اندازه‌گیری فعالیت و بیان ژن برخی از آنزیم‌های آنتی‌اکسیدانت وصفات کیفی میوه‌های پرتقال تحت تیمارهای پوششی

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشگاه اردکان، دانشکده کشاورزی و منابع طبیعی، گروه باغبانی، اردکان، ایران

2 دکتری بیماری‏ شناسی گیاهی، جهاد کشاورزی، البرز، ایران

چکیده

هدف: هدف از این مطالعه بررسی تاثیر عصاره آبی و  اتانولی گیاهان دارویی شامل چریش، میخک، آویشن و اسطوخودوس بر روی افزایش عمر انبارمانی پرتقال به‏وسیله کاهش اکسیژن­های فعال و متعاقب آن کاهش فعالیت آنزیم­های آنتی­اکسیدانت است.
مواد و روش‏ها: در این پژوهش ابتدا از چریش، میخک، آویشن و اسطوخودوس با استفاده از حلال­های آبی و اتانولی عصاره­گیری شد، سپس میوه‏های پرتقال با غلظت‏های مختلف عصاره­های گیاهی مذکور شامل 1000×2، 1000×4 و 1000×6، و همچنین کیتوزان و واکس، تیمار شدند. بعد از اعمال تیمار، میوه‏ها در سردخانه با دمای 7 درجه سانتی­گراد و رطوبت 80 تا 90 درصد نگه‏داری شدند. میوه­ها در ابتدای آزمایش و سپس هر بیست روز یک­بار از انبار خارج و فعالیت آنزیم­های کاتالاز و پراکسیداز و همچنین میزان بیان ژن این دو آنزیم در میوه­ها اندازه‏گیری شدند. در بخش دیگری از این مطالعه آزمون پنل انجام گرفت
نتایج: براساس نتایج، فعالیت هر دو آنزیم کاتالاز و پراکسیداز تحت تاثیر عصاره‏های گیاهی قرار گرفتند. در روز صدم، میوه­های تیمار شده با عصاره اسطوخودوس اتانولی با غلظت 1000×6 دارای کمترین میزان فعالیت آنزیم کاتالاز با مقدار 13/2، و کمترین میزان فعالیت آنزیم پراکسیداز مربوط به میوه‏های تیمار شده با غلطت 1000×6 عصاره آبی اسطوخودوس، به‏میزان 54/1 بودند. عصاره­های آبی و الکلی اسطوخودوس برروی میزان بیان هر دو ژن کاتالاز و پراکسیداز تاثیر داشتند به‏نحوی که کمترین میزان بیان ژن آنزیم­های کاتالاز و پراکسیداز در روز صدم، مربوط به تیمار 1000×6 عصاره اتانولی اسطوخودوس به‏ترتیب با مقادیر 66/6 و 28/5 بود.
نتیجه‏گیری: با توجه به نتایج این تحقیق مشخص شد که به‏طورکلی عصاره گیاهانچریش، میخک، آویشن و اسطوخودوس تاثیر بر روی فیزیولوژی میوه پرتقال داشته و با کاهش فعالیت فیزیولوژیکی باعث کاهش میزان فعالیت آنزیم­ها و همچنین بیان ژن­های متناظر آن­ها می­شوند.

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

پرتقال بومی مناطق گرمسیری و نیمه­گرمسیری بوده و یکی از قدیمی­ترین میوه­هایی است که بشر همواره از آن استفاده میکرده است. از حدود 500 سال قبل از میلاد مسیح کنفوسیوس از آن نام برده است (1). ایران با دارا بودن 290 هزار هکتار و تولید 2/4 میلیون تن مرکبات از نظر سطح زیرکشت و میزان تولید در بین کشور­های تولیدکننده مرکبات به‏ترتیب مقام هشتم و هفتم را داراست و این جایگاه خوبی در بین 140 کشور مرکبات­خیز دنیاست (2). مرکبات از گیاهان مناطق نیمه­گرمسیری محسوب می‏شوند. در مناطق گرمسیری، میزان قند و اسید در این میوه­ها کمتر شده و پوست آنان سبز باقی مانده و گلدهی نیز یکنواخت نمی­باشد (3). نظر به تولید این محصول در فصل خاصی از سال و همچنین تولید آن در مناطق خاصی از کشور نیاز به انبارداری آن امری اجتناب‏ناپذیر است. میوه‏جات از جمله مرکبات در طی انبارداری دستخوش تغییرات مختلف فیزیولوژیکی قرار می­گیرند که باعث می‏شود کیفیت میوه در طی انبارداری کاهش یابد (4). تغییرات بیوشیمیایی و فیزیولوژیک متعدد و هم­چنین تغییر در ساختار بافت محصولات باغی در قبل و بعد از برداشت انجام می­گیرد که شامل تغییر در میزان آب محصولات، تغییرات میزان قند در میوه و سبزی­ها، تغییر میزان نشاسته در محصولات باغی، تغییر ترکیبات پکتینی، تغییر ویتامین­های محصولات باغی، تغییرات سلولز و همی­سلولز، تغییر اسیدهای آلی، تغییر ترکیبات نیتروژنه، تغییر ترکیبات پروتئینی، تغییر ترکیبات لیپیدی، تغییر ترکیبات فنولی، تغییر ترکیبات رنگی، تغییر میزان کلروفیل و تغییر در میزان آنتوسیانین­ها می­شود (5). فساد پس­از برداشت می­تواند به‏دلیل عوامل قبل و بعد از برداشت باشد. مرکبات ممکن­ است قبل از برداشت و یا در طول برداشت دارای آلودگی پنهان باشد. به‏طورکلی ضایعات پس از برداشت میوه­ها و سبزی­ها به‏دلیل آسیب­های مکانیکی، فیزیولوژیکی و محیطی و فساد آن­ها به‏وسیله عوامل میکروبی و بیولوژیکی بروز می­کند. عوامل فیزیولوژیکی شامل تنفس و تعرق در میوه و سبزی و عوامل محیطی عمده، همان درجه ­حرارت و رطوبت نسبی محیط نگه‏داری محصول است. فساد میکروبی و بیولوژیکی به ضایعات ایجاد شده در اثر باکتری­ها، کپک­ها، مخمر­ها، ویروس­ها، آفات، جوندگان و سایر حیوانات اشاره کرد. آسیب­های مکانیکی در اثر استفاده از روش­های نامناسب برداشت و بسته­بندی و حمل و نقل نادرست به‏وجود می­آید (6). در این میان میوه مرکبات، محصولی حساس به بیماری­های پس ­از ­برداشت است، که توسط قارچ­ها در شرایط نامناسب ایجاد می­شوند. عامل­های قارچی پس ­از ­برداشت شامل بوتیریتیس سینرا، آلترناریا، آسپرژیلوس، پنی­سیلیوم، مونیلینا لاکسا و ریزوپوس استولونیفر می­باشند. تعدادی از میوه­جات توسط حشرات و حیوانات شکاف اولیه برداشته و در طی برداشت مکانیکی مستعد خسارت می­شوند (7). نظر به خسارتی که همواره میوه مرکبات همواره متحمل میشوند در نتیجه مطالعه و آگاهی از روش­های مختلفی که منتج به کـاهش میـزان ضـایعات شود از اهمیت بسـیاری برخـوردار اسـت. جـا دارد در ایران به مسائل پس از برداشت توجه بیشتری شده و با مراعــات نکــات فنــی، از ایجــاد ضــایعات در محصــول جلوگیری نموده و یا آن‏را بـه‏حـداقل ممکـن رسـاند. علاوه‏بر ضایعات فیزیکـی محصـول، هرگونـه اخـتلال در کیفیت ظاهری، بافت و عطـر و طعـم محصـول نیـز جـز ضایعات محصول محسوب می‏شود. بنابراین اهمیـت و نقـش فیزیولوژی و تکنولوژی پس از برداشت در کاهش ضایعات و حفظ کیفیت محصولات بیشتر می‏شود (8 و 9).

جهت افزایش عمر انبارمانی میوه جات و بالاخص مرکبات همواره از ترکیبات شیمیایی استفاده می­شود که این امر علاوه‏براین که برای محیط زیست خطرآفرین است سلامت انسان را نیز به چالش می‏کشد. استفاده از عصاره‏های گیاهی می‏تواند به‏عنوان روشی ایمن و دوست‏دار محیط­زیست باعث افزایش عمر انبارمانی میوه‏های مرکبات شود. عصاره­های گیاهی علاوه بر اثر مستقیم قارچ‏کشی که دارند، حاوی ترکیباتی هستند که می‏تواند باعث القای سیستم دفاعی گیاه در برابر بیمارگرها شود (10). لذا در این مطالعه به‏منظور مطالعه اثر عصاره‏های گیاهی بر سیستم آنزیمی گیاه، تاثیر این ترکیبات طبیعی بر روی میزان فعالیت دو آنزیم آنتی­اکسیدانت کاتالاز و پراکسیداز مورد بررسی قرار گرفت، در قسمت دوم تحقیق تاثیر عصاره آبی و اتانولی اسطوخودوس بر روی میزان بیان این دو ژن، و در نهایت جهت بررسی تاثیر عصاره‏های گیاهی بر روی کیفیت میوه‏ها آزمون پنل بر روی میوه‏های مورد بررسی انجام شد.

