و 7 میکرولیتر آب را براساس دستورالعمل با حجم نهایی 20 میکرولیتر مخلوط کرده و سپس محلول حاصل را در دستگاه PCR به‏مدت 5 دقیقه در دمای 95 درجه سانتی‏گراد و به‏مدت 2 ثانیه در دمای 92 درجه سانتی‏گراد قرار داده شد. در مرحله بعد به‏منظور سرد شدن تا دمای 25 درجه سانتی‏گرادحرارت دستگاه PCR به‏گونه‏ای تنظیم شد که دما یک درجه یک درجه به فاصله زمانی‏ ایستایی هر درجه سانتی‏گراد به‏مدت20 ثانیه کاهش یافت. در ادامه به‏منظور رقیق‌سازی یک میکرولیتر از نمونه را به 50 میکرولیتر بافر آنزیم T4 DNA Ligase  اضافه و به‏عنوان پیش‏سازهای gRNA استفاده شدند.

هضم آنزیمی پلاسمید  :pSpCas9(BB)-2A-Puro (PX459)به‏منظور خطی کردن پلاسمید حلقوی مقادیر 5 میکرولیتر بافر آنزیم برشگر BBS1، 5 میکرولیتر وکتور حلقوی (غیربرشی) و 1 میکرولیترآنزیم برشگرBBS1 رامخلوط و با استفاده از آب مقطرحجم نمونه‏ها در سطح 50 میکرولیترتنظیم شدند. سپس به‏مدت 90 دقیقه دردمای 37 درجه سانتی‏گراد و بعد از آن به‏مدت 10 دقیقه در دمای 65 درجه سانتی‏گراد قرار داده شدند. در مرحله بعد محصول برش آنزیمی پلاسمید برروی ژل آگارز 1 درصد سیستم الکتروفورز منتقل و توسط کیت Bioneer بر اساس دستور العمل استخراج از ژل قطعه موردنظر خالص‏سازی شد.

اتصال قطعه الیگونوکلئوتید راهنما با پلاسمید pSpCas9(BB)-2A-Puro (PX459)-V2-0 و ساخت DNA نوترکیب:به‏منظور اتصال قطعه راهنما به ناقل مقدار 5/4 میکرولیتر پلاسمید خطی، 5/2 میکرولیتر بافر آنزیم T4 DNA Ligase (لیگاز)، یک میکرولیتر آنزیم  T4 DNA Ligaseو یک میکرولیتر محلول رقیق شده پیش‏ساز gRNA را باهم ترکیب و پس از تنظیم حجم نهایی به‏وسیله آب مقطر تا حجم 20 میکرولیتر نمونه‏ها به‏مدت یک ساعت در دمای 22 درجه سانتی‏گراد و سپس 5 دقیقه در دمای 65 درجه سانتی‏گراد قرار داده شدند.

ترانسفورماسیون:برای انتقال وکتور نوترکیب در سلول‏های باکتری E.coli مستعد، از روش شوک حرارتی استفاده شد. بدین‏ترتیب که پس از مایع شدن میکروتیوپ حاوی 100 میکرولیتر سلول مستعد میزبان (کلرید کلسیم 1/0 مولار) برروی یخ، میزان 7 میکرولیتر از محصول ناقل نوترکیب را به نمونه سلولی در میکروتیوپ افزوده و به‏مدت 30 دقیقه بر روی یخ قرار داده شد. سپس به‏مدت 60 ثانیه میکروتیوپ را در دمای 42 درجه سانتی‏گراد قرار داده و مجددا نمونه‏ها را به‏مدت 1 دقیقه برروی یخ نگهداری شدند. در گام آخرمیزان 008 میکرولیتر محیط کشت مایع BL فاقدآنتی‏بیوتیک را به هر میکروتیوب اضافه و به‏مدت 2 ساعت در دمای 73 درجه سانتی‏گراد در انکوباتور با چرخش 051 دور در دقیقه قرارداده شدند. در ادامه میزان 001 میکرولیتر از محلول باکتری‏های ترانسفورم شده را بر روی محیط کشت جامد حاوی آنتی‏بیوتیک آمپی‏سیلین (غلظت یک میلی‌گرم درمیلی‏لیتر) توزیع و به‏مدت 61 ساعت در انکوباتور در دمای 73 درجه سانتی‏گراد نگهداری شدند. کلنی‏های رشد داده شده در محیط کشت مایع حاوی آنتی‏بیوتیک جهت استخراج پلاسمید و اثبات همسانه سازی مورد استفاده قرار گرفتند.

واکنش PCR و تعیین ردیف DNA:به‏منظورتایید همسانه ‏سازی و غربالگری باکتری‏های نوترکیب از روش PCR استفاده شد. واکنش PCR در حجم نهایی 50 میکرولیتر حاوی 5 میکرولیتر از بافر 10X، 1.5 میکرولیتر MgCl2 (50 میلی‏مولار)، یک میکرولیتر از dNTPs (10 میلی‏مولار)، یک میکرولیتر از هر پرایمر (100 میکرومولار)، یک میکرولیتر از آنزیمTaq DNA polymerase، 2 میکرولیتر از DNA الگو و 5/37 میکرولیتر آب انجام شد. برنامه PCR شامل 5 دقیقه جهت دناتوراسیون اولیه در دمای 95 درجه سانتی‏گراد و سپس 33 سیکل شامل یک دقیقه 95 درجه سانتی‏گراد، یک دقیقه 57 درجه سانتی‏گراد، یک دقیقه 72 درجه سانتی‏گراد و نهایتا 5 دقیقه 72 درجه سانتی‏گراد با استفاده از دستگاه ترموسایکلر شرکت Bioneer کره جنوبی انجام شد. نمونه‏های پلاسمیدی نوترکیب به‏همراه آغازگرهای جلوبرنده و برگشت قطعه راهنما به‏منظور تایید همسانه ‏سازی به شرکت تکاپو زیست برای تعیین ردیف DNA ارسال شدند.

 

نتایج

ساخت قطعه راهنمای دو رشته ای و همسانه سازی قطعات راهنما با استفاده از پلاسمید سیستم کریسپر و باکتری های شایسته میزبان E. coli DH5a

شکل 1 نتایج اتصال الیگونوکلئوتیدهای جلو برنده و برگشت جهت ایجاد قطعه راهنمای دو رشته‏ای برای تولید RNA راهنما را نشان می‏دهد. خط شماره 2 حالت تک رشته‏ای و خط شماره 3 حالت جفت شده یا دو رشته‏ای قطعه راهنما را با اندازه کمی سنگین‏تر مشخص می‏کند. M به‏عنوان مارکر استفاده شده است.

 

 

شکل 1: ساخت قطعه راهنمای دورشته‏ای را نشان می دهد. خط :M مارکر، خط 1:  حالت تک رشته‏ای و خط 2: فرم دو رشته‏ای قطعه راهنما را با اندازه کمی سنگین‏تر نشان می‏دهد.

 

در شکل 2 کلنی‏های باکتری ترانسفورم شده نوترکیب و غیرنوترکیب بر روی محیط کشت لوریا - برتانی LB (Luria-Bertani) حاوی آنتی بیوتیک آمپی‏سیلین دیده می‏شوند. تعداد نسبتا زیاد کلنی‏های تک ایجاد شده نشان از دقت و موفقیت مراحل همسانه سازی شامل برش، اتصال، تهیه سلول‏های شایسته میزبان، و انتقال است.DNA  پلاسمیدی از باکتری‏های نوترکیب و غیرنوترکیب با روش لیز قلیایی موجود در آزمایشگاه استخراج شدند. شکل 3 نقشه پلاسمیدهای نوترکیب pSpCas9(BB)-2A-Puro (PX459)-V2-0-LRRK2-gRNA حاوی قطعه راهنما برای ویرایش ژن LRRK2 بیماری پارکینسون را نشان می‏دهد. قطعه راهنما بعد از محل Scaffold وارد شده است تا با استفاده از پروموتور موجود بیان آن صورت گیرد.