 

مواد و روش‌ها

مشخصات طرح و تیمارهای آزمایش: در این مطالعه فعالت آنزیم­های پراکسیداز و کاتالاز میزان بیان این دو ژن، و همچنین تست پنل در میوه پرتقال رقم تامسون ناول، که تحت تیمارعصاره­های تهیه­شده با حلال آبی و اتانولی گیاهان مختلف شامل اسطوخودوس (Lavandula angostifolia)، میخک (Syzygium aromaticum) و چریش(Azadiratcha indica) در غلظت­های متفاوت (دو در هزار، چهار در هزار و شش در هزار)، و همچنین پوشش خوراکی در سه غلظت نیم، یک و یک و نیم درصد از کیتوزان و واکس انباری بر روی پرتقال اندازه­گیری شد. برای هر کدام از تیمارها، شاهد آب مقطر و برای کیتوزان هم شاهد کیتوزان در نظر گرفته شد (11).

تهیه مواد گیاهی: برگ گیاه چریش از فضای سبز شهرستان چابهار برداشت شد و آویشن، میخک ، اسطوخودوس از محل رویش طبیعی آن­ها تهیه شدند. واکس براق کننده پرتقال نیز از شرکت پوشان حیات­ سبز تهیه شد.گیاهان ابتدا شست و شوی سطحی شده و سپس به‏وسیله هیپوکلریت 2 درصد به‏مدت 5 دقیقه ضدعفونی و سپس با آب مقطر استریل سه مرتبه شسته شدند (12). نمونه­های گیاهی در شرایط آزمایشگاه و دور از تابش مستقیم نور آفتاب خشک شدند.  سپس اندام­های هوایی به‏وسیله خردکن پودر شده و از الک یک مش عبور داده شدند (13).

تهیه عصاره: تهیه عصاره­های گیاهی به دو روش استفاده از حلال الکلی (اتانولی) و آب انجام گرفت. در روش استفاده از اتانول، 20 گرم از ماده خشک گیاهی در 100 میلی‏لیتر اتانول خالص (شرکت مرک) خیسانده شد و بعد از 24 ساعت ماندن در فضای آزمایشگاه به‏مدت 24 ساعت روی شیکر با سرعت 110 دور در دقیقه قرار داده شدند. پس از اتمام زمان مورد نظر محلول­های حاصل توسط پارچه ململ صاف شدند و در 5000 دور در دقیقه به‏مدت 10 دقیقه سانتریفیوژ شدند و سپس 75 میلی‏لیتر از محلول رویی به یک استوانه مدرج منتقل شده، 25 میلی‏لیتر آب مقطر استریل به ‏آن اضافه شد تا حجم آن به 100 میلی‏لیتر برسد، سپس هم حجم با آن هگزان اضافه شد. این مخلوط دو ساعت روی شیکر قرار داده شده و پس از این مرحله، بخش‏های مختلف به‏ کمک دکانتور جدا شده و بخش اتانولی جهت تبخیر اتانول و استحصال عصاره در زیر هود قرار داده شد (14). در روش دوم بعد از ضدعفونی سطحی نمونه‏های گیاهی 20 گرم از ماده خشک گیاهی در 100 میلی‏لیتر آب مقطر استریل خیسانده شد و پس از 24 ساعت از پارچه ململ عبور داده شده و سانتریفیوژ شد (15).

تهیه کیتوزان: ابتدا کیتوزان از شرکت سیگما آلدریچ با درجه استیل­زدایی 80 درصد خریداری شد. برای تهیه غلظت 5/0 درصد کیتوزان، مقدار 25/1 گرم از پودر کیتوزان در 190 میلی­لیتر آب مقطر اتوکلاو شده و 5/12 میلی­لیتر اسید­استیک روی هات­پلیت هم­زده شد تا محلول یکنواختی حاصل شد. سپس pH این محلول توسط سود 5 نرمال، روی4/5 تنظیم گردید. مقدار کیتوزان مورد استفاده برای غلظت 1 درصد، 5/2 گرم و برای غلظت 5/1 درصد، 75/3 گرم از پودر کیتوزان بود. برای تهیه شاهد کیتوزان، همه موارد بالا تکرار شد ولی کیتوزان به این مواد افزوده نشد.

تهیه میوه پرتقال: میوه پرتقال رقم تامسون ناول بعد از تعیین زمان برداشت از یکی از باغ­های تجاری واقع در شهرستان جیرفت جمع­آوری شد. سعی براین شد که میوه­های انتخاب شده یکنواخت و دارای اندازه یکسان و عاری از هرگونه زخم، خراش و یا عامل بیماری باشند.

عملیات پوشش­دهی به‏روش غوطه­وری انجام شد و پرتقال­ها به‏مدت سه دقیقه در محلول عصاره و پوشش خوراکی در غلظت‏های معین قرار گرفتند. تیمارنمونه شاهد با استفاده از آب مقطر انجام شد. سپس میوه­ها در مجاورت هوا خشک شده و بعد از توزین برچسب زده شدند. بعد از اعمال تیمار، میوه‏ها در سردخانه با دمای 7 درجه سانتی­گراد و رطوبت 80 تا 90 درصد نگه­داری شدند. میوه­ها در ابتدای آزمایش و سپس هر بیست روز یک­بار از انبار خارج و فعالیت آنزیم­های کاتالاز و پراکسیداز و همچنین میزان بیان ژن این دو آنزیم داخل میوه اندازه‏گیری و با نمونه­های بدون پوشش مقایسه شدند. بعد از نمونه‏برداری پوست میوه از قسمت گوشت جداسازی و بلافاصله قسمت گوشت تا زمان استفاده در نیتروژن مایع قرار داده و سپس به فریزر 80- منتقل شد. نکته قابل ذکر این است که تیمارها حذفی بودند و در شروع آزمایش تعداد پرتقال‏ها طوری در نظر گرفته شده بودند که بعد از هر بیست روز که پرتقال‏ها برای اندازه­گیری آنزیم و بیان ژن حذف می­شوند، برای دوره‏های بعد از همان تیمارها میوه وجود داشته باشد. به‏عبارت دیگر برای 24 تیماری که در این مطالعه بررسی شد (جدول 3)، چهار تکرار در نظر گرفته شد، و با توجه به این‏که در هر مرحله­ای تعداد 96 عدد پرتقال حذف می­شدند (24 ضربدر 4 تکرار)، در مجموع 480 عدد پرتقال برای این آزمون در نظر گرفته شد.

اندازه­گیری فعالیت کاتالاز و پرکسیداز: جهت اندازه­گیری فعالیت آنزیم­های کاتالاز و پرکسیداز ابتدا میزان پروتئین تام به روش بردفورد و همکاران (16) انجام گرفت.

استخراج عصاره برای اندازه­گیری آنزیم: استخراج عصاره پرتقال به‏منظور ارزیابی فعالیت آنزیم پراکسیداز، طبق روش گنگ و همکاران (17).، به‏شرح زیر انجام شد. یک گرم از بافت پرتقال جداشده و در سه میلی­لیتر بافر فسفات 5/0 مولار با 7pH= در یک هاون چینی کاملا له شد. برای ­این‏که یک مخلوط هموژن از عصاره به‏دست آید بلافاصله سوسپانیون حاضر را به ویال­های دو میلی­لیتری منتقل و در دستگاه میکروسانتریفیوژ به‏مدت 15 دقیقه در rpm 15000 در دمای 4 درجه سانتیگراد سانتریفیوژ شد. مخلوط رویی جهت بررسی میزان تغییرات آنزیم پراکسیداز برداشته شد و در فریزر در دمای  02- درجه ­سانتیگراد نگه­داری شد

میزان فعالیت آنزیم پراکسیداز: جهت ارزیابی میزان فعالیت آنزیم پراکسیداز به‏روش رونی و همکاران (18)، دو میلی­لیتر از مخلوط واکنش شامل مقداری از عصاره که دارای 50 میلی­گرم پروتئین باشد (این مقدار با استفاده از منحنی استاندارد محاسبه شد)، 5 میلی­مولار گوایکول و مقدار کافی بافر فسفات 25 میلی­مول با 7pH= را به حجم نهایی دو میلی­لیتر رسید، در یک لوله آزمایش ریخته و دستگاه اسپکتروفتومتر با استفاده از این مخلوط در طول موج 470 نانومتر صفر گردید. سپس پنج میکرولیتر پراکسیدهیدروژن (H2O2) 30 درصد به این مخلوط اضافه شد و سریعا تغییرات جذب نور به فواصل 10 ثانیه، به‏مدت یک دقیقه اندازه­گیری شد. مقدار فعالیت آنزیم بر حسب تغییرات جذب نور بر دقیقه بر میلی­گرم پروتئین بیان شد.