 

شکل 2: کلنی‏های نوترکیب و غیرنوترکیب رشد داده شده بر روی محیط کشت جامد حاوی آنتی بیوتیک آمپی‏سیلین را نشان میدهد.

 

 

شکل3: نفشه پلاسمید نوترکیب pSpCas9(BB)-2A-Puro ( PX459)-V2-0-LRRK2-gRNA حاوی بخش راهنمای اضافه شده بعد ازScaffold RNA با عنوان LRRK2-gRNA با رنگ فرمز را نشان می‏دهد. قطعه اضافه شده بیست جفت باز اندازه دارد.

 

نتایج آزمایش های PCR و تعیین ردیف DNA برای تایید همسانه سازی قطعه راهنما

نتایج آزمایشات PCR در شکل 4 نشان داده شده است. با توجه به قطعه بسیار کوچک همسانه سازی شده راهنما، حدود 20 جفت باز، تایید همسانه سازی با روش برش آنزیمی امکان‏پذیر نبود. از مکانیزم‌های تعیین ردیف DNA و PCR چندگانه برای اثبات این امر استفاده شد. آغازگرها به‏صورتی طراحی شدند که پرایمرهای جلوبرنده و برگشت PPF و PPR یک قطعه حدود 400 جفت بازی را در دو طرف قطعه راهنما در پلاسمید تکثیر کنند. همچنین پرایمر جلوبرنده PPF و الیگونوکلئوتید آنتی سنس قطعه راهنما، gRNAR، یک قطعه 270 جفت بازی و بالاخره پرایمر برگشت PPR و الیگونوکلئوتید سنس قطعه راهنما، gRNAF، یک قطعه 150 جفت بازی را در صورت همسانه سازی موفقیت آمیز قطعه راهنما تکثیر کنند. در آزمایشات PCR از پلاسمیدهای استخراج شده احتمالی نوترکیب به‏عنوان DNA الگو استفاده شد. شکل 4 تکثیر قطعات سه‏گانه فوق را که تایید کننده همسانه سازی قطعه راهنما در پلاسمید مورد نظر است، نشان می‏دهد. توضیحات در زیر نویس شکل آورده شده است.

 

 

شکل 4: نتایج آزمایشات PCR به‏منظور تایید همسانه سازی قطعه راهنمای 20 جفت بازی ویژه ژن LRRK2 بیماری پارکینسون در پلاسمید کریسپر. pSpCas9(BB)-2A-Puro (PX459)-V2-0M: مارکر 100 جفت بازی، خط 2: قطعه 270 جفت بازی حاصل تکثیر پرایمر جلوبرنده پلاسمید و الیگونوکلئوتید آنتی سنس راهنما، خط 1: حاصل تکثیر یک بخش 150 جفت بازی با اثر پرایمر برگشت پلاسمید و رشته سنس راهنما. خط 3: قطعه 400 جفت بازی حاصل تکثیر پرایمرهای رفت و برگشت (سنس و آنتی سنس) پلاسمید. تکثیر قطعات سه گانه فوق تایید کننده همسانه سازی موفقیت آمیز است. برای توضیح جزئیات بیشتر به متن و جدول 1 مراجعه شود.

 

شکل 5 نتایج تعیین ردیف DNA قطعه راهنمای همسانه سازی شده در پلاسمید کریسپرpSpCas9(BB)-2A-Puro (PX459)-V2-0 با درجه همخوانی تشابه 100 درصد نشان می‏دهد. با توجه به نتایج حاصل، همسانه سازی قطعه راهنمای ژن LRRK2 بیماری پارکینسون در پلاسمید ویرایشی کریسپر در این مطالعه به‏وسیله آزمایشهای PCR و تعیین ردیف DNA اثبات شد (شکل‏های 4 و 5).