میزان فعالیت آنزیم کاتالاز: فعالیت آنزیم کاتالاز بر اساس روش ارائه شده توسط دو و همکاران (19) به‏ شرح زیر ارزیابی شد. مقداری از عصاره که دارای 40 میکروگرم پروتئین باشد (این مقدار با استفاده ازمنحنی استاندارد محاسبه شد)، با مقداری از بافر فسفات سدیم 50 میلی مولار با 7pH= به حجم دو میلی­لیتر رسانده و سپس در دستگاه اسپکتروفتومتر قرار داده شد و دستگاه با آن کالیبره شد. سپس به میزان 100 میکرولیتر از H2O2 سه درصد به مخلوط واکنش اضافه و میزان جذب نور به‏مدت 2 دقیقه اندازه­گیری شد. میزان فعالیت آنزیم بر اساس مقدار تجزیه شدن H2O2 اندازه­گیری می­شود. جذب محلول­ها در 240 نانومتر نسبت به آب با استفاده از دستگاه اسپکتروفتومتر قرائت شد. فعالیت کاتالاز بر اساس میلی­مولار پراکسیدهیدروژن در دقیقه در میلی­گرم پروتئین چهار تکرار اندازه­گیری شد.

بررسی میزان بیان بعضی از ژن‏های دفاعی در سطح نسخه‏برداری: در این قسمت، بررسی بیان ژن دو آنزیمی که میزان فعالیت آن­ها اندازه­گیری شده بود، انجام شد. میوهای پرتقال مانند آزمون اندازه­گیری آنزیم­ها تیمار شدند، و در واقع همزمان با نمونه­برداری برای اندازه­گیری آنزیم­ها نمونه برداری برای اندازه­گیری فعالیت ژن­ها نیز انجام شد (فقط از عصاره اسطوخودوس و کیتوزان غلظت 5/0 استفاده شد) تیمار شدند، و نمونه‌برداری در روزهای بیستم، چهلم، شصتم، هشتاد و 100 روز بعد از آلودگی میوه­ها صورت گرفت. بعد از نمونه­برداری، پوست میوه از قسمت گوشت جداسازی و بلافاصله قسمت گوشت تا زمان استفاده در نیتروژن مایع قرار داده و سپس به فریزر 80-  درجه سانتی‏گراد منتقل شد.

برای استخراج  RNAکل، نمونه‌ها از فریزر خارج شده و بلافاصله در داخل ظرف حاوی نیتروژن مایع قرار گرفت و سپس در داخل هاون و نیتروژن مایع به‏خوبی کوبیده شدند. استخراجRNA توسط کیت RNXplus (سیناژن، ایران) و بر اساس دستورالعمل شرکت انجام پذیرفت (20).

ساخت cDNA توسط آنزیم رونویسی معکوس: ساخت رشته cDNA از روی mRNAهای کل سلول با استفاده از آغازگر Oligo- (dt)18 تعبیه شده در کیتRevertAid Reverse Transcriptase (شرکت Thermo Scientific، آلمان) و بر اساس دستورالعمل ارایه شده در کیت انجام شد. به‏منظور اطمینان از عدم آلودگی RNA به DNA ژنومی، قبل از ساختcDNA با استفاده از آغازگرهای اختصاصی واکنش PCR با اینRNA  انجام شد و در مورد هیچ یک از RNA‌های استخراجی، باندی در واکنش PCR آن­ها مشاهده نشد.

بررسی الگوی بیان ژن‌های منتخب با روش Real time –PCR: الگوی بیان سه ژن شامل ژن­های رمز کننده کاتالاز، پراکسیداز در سطح نسخه‏برداری با استفاده از آغازگرهای مناسب (جدول 1) و روش PCR کمی از نوع کمیت‏سنجی نسبی بررسی شدند. ژن اکتین به‏عنوان ژن خانه‏دار انتخاب شد. تکثیر cDNA در واکنش کمی PCR از نوع کمیت‏سنجی نسبی، بر طبق دستورالعمل کیتYTA SYBR Green qPCR Master Mix (2x) (یکتا تجهیز آزما، ایران) و با استفاده از ترموسایکلر ویژه PCR کمی (Corbett RG-6000) انجام گرفت. برای تعیین میزان تغییرات بیان ژن­ها در طی نقاط زمانی از روش Livak استفاده شد. در این روش فرض بر این است که بازده نمونه و کنترل داخلی برابر و 100 درصد است و از فرمول CT∆∆-2 به‏منظور بررسی تغییر بیان ژن استفاده شد (21). بلافاصله بعد از انجام واکنشReal time PCR، محصول واکنش روی ژل ران شد و از کارکرد اختصاصی واکنش اطمینان حاصل ­شد. الگوی بیان ژن­ها با استفاده از دستگاه ترموسایکلر زمان واقعی (Corbett RG-6000) بررسی شد. برای تعیین میزان تغییرات بیان ژن­ها در طی نقاط زمانی از روش Livak استفاده شد. در این روش فرض بر این است که بازده نمونه و کنترل داخلی برابر و 100 درصد است و از فرمول  CT∆∆-2 به‏منظور بررسی تغییر بیان ژن استفاده شد (21).

میزان بیان ژن­های دفاعی منتخب براساس ژن توبولین (ژن خانه دار) با بیان ثابت نرمال شده و سپس میزان تغییرات بیان ژن در همه تیمارها نسبت به شاهد سنجیده شد.

میانگین مربوط به هر ژن در قالب طرح کاملا تصادفی با چهار تکرار (دو تکرار زیستی و دو تکرار روشی) تجزیه واریانس شد. نتایج به‏دست آمده از Real time RT -PCR با استفاده از آزمون چند دامنه دانکن در سطح خطای 05/0 و با استفاده از نرم­افزار SAS انجام گرفت. داده‏ها بر اساس آزمون Kurtosis و Skewness نرمال بودند.

 

جدول 1: آغازگرهای مورد استفاده در آزمایش Real time PCR

Name of genes

Primers seqences

Catalase

TTGAACACGAACGTCGACACCT

 

CTTGTACAGGAACGACAGCATC

 

GATCTTCGTGCTCGTGTTCA

Peroxidase

TGCGAATGTTTTGCTGTCTC

 

ارزیابی کیفیت میوه بر اساس تست پنل: در انتهای آزمایش به‏منظور بررسی کیفیت ظاهری و حسی میوه‎ها از نظر مصرف‎کننده آزمایشی صورت پذیرفت که در آن فرد مورد نظر بدون آگاهی از نوع و مقدار ماده پوششی استفاده شده روی میوه‎ها، به سوالات پرسیده شده در فرم پرسش‌نامه پاسخ دهد. برای ارزیابی حسی میوه از تعداد 9 نفر پانلیست شامل 5 مرد و 4 زن، در سنین بین 25 تا 45 سال استفاده شد. از افراد خواسته­شد تا بعد از تست میوه‎های مذکور به‏جهت از بین بردن مزه‎ی دهان به‏مقدار کافی آب میل نمایند.

 

نتایج

بررسی فعالیت آنزیم­های کاتالاز و پراکسیداز

کاتالاز

طبق جدول تجزیه واریانس (جدول 2)، داده‎های آنزیم کاتالاز در سطح احتمال یک درصد دارای اختلاف معنی­دار بودند. روند کلی داده‎های مربوط به آنزیم کاتالاز افزایشی است. طبق جدول مقایسه میانگین (جدول 3)، از میان تیمارهای اعمال شده، تیمارهای شاهد کیتوزان با مقدار 31/4 دارای کم­ترین میزان آنزیم کاتالاز هستند و بعد از آن کیتوزان یک و یک ­و نیم درصدی با مقدار 45/1 کم­ترین میزان کاتالاز را دارا بود. در روز صدم، عصاره اسطوخودوس اتانولی با غلظت شش در هزار دارای کمترین میزان آنزیم کاتالاز با مقدار 13/2 می­باشد. بعد از عصاره اسطوخودوس، پرتقال­های تیمار شده با عصاره میخک و سپس عصاره چریش قرار دارند.

 

جدول 2: تجزیه واریانس داده‎های کاتالاز پرتقال تامسون در طی زمان‌های انبارداری

میانگین مربعات

df

 

دوره پنجم (روز100)

دوره چهارم (روز80)

دوره سوم (روز 60)

دوره دوم (روز 40)

دوره اول (روز20)

 

منابع تغییرات

**87/1

**05/2

**01/2

**84/1

**087/2

23

تیمارها

004/0

003/0

003/0

037/0

002/0

48

خطا

16/2

01/2

37/2

78/7

26/2

 

CV%

               

** به‏احتمال 99 درصد (P≤0.01) اختلاف معنی دار بین تیمارهای مورد مطالعه وجود دارد.

 

جدول3: مقایسه میانگین تیمار­های مختلف بر میزان فعالیت کاتالاز در پرتقال تامسون در طی دوره‌های انباری

دوره پنجم(روز100)

دوره چهارم(روز80)

دوره سوم(روز 60)

دوره دوم(روز 40)

دوره اول(روز 20)

غلظت

تیمار

25/4a

13/4a

01/4a

78/3a

62/3a

0

شاهد

31/4a

12/4a

96/3a

62/3ab

47/3b

0

شاهد کیتوزان

50/2g

21/2j

12/2j

04/2ij

95/1l

1000×2

 

54/2i

12/2jk

04/2j

77/1j

77/1m

1000×4

اسطوخودوس (آبی)

34/2i

13/2jk

02/2j

82/1j

70/1m

1000×6

 

22/2i

11/2jk

91/1k

84/1j

57/1n

1000×2

 

35/2h

13/2jk

92/1k

81/1j

53/1n

1000×4

اسطوخودوس (اتانولی)

13/2i

05/2k

87/1k

78/1j

41/1o

1000×6

 

54/3d

50/3d

40/3cd

77/2ef

24/3d

1000×2

 

10/3e

86/2g

81/2f

91/2ed

67/2g

1000×4

میخک (آبی)

11/3e

89/2j

63/2g

54/2fgh

i28/2

1000×6

 

04/3e

87/2j

80/2f

71/2ef

67/2j

1000×2

 

03/3e

88/2g

75/2f

55/2fg

44/2h

1000×4

میخک (اتانولی)

81/2f

46/2i

33/2i

21/2hi

j17/2

1000×6

 

55/3d

61/3c

43/3c

40/3bc

36/3c

1000×2

 

56/3d

39/3e

34/3cd

21/3cd

17/3d

1000×4

چریش (آبی)

11/3e

06/3f

94/2e

84/2ef

76/2f

1000×6

 

73/3c

53/3cd

31/3o

27/3bc

23/3o

1000×2

 

90/3b

85/3b

70/3b

50/3abc

83/3c

1000×4

چریش (اتانولی)

56/3d

53/3cd

40/3cd

28/3bc

08/3e

1000×6

 

86/2f

62/2h

44/2h

25/2ghi

k08/2

1گرم

کیتوزان (5/0)

45/1k

35/1m

26/1l

25/1k

06/1q

5/2گرم

کیتوزان (0/1)

45/1k

36/1m

35/1lm

28/1k

q05/1

75/3پرم

کیتوزان (5/1)

96/1j

59/1l

43/1l

28/1k

18/1p

2میلی­لیتر

واکس

میانگین­های دارای حروف متفاوت در هر ستون بر اساس آزمون دانکن در سطح احتمال یک درصد دارای اختلاف معنی‏دار می­باشد

 

پراکسیداز: طبق نتایج جدول تجزیه واریانس، (جدول 4) داده­ها در سطح احتمال یک درصد معنی­دار بودند. با گذشت زمان میزان آنزیم پراکسیداز در میوه­های تیمار شده افزایشی بود. جدول مقایسه میانگین (جدول 5)، نشان می­دهد که در روز صدم، کمترین میزان آنزیم پراکسیداز بعد از تیمارهای کیتوزان یک و یک و نیم درصد و واکس، مربوط به تیمار اسطوخودوسآبی با غلظت شش در هزار و به‏میزان 54/1 بود و بعد از تیمار عصاره اسطوخودوس اتانولی قرار گرفت. تیمارهای گروه شاهد با مقدار 59/3 و 31/3 دارای میزان آنزیم پراکسیداز بالایی بودند. میوه­های تیمار شده با پوشش­های خوراکی کیتوزان یک درصد با مقدار 18/1 دارای کم­ترین میزان فعالیت آنزیم کاتالاز بودند.

 

جدول 4- تجزیه واریانس داده‎های پراکسیداز پرتقال تامسون در طی زمان‌های انبارداری

 

 

میانگین مربعات

 

 

df

 

دوره پنجم(روز100)

دوره چهارم(روز80)

دوره سوم (روز 60)

دوره دوم (روز 40)

دوره اول(روز20)

 

منابع تغییرات

**29/2

**27/2

**27/2

**13/2

**12/2

23

تیمارها

0002/0

0005/0

0003/0

015/0

0002/0

48

خطا

62/0

91/0

72/0

13/5

67/0

 

CV%

** به‏احتمال 99 درصد (P≤0.01) اختلاف معنی‏دار بین تیمارهای مورد مطالعه وجود دارد.

 

 

جدول 5: مقایسه میانگین تیمار­های مختلف بر میزان فعالیت پراکسیداز در پرتقال تامسون در طی دوره‌های انباری

دوره پنجم (روز100)

دوره چهارم (روز80)

دوره سوم (روز 60)

دوره دوم (روز 40)

دوره اول (روز 20)

غلظت

تیمار

31/3e

28/3e

23/3g

22/3c

19/3e

0

شاهد

59/3b

58/3b

53/3c

47/3ab

14/3b

0

شاهد کیتوزان

65/1p

63/1p

58/1q

55/1ij

51/1q

1000×2

 

63/1p

60/1p

59/1q

56/1ij

49/1q

1000×4

اسطوخودوس (آبی)

54/1q

50/1q

45/1r

39/1jk

34/1r

1000×6

 

00/2m

01/2m

98/1n

96/1gh

88/1n

1000×2

 

82/1n

82/1n

82/1o

76/1hi

70/1o

1000×4

اسطوخودوس (اتانولی)

70/1o

72/1o

70/1p

67/1i

61/1p

1000×6

 

86/2g

81/2g

76/2i

70/2d

65/2i

1000×2

 

65/2i

62/2i

56/2j

48/2e

42/2j

1000×4

میخک (آبی)

33/2k

29/2k

23/2l

18/2f

11/2l

1000×6

 

39/3d

37/3d

32/2f

27/3bc

21/3b

1000×2

 

77/2h

76/2h

74/2i

69/2d

62/2i

1000×4

میخک (اتانولی)

40/2j

39/2j

33/2k

30/2ef

k24/2

1000×6

 

50/3c

47/3c

46/3d

40/3bc

33/3c

1000×2

 

29/3e

27/3e

23/3g

19/3c

14/3f

1000×4

چریش (آبی)

92/2f

89/2f

86/2h

82/2d

76/2h

1000×6

 

74/3a

72/3a

74/3a

66/3a

60/3a

1000×2

 

52/3c

50/3c

42/3e

39/3bc

32/3c

1000×4

چریش (اتانولی)

76/3a

75/3a

69/3b

49/3ab

02/3g

1000×6

 

24/2l

19/2l

15/2m

10/2fg

m02/2

1گرم

کیتوزان (5/0)

18/1t

15/1s

13/1t

34/1jk

t03/1

5/2گرم

کیتوزان (0/1)

21/1s

19/1s

13/1t

08/1l

02/1t

75/3پرم

کیتوزان (5/1)

28/1r

28/1r

24/1s

18/1kl

13/1s

2میلی­لیتر

واکس

میانگین­های دارای حروف متفاوت در هر ستون بر اساس آزمون دانکن در سطح احتمال یک درصد دارای اختلاف معنی‏دار می­باشد.

 

بررسی میزان بیان ژن آنزیم­های کاتالاز و پراکسیداز: با ارزیابی منحنی‌های ذوب قطعات تکثیری و مشاهده‌ی تنها یک پیک برای هر ژن، از اختصاصی بودن تولیدات سنجش‌شده در آزمون کمی اطمینان حاصل شد (جدول 6). میزان بیان ژن رمز کننده آنزیم کاتالاز در طول 100 روز نگهداری در تمام تیمارها روند مشابهی را داشت و تا روز صدم پس از اعمال تیمارها، در تمام تیمارها افزایش نشان داد. کمترین میزان  بیان ژن در بین تیمارها مربوط به تیمار 1000×6 عصاره  اسطوخودوس اتانولی، در تمام روزهای نمونه­برداری بود، و در روز بیستم بعد از اعمال تیمارها، کمترین میزان را با مقدار 66/6 برابر میزان بیان در تیمارپرتقال سالم در روز اول، از خود نشان داد. میزان بیان این ژن با افزایش غلظت عصاره، نشان دهنده تاثیر مستقیم عصاره بر روی میزان بیان این ژن در سطح نسخه‏برداری می‏باشد (شکل 1 و جدول 7). در مورد عصاره آبی اسطوخودوس نیز دقیقا همین روال مورد مشاهده قرار گرفت، ولی همواره عصاره آبی تأثیر کمتری در میزان افزایش بیان ژن کاتالاز از خود نشان داد.

میزان ژن رمز کننده آنزیم پر­اکسیداز در طول 100 روز آزمایش، در تمام تیمارها روند مشابهی داشت، به‏عبارت‏دیگر میزان بیان این ژن در طول آزمایش همواره افزیش یافت، اما تیمارهای استفاده از عصاره های آبی و اتانولی اسطوخودوس این روند را کند کردند (جدول 8). غلظت 1000×6  عصاره اتانولی کمترین میزان بیان ژن این آنزیم را بیست روز بعد از اعمال تیمار در پی داشت (26/5 برابر میزان بیان این ژن در پرتقال سالم در روز اول) و این مقدار کمترین میزان نسخه‏برداری نسبی ژن در بین همه تیمارهای غلظت‏ها بود. استفاده از عصاره آبی اسطوخودوس تاثیر مشابهی بر روی میزان بیان ژن پراکسیداز در طول این آزمون گذاشت و روند افزایشی فعالیت آنزیم را کند نمود، در مورد این تیمار استفاده از غلظت 1000×6 این عصاره بیشترین تاثیر را در بین غلظت­های مختلف عصاره آبی در کاهش فعالیت آنزیم با به‏میزان 52/7 در روز بیستم نمونه برداری، از خود نشان داد (شکل 2، جدول 9).