 

 

شکل 5: نتایج تعیین ردیف DNA قطعه همسانه سازی شده راهنما مربوط به ژن LRRK2 بیماری پارکینسون در پلاسمید ویرایشیpSpCas9(BB)-2A-Puro (PX459)-V2-0 را نشان می‏دهد. درجه همخوانی تشابه 100 درصد است که نشان دهنده همسانه سازی قطعه فوق است.

بحث

در پژوهش حاضر ابتدا پیش‏سازهای لازم برای قطعه 20 جفت بازی dsDNA تولید کننده gRNA مخصوص ژن  LRRK2 بیماری پارکینسون با استفاده از نرم افزارهای کامپیوتری طراحی شدند. پس از تشکیل قطعه دورشته‏ای راهنما، با استفاده از آنزیم برشگر BBS1 و آنزیم DNA لیگاز ناقل نوترکیب pSpCas9(BB)-2A-PuroPX459)-LRRK2) ساخته شد. عمل ترانسفورماسیون با کمک روش شوک حرارتی انجام و همسانه سازی قطعه راهنما در سلول‏های باکتری  E. coli DH5a میزبان با موفقیت انجام شد. همسانه سازی با استفاده از روش PCR و تعیین ردیف DNA اثبات شد.

ژن LRRK2 یکی از شایع‌ترین ژن‌های درگیر در بیماری پارکینسون می‏باشد. این بیماری یکــی از مهم‏تریــن اختلالات مزمــن سیســتم اعصــاب مرکــزی در انسان است که تاکنون هیچ درمان کاملی برای این بیماری پیدا نشده است (26). بیان بیش از حد یا زیاد این پروتئین آثار تخریبی نرون‏ها را در مگس سرکه آشکار کرده است (37). خاموش کردن این ژن ممکن است در بهبود بیماری مغزی-عصبی پارکینسون مفید واقع شود (38). جهش‏های ژنتیکی بر روی ژن LRRK2 با استفاده از روش‏های ZFN، TALEN، CRISPR و حتی پیش بینی‏های بیوانفورماتیکی صورت گرفته است (39،40،41،42،43،44). این بررسی‏ها برروی برخی ژن‏های دیگر بیماری پارکینسون و سایر بیماری‏های تحلیل برنده عصبی نیز انجام شده است. مثلا با ایجاد جهش در ژن LRRK2 عملکرد و مسیر این ژن در بیماری پارکینسون مشخص شد (33،47). همچنین نتایج حاصل از عمل سیستم ZFN، برخی اثرات ضد جهشی بر روی ژن‏های میتوکندری را نشان داد. جهش در ژنوم میتوکندری نیز ازجمله عوامل بیماری پارکینسون است (41، 48). استفاده از روشی راحت، مقرون به‏صرفه، سریع و اختصاصی همچون CRISPR جهت ایجاد تغییر ژنتیکی در ژن LRRK2 به‏عنوان یک گزینه داروی زیستی یا بیوتکنولوژی با هدف ژن‏درمانی بیماری پارکینسون و موارد مشابه می‏تواند مد نظر قرار گیرد.