 

جدول 6: تجزیه واریانس داده‎های بیان ژن آنزیم کاتالاز پرتقال تامسون در طی زمان‌های انبارداری

میانگین مربعات

df

 

دوره پنجم (روز100)

دوره چهارم (روز80)

دوره سوم (روز 60)

دوره دوم (روز 40)

دوره اول (روز20)

 

منابع تغییرات

**97/1

**25/2

**21/2

**74/4

**96/1

7

تیمارها

024/0

023/0

023/0

137/0

016/0

18

خطا

26/2

31/2

26/2

84/5

12/8

 

CV%

               

** به‏احتمال 99 درصد (P≤0.01) اختلاف معنی‏دار بین تیمارهای مورد مطالعه وجود دارد.

 

 

جدول 7: مقایسه میانگین تیمار­های مختلف بر میزان بیان ژن آنزیم کاتالاز در پرتقال تامسون در طی دوره‌های انباری

دوره پنجم (روز100)

دوره چهارم (روز80)

دوره سوم (روز 60)

دوره دوم (روز 40)

دوره اول (روز 20)

غلظت

تیمار

95/48a

62/42a

89/35a

45/28a

15/24a

0

شاهد

74/38b

25/32b

63/27b

41/22b

12/18b

0

شاهدکیتوزان

66/36c

21/30bc

25/24bc

80/17cd

66/12cd

1000×2

 

87/28ef

52/24de

04/20d

52/16de

05/9def

1000×4

اسطوخودوس (آبی)

85/27fg

55/21ef

25/17ef

99/14ef

52/7fg

1000×6

 

14/29de

52/24de

85/20d

52/16de

45/12cd

1000×2

 

01/22hi

63/17g

21/15fg

52/13ef

87/9de

1000×4

اسطوخودوس (اتانولی)

87/19ij

06/176g

25/13g

06/9g

66/6gh

1000×6

 


میانگین­های دارای حروف متفاوت در هر ستون بر اساس آزمون دانکن در سطح احتمال یک­درصد دارای اختلاف معنی‏دار می­باشد.

 

 

شکل 1: تاثیر عصاره اسطوخودوس آبی (w) و اتانولی (e) و کیتوزان (k) غلظت 5/0 بر روی بیان ژن آنزیم­های کاتالاز در میوه پرتقال. P: بیمارگر. داده­ها میانگین سه تکرار هستند.

 

 

 

جدول 8: تجزیه واریانس داده‎های بیان ژن آنزیم پراکسیداز پرتقال تامسون در طی زمان‌های انبارداری

 

 

میانگین مربعات

 

 

df

 

دوره پنجم (روز100)

دوره چهارم (روز80)

دوره سوم (روز 60)

دوره دوم (روز 40)

دوره اول (روز20)

 

منابع تغییرات

**63/5

**51/2

**26/2

**26/2

**16/2

7

تیمارها

0062/0

0011/0

0012/0

022/0

0023/0

18

خطا

12/4

26/6

22/5

16/5

69/6

 

CV%

** به‏احتمال 99 درصد (P≤0.01) اختلاف معنی‏دار بین تیمارهای مورد مطالعه وجود دارد.

 

جدول 9: مقایسه میانگین تیمار­های مختلف بر میزان بیان ژن آنزیم پراکسیداز در پرتقال تامسون در طی دوره‌های انباری

دوره پنجم (روز100)

دوره چهارم (روز80)

دوره سوم (روز 60)

دوره دوم (روز 40)

دوره اول (روز 20)

غلظت

تیمار

24/36a

14/32a

65/25a

36/22a

96/18a

0

شاهد

22/30b

96/26bc

36/21b

46/17b

25/14b

0

شاهدکیتوزان

85/25c

52.23cd

85/18c

52/14cd

36/10cd

1000×2

 

25/21cde

96/17fg

25/15ef

36/12de

52/8ef

1000×4

اسطوخدوس(آبی)

85/20de

52/16gh

23/15ef

96/11ef

69/7fg

1000×6

 

41/22cd

88/18ef

54/16de

55/12de

88/9de

1000×2

 

88/16fg

44/14hi

84/11gh

89/9fg

52/7fg

1000×4

اسطوخودوس(اتانولی)

36/16g

25/14i

85/9h

96/7gh

28/5h

1000×6

 

میانگین­های دارای حروف متفاوت در هر ستون بر اساس آزمون دانکن در سطح احتمال یک درصد دارای اختلاف معنی‏دار می­باشد.

 

 

شکل 2: تاثیر عصاره اسطوخودس آبی (w) و اتانولی (e) و کیتوزان (k) غلظت 5/0 بر روی بیان ژن آنزیم­های پراکسیداز در میوه پرتقال. P: بیمارگر. داده­ها میانگین سه تکرار هستند.

 

تست پنل

بر اساس نتایج تجزیه واریانس (جدول 10)، اثر پوشش­ها و عصاره­های گیاهی بعد از گذشت 100 روز از انبارداری میوه­ها، بر رنگ پوست، بو و طعم میوه، کیفیت ظاهری، تصمیم به خرید و ارزیابی میوه به‏طورکلی در سطح احتمال پنج درصد معنی­دار بود. براساس نتایج مقایسه میانگین، (جدول 11 و 12)، از نظر رنگ پوست تیمار واکس، میخک اتانولی و آبی با غلظت شش در هزار با مقدار 11/4 بیشترین نمره­ها را به‏دست آوردند. تیمار عصاره اسطوخودوس و پوشش کیتوزان با غلظت­های مختلف، از این نظر در مرحله بعدی قرار گرفتند. از بین عصاره­های اعمال شده میوه­های تیمار شده با عصاره چریش با غلظت دو در هزار با غلظت 00/3 کم­ترین نمرات را به‏دست آوردند. گروه شاهد آب مقطر و شاهد کیتوزان به‏ترتیب با مقدار 00/3 و 88/2 دارای کم­ترین نمره­ها هستند.

از نظر بوی میوه، اسطوخودوس اتانولی با غلظت چهار در هزار با مقدار 88/3 و غلظت شش در هزار با مقدار 00/4 و میخک آبی چهار در هزار با مقدار 8/3 و با غلظت شش در هزار با مقدار 00/4 بیش‏ترین نمره­ها را به‏دست آوردند. تیمار چریش بعد از تیمار عصاره­های اسطوخودوس و میخک قرار گرفت. از پوشش­های کیتوزان استفاده شده، پوشش کیتوزان نیم درصد با مقدار 77/3 دارای نمره­ی بیش‏تری بود.کم­ترین نمره­ مربوط به تیمار شاهد کیتوزان با مقدار 88/2 و بعد از آن شاهد آب مقطر با مقدار 00/3 بود (جدول 11). از نظر طعم چریش آبی شش در هزار با غلظت 00/4 و اسطوخودوس اتانولی با غلظت شش در هزار با مقدار 88/3 بیشترین نمره­ها را به‏دست آوردند. واکس و شاهد آب مقطر با غلظت 00/3، و شاهد کیتوزان با غلظت 66/2، دارای کم­ترین نمره­ها هستند.

از نظر بافت میوه­ها بین پوشش­ها اختلاف معنی‏داری مشاهده نشد اما از نظر عددی تیمار مربوط به شاهد کیتوزان با مقدار 33/3 مقدار کم­تر و تیمار کیتوزان 00/4 مقدار بیشتری را از نظر عددی بدست آورد. از نظر میزان آب­میوه نیز تفاوت معنی‏داری مشاهده نشد ولی از نظر عددی کم­ترین نمرات میزان آب میوه مربوط به تیمار شاهد کیتوزان با غلظت 33/3 و بیش‏ترین کیتوزان با غلظت نیم درصد با مقدار 00/4 و واکس و تیمار عصاره آبی و اتانولی شش در هزار با غلظت 88/3، نمره­دهی شده است.

از نظر کیفیت ظاهری میوه­ها، تیمار واکس و کیتوزان با غلظت نیم درصد با مقدار 77/3 بیش‏ترین نمره­هارا دریافت کردند. از بین عصاره­های استفاده شده، عصاره میخک با حلال آبی و حلال اتانولی با غلظت شش در هزار با مقدار 66/3 بیشترین نمره را از ارزیاب­ها دریافت کردند، پس از آن تیمار عصاره اسطوخودوس و سپس عصاره چریش قرار گرفت. تیمارهای مربوط به گروه شاهد، به‏ترتیب شاهد آب مقطر و شاهد کیتوزان با مقدار 00/3 و 88/2 کم­ترین نمرات را دریافت کردند.