تغییر ژنتیکی مواد ژنومی مبتنی بر سیستم ویرایش ژنی CRISPR با توجه به فاکتورهایی همچون هزینه پایین، دقت زیاد، کارآیی مطلوب و سرعت بالا تاکنون موفقیت‌های زیادی حاصل کرده ‌است (49، 50). از سیستم ویرایشی فوق جهت تخریب یا تغییر ژنهای درگیر در بیماری‏های گوناگون ازجمله انواع سرطان‏های مختلف مانند سرطان ریه و همچنین بیماری‏های سیستم عصبی مانند دیستروفی عضلانی، بیماری اسکلروز جانبی آمیوتروفیک استفاده شده است (43،44،49،50). در مقایسه سیستم‏های ویرایش ژنی همچون ZFN، TALEN و CRISPR، اگرچه نحوه عمل همه‏ی این سیستم‏ها یکسان است و با راه‏اندازی مکانیسم‏های ترمیم موجب ایجاد جهش در ژنوم می‏شوند، ولی سیستم CRISPR دارای مزایای بیشتری است. ازلحاظ حساسیت به متیله بودن DNA، سیستم کریسپر به‌ این تغییر در ژنوم حساس نیست و توانایی برش DNA متیله و غیرمتیله را دارد. در مقابل TALEN و ZNF به‏شدت به ‌این تغییر حساس هستند و توانایی برش جایگاه متیله را ندارند. علاوه‏براین، برای طراحی جایگاه‏های برش متفاوت، در سیستم کریسپر فقط یک قطعه‌ی 20 نوکلوتیدی را می‏توان تغییر داد، درصورتی‏که‌ این تغییر برای ZNF و TALEN در سطح پروتئین با تغییر اسید آمینه‌های دخیل در جایگاه تشخیصی سیستم امکان‏پذیر است. این فرایند زمان‏بر، همراه با هزینه بیشتر و پیچیده‏تر است (51،52). در مقایسه جهش‏زایی سیستم‏های ZFN، TALEN و CRISPR در ژن بتاکازئین گوساله و بز، میزان کارایی سیستم ZFN حدود 7 درصد، سیستم TALEN حدود 25 درصد و برای سیستم CRISPR حدود 75 درصد مشخص شد (53). مزیت و کارایی قدرت ترمیم روش CRISPR نسبت به دو روش دیگر با اثر بر روی ژن بتاگلوبین انسانی نیز مشاهده شد (54). بهره‏وری بیشتر سیستم CRISPR حتی نسبت به روش‏های ویرایش ژنی همچون microRNA و iRNAها به‏دلیل کارایی بالا، سادگی و کاربردهای چندگانه کلینیکی مورد تایید قرار گرفته است (55). استفاده از روش CRISPR-Cas9 که در این مطالعه به‏طور کاملا دقیق منجر به ایجاد ناقل نوترکیب ژن LRRK2 دخیل در بیماری پارکینسون شد، می‌تواند روزنه امیدی برای درک هرچه بهتر مکانیسم‌های دخیل در ایجاد بیماری، تولید حیوانات مدل و درمان احتمالی بیماری‏های مهمی از جمله پارکینسون باشد.

 

نتیجه­گیری

با توجه به مزایای بسیار سودمند و کاربردی روش CRISPR در ویرایش ژنوم (Gene Targeting)، ساخت ناقل نوترکیب کریسپیر ویژه ژن LRRK2  درگیر در بیماری عصبی پارکینسون که در این تحقیق انجام گرفت، می تواند در صورت توسعه و تکامل بهعنوان یک گزینه مهم در امر ژن درمانی مورد توجه قرار گیرد.

 

تشکر و قدردانی

نتایج مطالعه اخیر برگرفته از بخشی از پایان نامه کارشناسی ارشد رشته ژنتیک خانم آزاده ثمره غلامی از دانشگاه شهید با هنر کرمان می باشد. بدینوسیله از معاونت محترم پژوهشی و فناوری دانشگاه متبوع قدردانی می گردد.

 

 

 

 

1. Barrangou R, Fremaux C, Deveau H, Richards M, et al. CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes. Science. 2017; 315(5819): 1709-1712.

2. Mojica FJ, García-Martínez J, Soria E. Intervening Sequences of Regularly Spaced Prokaryotic Repeats Derive from Foreign Genetic Elements. J Mol Evol. 2005;60(2): 174-182.

3. Brouns SJ, Jore MM, Lundgren M, Westra ER, et al. Small CRISPR RNAs Guide Antiviral Defense in Prokaryotes. Science. 2008; 321(5891): 960-964.

4. Makarova KS, Haft DH, Barrangou R, Brouns SJ, et al. Evolution and Classification of the CRISPR–Cas Systems. Nat Rev Microbiol. 2011; 9(6): 467-77.

5. Horvath P, Barrangou R. CRISPR/Cas, the Immune System of Bacteria and Archaea. Science. 2010; 327(5962):167-170.

6. Westra ER, Swarts DC, Staals RHJ, Jore MM, et al. The CRISPRs, They Are A-changing’: How Prokaryotes Generate Adaptive Immunity. Annu Rev Genet. 2012; 46: 311-339.

7. van der Oost J, Jore MM, Westra ER, Lundgren M, et al.  CRISPR-Based Adaptive and Heritable Immunity in Prokaryotes. Trends Biochem Sci. 2009; 34(8): 401-407.

8. Babu M, Beloglazova N, Flick R, Graham C, et al.  A Dual Function of the CRISPR-Cas System in Bacterial Antivirus Immunity and DNA Repair. Mol Microbiol. 2011; 79(2): 484-502.

9. Yosef I, Goren MG, Qimron U. Proteins and DNA Elements Essential for the CRISPR Adaptation Process in Escherichiacoli. Nucleic Acids Res. 2012; 12: 5569-5576.

10. Datsenko KA, Pougach K, Tikhonov A, Wanner BL, et al. Molecular Memory of Prior Infections Activates the CRISPR/Cas Adaptive Bacterial Immunity System. Nat Commun. 2012; 3: 945.

11. Carte J, Pfister NT, Compton MM, Terns RM, et al. MP. Binding and Cleavage of CRISPR RNA by Cas6. RNA. 2010; 16(11): 2181-2188.

12. Djordjevic M, Djordjevic M, Severinov K. CRISPR Transcript Processing: A Mechanism for Generating a Large Number of Small Interfering RNAs. Biol Direct. 2012; 7(1): 24.

13. Deltcheva E, Chylinski K, Sharma CM, Gonzales K, et al. CRISPR RNA Maturation by Trans-Encoded Small RNA and Host Factor RNase III. Nature. 2011; 741(7340): 602-607.

14. Burmistrz M, Pyrć K. CRISPR-Cas Systems in Prokaryotes. Pol J Microbiol. 2015; 64(3):193-202.

15. Mali P, Esvelt KM, Church GM. Cas9 as a Versatile Tool for Engineering Biology. Nat Methods. 2012; 10(10): 957-963.

16. Redman M, King A, Watson C, King D. What is CRISPR/Cas9. Arch Dis Child Educ Pract Ed. 2016; 101(4): 213-215.

17. Makarova KS, Grishin NV, Shabalina SA, Wolf YI, et al. A Putative RNA-Interference-Based Immune System in Prokaryotes: Computational Analysis of the Predicted Enzymatic Machinery, Functional Analogies with Eukaryotic RNAi, and Hypothetical Mechanisms of Action. Biol Direct. 2006; 1: 7.

18. Garneau JE, Dupuis MÈ, Villion M, Romero DA, et al. The CRISPR/Cas Bacterial Immune System Cleaves Bacteriophage and Plasmid DNA. Nature. 2010; 468(7320): 67-71.

19. Hsu PD, Lander ES, Zhang F. Development and Applications of CRISPR-Cas9 for Genome Engineering. Cell. 2014; 157(6): 1262–1278.

20. Sveinbjornsdottir, S. The clinical symptoms of Parkinson's disease. J neurochem. 2016; 139: 318-324.

21. Kalia LV, Lang AE.Parkinson's disease. Lancet. 2015; 386(9996): 896-912.

22. Bekris LM, Mata IF, Zabetian CP. The Genetics of Parkinson Disease. J Geriatr Psychiatry Neurol. 2010; 23(4): 228-242.