براساس نظرسنجی مربوط به تصمیم به خرید میوه­های تیمارشده، تیمار اسطوخودوس اتانولی با غلظت چهار در هزار و کیتوزان نیم درصد با مقدار 66/3 بیشترین امتیاز را کسب کردند. به‏طورکلی، تیمار شاهد با مقدار 55/2 دارای کم­ترین نمرات و کم­ترین تمایل به خرید بودند. به‏طورکلی از بین عصاره­های اعمال شده، میخک اتانولی و اسطوخودوس دارای امتیاز بالاتری بودند. براساس نظرسنجی مربوط به ارزیابی کلی میوه­های تیمارشده، تیمار اسطوخودوس اتانولی و میخک اتانولی با غلظت شش در هزار بیش‏ترین امتیاز را کسب کردند. کم­ترین امتیاز از این نظر مربوط به تیمار شاهد کیتوزان با مقدار44/2 و شاهد آب مقطر با مقدار 55/2 بود. به‏طورکلی، تیمار شاهد دارای کم­ترین نمرات و میخک اتانولی شش در هزار و اسطوخودوس اتانولی شش در هزار دارای امتیاز بالاتری بودند.

 

جدول 10: تجزیه واریانس داده‎های تست پنل پرتقال تامسون در طی زمان‌های انبارداری

 

 

 

میانگین مربعات

 

df

 

به‏طورکلی

تصمیم خرید

کیفیت ظاهری

میزان آب میوه

بافت

طعم

بوی میوه

رنگ پوست

 

منابع تغییرات

*07/1

*12/1

*04/1

32/0ns

32/0ns

*65/0

*97/0

*19/1

23

تیمارها

48/0

49/0

55/0

54/0

54/0

48/0

53/0

58/0

192

خطا

18/22

38/22

61/22

36/20

36/20

97/19

87/20

69/21

 

Cv%

** به‏احتمال 95 درصد (P≤0.05) اختلاف معنی‏دار بین تیمارهای مورد مطالعه وجود دارد.

ns: سطوح معنی­داری وجود ندارد.

جدول 11: مقایسه میانگین تیمار­های مختلف بر تست پنل در پرتقال تامسون در طی دوره‌های انباری

بافت

طعم

بوی

رنگ

غلظت

تیمار

44/3a

00/3bc

00/3bc

00/3de

0

شاهد

33/3a

66/2c

88/2c

a88/2

0

شاهدکیتوزان

66/3a

33/3abc

22/3abc

44/3abcde

1000×2

 

88/3a

55/3ab

55/3abc

66/3abcde

1000×4

اسطوخودوس(آبی)

77/3a

55/3ab

66/3abc

88/3abc

1000×6

 

44/3a

66/3ab

44/3abc

33/3abcde

1000×2

 

44/3a

77/3ab

88/3a

55/3abcde

1000×4

اسطوخودوس(اتانولی)

89/3a

88/3a

00/4a

77/3abcd

1000×6

 

55/3a

abc33/3

44/3abc

44/3abcde

1000×2

 

66/3a

55/3ab

88/3a

00/4ab

1000×4

میخک(آبی)

77/3a

55/3ab

00/4a

11/4a

1000×6

 

77/3a

33/3abc

22/3abc

bcde22/3

1000×2

 

77/3a

44/3ab

44/3abc

22/3bcde

1000×4

میخک(اتانولی)

66/3a

55/3ab

88/3a

11/4a

1000×6

 

44/3a

44/3ab

22/3abc

00/3de

1000×2

 

66/3a

22/3abc

33/3abc

22/3bcde

1000×4

چریش(آبی)

77/3a

00/4a

77/3ab

55/3abcde

1000×6

 

44/3a

66/3ab

44/3abc

33/3abcde

1000×2

 

44/3a

44/3ab

00/3bc

55/3abcde

1000×4

چریش(اتانولی)

66/3a

55/3ab

77/3ab

55/3abcde

1000×6

 

00/4a

55/3ab

77/3ab

abcde77/3

1g

کیتوزان(5/0)

55/3a

55/3ab

66/3abc

88/3abc

5/2 g

کیتوزان(0/1)

55/3a

44/3ab

22/3abc

11/3cde

75/3 g

کیتوزان(5/1)

88/3a

00/3bc

66/3abc

11/4a

2 cc

واکس

میانگین­های دارای حروف متفاوت در هر ستون بر اساس آزمون دانکن در سطح احتمال یک درصد دارای اختلاف معنی‏دار می­باشد.

 

جدول 12: مقایسه میانگین تیمار­های مختلف بر تست پنل در پرتقال تامسون در طی دوره‌های انباری

به‏طورکلی

تصمیم به خرید

کیفیت ظاهری

میزان آب میوه

غلظت

تیمار

55/2de

55/2c

88/2bcd

44/3a

0

شاهد

44/2e

55/2c

00/3abcd

a33/3

0

شاهدکیتوزان

00/3abcde

00/3abc

22/3abcd

44/3a

1000×2

 

11/3abcde

00/3abc

55/3ab

77/3a

1000×4

اسطوخودوس(آبی)

33/3abcd

22/3abc

33/3abcd

88/3a

1000×6

 

55/3ab

55/3a

33/3abcd

44/3a

1000×2

 

33/3abcd

66/3a

33/3abcd

66/3a

1000×4

اسطوخودوس(اتانولی)

66/3a

55/3a

11/3abcd

88/3a

1000×6

 

11/3abcde

55/3a

22/3abcd

55/3a

1000×2

 

44/3abc

33/3abc

22/3abcd

66/3a

1000×4

میخک(آبی)

00/3abcde

22/3abc

66/3ab

77/3a

1000×6

 

44/3abc

44/3ab

22/3abcd

a77/3

1000×2

 

22/3abcde

11/3abc

44/3abc

33/3a

1000×4

میخک(اتانولی)

66/3a

22/3abc

66/3ab

66/3a

1000×6

 

66/2cde

66/2bc

88/2bcd

44/3a

1000×2

 

77/2bcde

66/2bc

22/3abcd

66/3a

1000×4

چریش(آبی)

77/2bcde

88/2abc

11/3abcd

77/3a

1000×6

 

00/3abcde

11/3abc

44/3abc

44/3a

1000×2

 

77/2bcde

66/2bc

55/2d

44/3a

1000×4

چریش(اتانولی)

00/3abcde

88/2abc

66/2cd

66/3a

1000×6

 

44/3abc

66/3a

77/3a

a00/4

1g

کیتوزان(5/0)

22/3abcde

22/3abc

66/3ab

55/3a

5/2 g

کیتوزان(0/1)

44/3abc

33/3abc

66/3ab

55/3a

75/3 g

کیتوزان(5/1)

33/3abcd

44/3ab

77/3a

88/3a

2 cc

واکس

میانگین­های دارای حروف متفاوت در هر ستون بر اساس آزمون دانکن در سطح احتمال یک­ درصد دارای اختلاف معنی‏دار می­باشد

 

بحث

میوه‏ها و سبزیجات به‏علت فعالیت آنزیمی بالا بیشترین درصد ضایعات را به‏خود اختصاص داده­اند. کاهش و به‏حداقل رساندن چنین ضایعاتی به‏عنوان برداشت مخفی می­تواند یکی از راه­های موثر در تامین مواد غذایی برای جامعه محسوب شود (راحمی، 1383 ). میوه­ها در مرحله پس از برداشت هنوز زنده هستند و تنفس می­کنند. به‏هر حال آن­ها از منابع آب و غذای اصلی جدا شده‏اند و بنابراین درصورتی‏که ارزیابی­ها به‏صورت دقیق صورت نگیرد، بسیار سریع دچار فساد می‏شوند (22).

با توجه به نتایج به‏دست آمده، میزان کاتالاز با گذشت زمان روند افزایشی دارد و تیمار کیتوزان 5/1 درصد دارای کم­ترین میزان و تیمار شاهد دارای بیشترین میزان کاتالاز بود. از میان عصاره­ها، عصاره اسطوخودوس دارای کم­ترین میزان فعالیت آنزیم هستند. افزایش اکسیژن فعال و رادیکال­های آزاد در طی فرایند رسیدن میوه­ها و در اثر تنفس سلولی، هم­چنین متابولیسم اکسیداتیو که در میوه­ها به‏خصوص میوه­های فرازگرا صورت می­گیرد، می­تواند منجر به ایجاد خسارت به غشاهای زیستی گردد. برای جلوگیری از ایجاد خسارت توسط رادیکال­های آزاد، سلول­ها از استراتژی جالبی بهره می­گیرندکه توسعه سیستم آنتی­اکسیدانتی می­باشد (23). آنتی­اکسیدانت‏ها با دادن الکترون به رادیکال­های آزاد، خود اکسیده شده و قدرت اکسیدکنندگی و ایجاد خسارت توسط رادیکال‏های آزاد را از بین می­برند (24). به‏نظر می­رسد که کیتوزان 5/1 درصد با کاهش فعالیت آنزیم­های آنتی­اکسیدانتی، مثل کاتالاز باعث افزایش H2O2 و برخی از گونه­های اکسیژن فعال می­گردد که این مولکول­ها برای فعال کردن ژن­های عامل مقاومت به شرایط استرس و بیماری وارد عمل می­شوند، بعد از فعال شدن ژن­های عامل مقاومت، رادیکال­های آزاد باید از سلول حذف شوند که ترکیبات آنتی­اکسیدانتی در تیمار کیتوزان، برای حذف آن­ها مصرف شده و میزان آن­ها کاهش می­یابد، کاتالاز آنزیم سم‏زدای مهمی است که با آنزیم­های دیگر فعالیت حذف کنندگی رادیکال­های آزاد را تحریک می­کند (25).