23. Tarazi FI, Sahli ZT, Wolny M, Mousa SA. Emerging Therapies for Parkinson's Disease: From Bench to Bedside. Pharmacol Ther. 2014; 144(2): 123-133.

24. Gasser T. Update on the Genetics of Parkinson's Disease. Mov Disord. 2007; 22(17): 343-350.

25. Launer LJ, Berger K, Breteler MM, Dartigues JF, et al. Prevalence of Parkinson's Disease in Europe: A Collaborative Study of Population-Based Cohorts. Neurologic Diseases in the Elderly Research Group. Neurology. 2000; 54(5): 21-23.

26. Savitt JM, Dawson VL, Dawson TM. Diagnosis and Treatment of Parkinson Disease: Molecules to Medicine. J Clin Investig. 2009; 116(7): 1744-1754.

27. Gasser T. Mendelian forms of Parkinson's Disease. Biochim Biophys Acta Mol Basis Dis. 2009; 1792(7): 587-596.

28. Mastrangelo L. The Genetics of Parkinson Disease. Adv Genet. 2017; 98: 43-62.

29. Collier TJ, Kanaan NM, Kordower JH. Aging as a Primary Risk Factor for Parkinson's Disease: Evidence from Studies of Non-Human Primates. Nat Rev Neurosci. 2011; 12(6): 359-66.

30. Wood-Kaczmar A, Gandhi S, Wood NW. Understanding the Molecular Causes of Parkinson's Disease.Trends Mol Med. 2006; 12(11): 521-528.

31. Lin TK, Liou CW, Chen SD, Chuang YC, et al.  Mitochondrial Dysfunction and Biogenesis in the Pathogenesis of Parkinson’s Disease. Chang Gung Med J. 2009; 32(6): 589-599.

32. Willis AW, Evanoff BA, Lian M, Galarza A, et al. Metal Emissions and Urban Incident Parkinson Disease: A Community Health Study of Medicare Beneficiaries by Using Geographic Information Systems. Am J Epidemiol. 2009; 172(12): 1357-1363.

33. Xiaobing QWalter J, Jarazo J, Arias-Fuenzalida J, et al.CRISPR/Cas9 and piggyBac-mediated footprint-free LRRK2-G2019S knock-in reveals neuronal complexity phenotypes and α-Synuclein modulation in dopaminergic neurons. Stem Cell Res. 2017; 24: 44-50.

34. Yoichi Imaizumi, Okano H. 2014. Modeling human neurological disorders with Induced Pluripotent stem cells. J.of Neurochemis. 2014; 129(3): 388–399.

35. Artyukhova MA, Tyurina YY, Chu CT, Zharikova TM, et al.Interrogating Parkinson's disease associated redox targets: Potential application of CRISPR editing. Free Radical Biol. and Medicine. 2019; 144: 279-292.

36. Nivya KolliLu M, Maiti P,  Rossignol J, et al. Application of the gene editing tool, CRISPR-Cas9, for treating neurodegenerative diseases. Neurochem Int. 2017; 112: 187-196.

37. Liu Z, Wang X, Yu YI, Li X, et al. A Drosophila Model for LRRK2-linked Parkinsonism. Proc Natl Acad Sci India Sect B Biol Sci. 2008; 105(7): 2693-2698.

38. Greggio E, Jain S, Kingsbury A, Bandopadhyay R, et al. Kinase Activity Is Required for the Toxic Effects of Mutant LRRK2/Dardarin. Neurobiol Dis. 2006; 23(2): 329-341.

39. Ashish KA,George Priya C.DossSiva R,  Magesh R, et al. Molecular insights of the G2019S substitution in LRRK2 kinase domain associated with Parkinson's disease: A molecular dynamics simulation approach. J Theoretical Biol. 2019; 496: 163-171.