در تحقیقی به‏عنوان اثر پس­از برداشت اسید­سالیسیلیک بر برخی ویژگی­های کیفی و فعالیت آنتی­اکسیدانی میوه کیوی رقم هایوارد، انجام شد. نتایج این مطالعه نشان داد که ﺑﺎ ﮔﺬﺷﺖ زﻣﺎن اثر سالیسیلیک اسید در افزایش فعالیت آنزیم کاتالاز موثرتر بوده است میزان فعالیت آنزیم کاتالاز نیز پس از 16 هفته در غلظت یک میلی مولار بالاتر بود (26).

با توجه به نتایج این مطالعه، کم­ترین میزان آنزیم پراکسیداز مربوط به تیمار کیتوزان و از عصاره­ها، عصاره اسطوخودوس دارای میزان کمی از فعالیت آنزیم بود. با گذشت زمان فعالیت آنزیم پراکسیداز افزایش یافت. گیاهان در برابر تنش­های محیطی رادیکال‏های اکسیژن، آزاد تولید می­کنند که خود روند پیری را افزایش می­دهد. برای محافظت سلول در برابر تنش­های اکسایشی (اکسیداتیو)، بافت­های گیاهی آنزیم­های حذف کننده­ی گونه­های فعال اکسیژن مانند سوپراکسیداتیو دیسموتاز­، کاتالاز و پراکسیداز، ترکیب­های سمیت­زدا در برابر لیپوکسیژنازها (گلوتاتیون اس ترانسفراز، آسکوربات پراکسیداز) و شبکه­ای از پاداکسنده‏های کم وزن (آسکوربات، گلوتاتیون ترکیب فنلی و توکوفرل­ها) دارند (27).برای خنثی کردن اثر سمی گونه­های اکسیژن فعال یک سیستم آنتی اکسیدانتی خیلی موثر مورد نیاز است که در سلول­های گیاهی دو سیستم غیرآنزیمی و آنزیمی این نقش را بر عهده دارند (28).

لی و همکاران  (29) اثر پوشش­های مبتنی بر پلی­ساکارید (آلژینات، پولولان و کیتوزان) را بر آنزیم­های آنتی­اکسیدانتی توتفرنگی مورد بررسی قرار دادند. نتایج نشان داد که فعالیت آنزیم کاتالاز در تمام میوه­ها در طول انبارداری سرد، کاهش یافته است اما فعالیت آنزیم در میوه شاهد کاهش بیشتری نسبت به میوه­های پوشش داده شده با پلی­ساکارید­ها داشت. میوه­های پوشش داده شده با کیتوزان بیشترین فعالیت کاتالاز را در میان سه تیمار پلی­ساکاریدی نشان دادند. میوه­های پوشش داده شده با پلی­ساکارید فعالیت‏های متفاوتی از آنزیم­های آنتی­اکسیدانتی در طول انبارمانی در دمای پایین نشان دادند که ضرورت تحقیقات بیش‏تر روی اثرات آن­ها بر بیان ژن مربوط به این آنزیم­ها نشان می­دهد.

ترش در سال 1394، اثر اسانس مرزه باغی، صمغ عربی و آب گرم بر پوسیدگی کپک سبز در لیمو ترش را بررسی کرد. نتایج نشان داد که تیمار اسانس مرزه باغی در غلظت 800 میکرولیتر در لیتر، بهترین تیمار برای حفظ ترکیبات زیست فعال مانند فنول و فعالیت آنتی­اکسیدانتی بود و هم­چنین باعث کاهش فعالیت آنزیم پلی­فنل اکسیداز پراکسیداز وکاتالاز در پوست میوه شد. تیمارهای مختلف تاثیر چندانی بر چگالی میوه و چگالی آب­میوه نداشتند. نتایج نشان داد که به‏طورکلی میوه­های تیمار شده توسط آب گرم 40 درجه سلسیوس کمترین تغییرات فیزیکوشیمیایی را در طی انبار داشتند.

در این بررسی، عصاره‌های گیاهی فعالیت آنزیم‌های کاتالاز و پراکسیداز را در طول آزمایش نسبت به شاهد کاهش دادند. کاهش فعالیت آنزیم‏های دفاعی به‏وسیله عصاره‏های گیاهی در اثر کاهش تنفس و اثر پوشش‏دهی میوه­ها می‏باشد. در تحقیقی که به‏وسیله زاهدی و همکاران انجام شد نتایج نشان داد که میزان ترکیبات فنلی در میوه‏های انبه تیمار شده با پوشش خوراکی کیتوزان، ابتدا افزایش و سپس کاهش پیدا کرد و در نهایت میزان ماندگاری میوه های انبه افزایش یافت (30).

در آزمون بررسی تغییرات بیان ژن‌های کاتالاز و پراکسیداز میزان بیان نسبی این دو ژن دقیقا روندی مانند میزان فعالیت دو آنزیم مورد بررسی داشتند. در مورد هر دو ژن میزان فعالیت در طی روزهای نمونه‏برداری در تیمار شاهد افزایش یافت. عصاره‏های گیاهی در این مورد هم باعث کاهش میزان بیان دو ژن مورد بررسی، یعنی کاتالاز و  پرکسیداز شدند. در این آزمون، با افزایش میزان غلظت استفاده از عصاره گیاهی، میزان نسخه‌برداری ژن و میزان فعالیت آنزیم‌ها کاهش پیدا کرد. با توجه به این مطالب می‎توان به‏این نتیجه رسید که عصاره‏های گیاهی با پوششی که بر روی میوه ایجاد کردند توانستند فیزیولوژی گیاه را به‏سمتی هدایت کنند که میزان فعالیت آنزیم‏های آنتی­اکسیدانت کاهش یابد (31).

عصاره بعضی گیاهان می­تواند بر روی فیزیولوژی میوه ها تاثیر بگذارد. در این مطالعه، هماهنگی کاملی بین میزان بیان ژن‏های کاتالاز و پراکسیداز و فعالیت این دو آنزیم وجود داشت. میزان بیان ژن و همچنین فعالیت­ آنزیم‏های مربوطه در این مطالعه افزایش یافت، ولی عصاره گیاه اسطوخودوس روند افزایشی را هم در مورد فعالیت آنزیم و هم میزان بیان آن­ها کاهش داد. تحقیقی دیگر با عنوان اثر پوشش خوراکی اسانس برازنبیل با پایه روغن زیتون  بر ماندگاری و صفات فیزیکوشیمیایی میوه خرمالو انجام شد نتایج نشان داد فعالیت آنزیم پلی­فنل­اکسیداز و کاتالاز در میوه­های پوشش داده شده نسبت به شاهد کمتر بود. در نتیجه در محدوده پژوهش انجام شده ترکیب تیماری فیلم پی وی سی با اسانس برازنبیل را می‏توان به‏عنوان ترکیب تیماری مناسب معرفی کرد (15).

در رابطه با هماهنگی فعالیت آنزیم­ها و میزان بیان ژن­های متناظر با آن­ها، نتایج این تحقیق هماهنگی کامل بین این عامل را نشان داد. زمانی­که میزان فعالیت آنزیم افزایش پیدا کرد به‏طور کاملا هماهنگ و هم راستا با آن افزایش بیان ژن‏ها را در این مطالعه ما شاهد بودیم. به‏عبارت‏دیگر، با بالا رفتن بیان ژن­های دفاعی، میزان پروتئین متناظر آن‏ها نیز افزایش می‏یابد، و افزایش میزان پروتئین­های پیام­دهنده باعث بالا رفتن میزان فعالیت آنزیم­های درگیر در این واکنش­ها می­گردد.

فاکتورهای مهم در کیفیت فراورده از نظر مصرف کننده شامل وضع ظاهر (اندازه و شکل و رنگ)، حالت محصول و بی‎عیب بودن، بافت و احساس آن در دهان، طعم و ارزش غذایی می‌باشد (32). بر همین اساس در آزمون پانل، رنگ پوست، بو، طعم، بافت، آب‏دار بودن میوه، کیفیت ظاهری و میزان مشتری‎پسندی محصول اندازه‌گیری شد.

بر اساس نتایج، از نظر رنگ پوست تیمار واکس، میخک اتانولی و آبی با غلظت 6000 بیشترین نمره­ها را به‏دست آوردند. از نظر بوی میوه، اسطوخودوس اتانولی4000 و 6000 و میخک آبی 4000 و 6000 بیشترین نمره­ها را بدست آوردند. از نظر طعم چریش آبی6000  و اسطوخودوس اتانولی 6000  بیش‏ترین نمره­ها را به‏دست آوردند. از نظر کیفیت ظاهری میوه­ها، تیمار واکس بیش‏ترین نمره را دریافت کرد پس از آن تیمار کیتوزان قرار گرفت. از بین عصاره­های استفاده شده، عصاره میخک بیش‏ترین نمره را از ارزیاب­ها دریافت کرد.