40. Senthilkumar SK,Xiong Y, Lee Y, Lawless ML, et al. LRRK2 G2019S transgenic mice display increased susceptibility to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-mediated neurotoxicity. J Chem Neuroana. 2016; 76(Pt B): 90-97.

41. Howlett EHJensen NBelmonte FZafar F, et al.  LRRK2 G2019S-induced mitochondrial DNA damage is LRRK2 kinase dependent and inhibition restores mtDNA integrity in Parkinson's disease. Hum Mol Genet. 2017; 26(22):4340-4351.

42. Cota-Coronado JA, Sandoval-Ávila S, Gaytan-Dávila YP, Diaz NF, et al.Nuevos modelos transgénicos para el estudio de la enfermedad de Parkinson basados en sistemas de edición con nucleasas. Neurologia. 2017; 1-14.

43. Hueng-ChuenF,Chi CS,Lee YG, Tsai JD, et al.The Role of Gene Editing in NeurodegenerativeDiseases. Cell Transplan. 2018; 27(3): 364-378.

44. Scott CV, Babinski A, Tran N, To S, et al.  In Vitro CRISPR/Cas9-Directed Gene Editing to Model LRRK2 G2019S Parkinson’s Disease in Common Marmosets. Sci Rep. 2020;10:3447.  

45. Reinhardt PSchmid BBurbulla LFSchöndorf DC, et al.  Genetic correction of a LRRK2 mutation in human iPSCs links parkinsonian neurodegeneration to ERK-dependent changes in gene expression. Cell Stem Cell. 2013; 12(3): 354-367.

46. Marrone LBus CSchöndorf DFitzgerald JC, et al. Generation of iPSCs carrying a common LRRK2 risk allele for in vitro modeling of idiopathic Parkinson's disease. PloS one. 2018; 13(3): p. e0192497.

47. Purlyte EDhekne HSSarhan ARGomez R, et al. Rab29 activation of the Parkinson's disease‐associated LRRK2 kinase. EMBO J. 2018; 37(1): 1-18.

48. Laurie H. SandersLaganière J, Cooper O, et al. LRRK2 mutations cause mitochondrial DNA damage in iPSC-derived neural cells from Parkinson’s disease patients: Reversal by gene correction. Neurobiol Dis. 2014; 62: 381-6.

49. Heidenreich M, Zhang F. Applications of CRISPR–Cas Systems in Neuroscience. Nat Rev Neurosci. 2016; 17(1): 36-44.

50. Sachdeva M, Sachdeva N, Pal M, Gupta N, et al. Majumdar M, Tiwari A. CRISPR/Cas9: Molecular Tool for Gene Therapy to Target Genome and Epigenome in the Treatment of Lung Cancer. Cancer Gene Ther. 2015; 22(11): 509-517.

51. Thomas Gaj, Gersbach CA, Barbas CF III. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 2013; 31(7): 397-406.

52. Wang SPeng ZWang SYang L, et al. KRAB-type zinc-finger proteins PITA and PISA specifically regulate p53-dependent glycolysis and mitochondrial respiration. Cell Res. 2018; 28(5): 572-592.

53. Liu H, Chang L, Yu-hang Z, Xue-jie H, et al. Comparing successful gene knock-in efficiencies of CRISPR/Cas9 with ZFNs and TALENs gene editing systems in bovine and dairy goat fetal fibroblasts. J of Integra Agricul. 2018; 17(2): 406-414.

54. Eli JF, Hendel A, Kildebeck EJ, Caleb M, et al. A Comparison of Repair Pathway Choice between ZFNs, TALENs, and CRISPRs at Endogenous Loci via Simultaneous Measurement of NHEJ and HDR Using SMRT Sequencing. Molecular Therapy. 2014; 22: S34.

55. Sikandar Hayat Khan. 2019. Genome-Editing Technologies: Concept, Pros, and Cons of Various Genome-Editing Techniques and Bioethical Concerns for Clinical Application. Mol Ther Nucleic Acids. 2019; 16: 326-334.