 

نتیجه­گیری

امروزه در عرصه جهانی، جایگزین­های مختلفی برای پوشش­های و همچنین سموم و آفت­کش­های شیمیایی مورد توجه قرار گرفته است. به­عنوان مثال می­توان عصاره­های گیاهی را نام برد که از گیاهان عالی به‏دست آمده و گزینه خوب و نوید بخشی جهت جایگزینی مواد شیمیایی سنتزی، که برای تیمار میوه­ها در انبار استفاده می­شوند، هستند. از طرف دیگر تولید محصولات ارگانیک به‏دلیل نقش آن­ها در سلامتی انسان رو به افزایش است که این خود نیازمند عدم استفاده از مواد شیمیایی در خلال مرحله پس­از برداشت می­باشد. روش­های مختلفی جهت حفظ این محصولات به­کار می­رود و عصاره­های طبیعی با توجه به خواص ضد­میکروبی و آنتی اکسیدانتی می­توانند جایگزین روش­ها معمول گردند. تاثیر ضد میکروبی و افزایش خواص کیفی محصولات توسط برخی از ترکیبات طبیعی ثابت گردیده، ولی به‏منظور استفاده تجاری، این نتایج به‏صورت پوشش­دار کردن میوه یا تغییر اتمسفر انبار (MA)، در غلظت­های مختلفی روی محصولات تازه در سطح تجاری آزمایش گردد. هدف از انجام این پژوهش اثبات این موضوع بود که عصاره‏های گیاهی علاوه ‏بر این‏که خاصیت ضدمیکروبی مستقیم دارند که در تعداد زیادی از مقالات این موضوع به اثبات رسیده است، نیز می‏توانند با کاهش فعالیت آنزیم‏های آنتی­اکسیدانت باعث افزایش ماندگاری میوه در انبار شوند. به‏عبارت‏دیگر با خاصیت پوشش­دهی وکاهش تنفس که عصاره‏های گیاهی بر روی میوه پرتقال ایجاد کردند توانستند روند افزایشی تولید رادیکال­های آزاد اکسیژن را در طول زمان کندتر کنند، که متعاقب آن روند افزایشی فعالیت آنزیم­های آنتی­اکسیدانت هم با شیب ملایم­تری نسبت به شاهد ادامه یافت، که این نکته دقیقا در مورد بیان ژن دو آنزیم کاتالاز و پراکسیداز که در این مطالعه بررسی شدند نیز اتفاق افتاد.

1. Curk F, Ollitrault F, Garcia-Lor A, Luro F. et al. Phylogenetic origin of limes and lemons revealed by cytoplasmic and nuclear markers. Ann Bot. 2016; 117(4): 565–583.
2. Adetuyi FO, Ibrahim TA, Ajalia L, Oloye DA. Waxing Effect on the Physical Attributes, Antioxidant and Sugar Contents of Orange (Citrus sinensis L. osbeek) stored at Room Temperature in Nigeria. Bangladesh J Sci Ind Res. 2010; 45(2): 111-116.
3. Hutton RJ., Loveys, BR. A partial root zone drying irrigation strategy for citrus—Effects on water use efficiency and fruit characteristics. Agricultural Water Management, 2011; 98: 1485–1496.
4. Gholamnejad J, Etebarian HR, Roustaee A. Sahebani N.  Biological control of apple blue mold by   isolates of Saccharomyces cerevisiae.  Journal of Plant Protection research, 2009; 49:270-275.
5. Azarakhshi M, Farzad Mehr J, Eslah M, Sahabi H. An investigation on trends of annual and seasonal rainfall and temperature in different climatologically regions of Iran. Journal of Range and Watershed Management, 2013; 66(1): 1-16.
6. Kirda C, Topaloglu F, Topcu S, Kaman, H. Mandarin yield response to partial root drying and conventional deficit irrigation. Turkish Journal of Agriculture and Forestry, 2012; 31: 1-10.
7. Obagwa J, Korsten L. Control of citrus and green and blue molds with garlic extracts. Plant Pathology. 2002; 109: 221- 225.
8. Gholamnezhad J. Transcriptomics and useful techniques of defense gene expression evalution of plant. Appl biol. 2016; 6(4): 21-42.
9. Kader AA. Postharvest Technology of Horticultural Crops - An Overview from Farm to Fork. Ethiop .J. Appl. Sci. Technol, 2013; (1): 1- 8.
10. Gholamnejad J, Etebarian HR, Naserinasab F. Induction of defense responses and biological control of blue mold of apple fruit (Penicillium expansum) with Rhodotorula mucilaginosa A1. Res plant pathol. 2013; 1(4): 47-60.
11. Gholamnezhad J. Effect of plant extracts on activity of some defense enzymes of apple fruit in interaction with Botrytis cinerea. J Integ Agr. 2019; 17(0): 1-10.
12. Alam P. Mohammad, A. Ahmad, MM. Khan, MA.etal., Efficient method for Agrobacterium mediated transformation of Artemisia annua L. Recent Pat Biotechnol. 2014; 8(1): 102-107.
13. Abdul Aziz H, Omran A, Zakaria WR. H2O2 Oxidation of Pre-Coagulated Semi Aerobic Leachate. Int J Environ Res. 2010; 4 (2): 209-216.
14. Bahraminejad S, Asenstorfer RE, Riley IT, Schultz CJ. Analysis of the antimicrobial activity of flavonoids and saponins isolated from the shoots oats (Avena sativa L.) J Phytopathol. 2008; 156(1): 1-7.
15. Azimim AA. Delnavaz HB, Mansour GA. Antifungal effect of aqueous alcoholic and phenolic extracts of seed and leaves of Sorghum bicoloragainst Fusarium solani Fusarium poa in Persian.  Med Plant Res J. 2006; 6(1): 26 - 32.
16. Bradford MM. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem. 1976; 72(1-2): 248-254.
17. Gong M, Li Y, Dai X, Tian M, et al. Involvment of calcium and calmodulin in the acquisition of  HS inuced thermotolerance in maize seedling. J Plant Physiol. 1997; 150(5): 615-621.
18. Reuveni R. 1995. Biochemical marker of disease resistance. p. 99–114. In: “Molecular Methods in Plant Pathology” (R.P. Singh, U.S. Singh, eds.). Boca Raton, CRC Press, Florida, USA, 1995; 507 pp.
19. Du Z, Bramlage WJ.  Peroxidativeactivity of apples peel in relation todevelopment of poststorage disorders. Hort Sci. 1995; 30(2): 205-208.
20. Zangoei E, Bazgir E, Gholamnezhad J, Darvishnia M. Investigation of the peroxidase and catalase enzymes activity and expression level of it’s encoding genes in pathogen stress (Penicillium expansum) and Walnut green skin extract condition in apple fruits. Cell tissue j. 2018; 9(2): 397-415.
21. Livak KL, Schmittgen TD. Analysis of relative gene expression Data using Real-time quantitative PCR and the 2 -∆∆CT Method. Methodes. 2001; 25: 402–408.
22. Adiani  V,  Gupta  S,  Padole  R,  Variyar  PS, etal. Artocarpus heterophyllus bulbs.  Postharvest  Biol Technol.  2014; 98:  34–40.
23. Spinardi MA. Effect of Harvest Date and Storage on Antioxidant Systems in Pears. Int Postharvest Symp. 2005; 682(682):135-140
24. Gholamnezhad J, Sanjarian F, Mohammadi goltapeh E, Safaei N, et al. Study of defense genes expression profile pattern of wheat in response to infection by Mycosphaerella graminicola. Iran J Plant Biol. 2016; 8(30): 43-55.
25. Hernandez JA, Ferrer MA, Jimenez A, Barcelo AR,  Sevilla F. Antioxidant systems and O2-/ H2O2 production the apoplast of pea leaves. Its relation with salt- induced necrotic lesions in minor veins. Plant Physiol. 2001; 127: 827-831.
26. Janowska B, Jerzy M. Effect of Gibberllic acid on the post – harvest Flower Longevity of Zantedeschia elliottiana (W.Wats) Engl. Acta Sci Pol Hortorum cultus. 2004; 3(1): 3-9.
27. Bakkali F, Averbeck S, Averbeck D,  Idaomar M. Biological effects of essential oils–a review. Food chem toxicol. 2008; 46(2): 446-475.
28. Sonboli A, Salehi P, Yousefzadi M.  Antimicrobial Activity and Chemical Composition of the Essential Oil of Nepeta crispa Willd. from Iran. Z Naturforsch. 2004; 59(9-10): 653-656.
29. Li H, Wang Y, Liu F, Yang Y, et al. Effects of chitosan on control of postharvest blue mold decay of apple fruit and the possible mechanisms involved. Sci Hortic. 2015; 186: 77-83.
30. Lobo V, Patil A, Phatak A, Chandra N. Free radicals, antioxidants and functional foods: Impact on human health. Pharmacogn Rev. 2010; 4, 118–126.
31. Abebe, Z., Tola, Y.B., Mohammed, A. 2017.  Effects of edible coating materials and stages of maturity at harvest on storage life and quality of tomato (Lycopersicon esculentum Mill.) fruits. African journal of Agricultural Research, 2017; 12(8), 550-565.
32. Zahedi S M, Ehteshami  S, Aazami  M. A. Effect of Edible Chitosan Coating on some Qualitative Characteristics and Storage Life of Mango. Plant prod technol. 2019; 17(2): 143- 154.