بررسی میزان بیان miR-33 a، miR-429 و miR-200 c درسرطان سلول‌های غیر‏‏کوچک ریه

نویسندگان

1 گروه ژنتیک، دانشکده علوم زیستی، دانشگاه آزاد اسلامی واحد ورامین–پیشوا، تهران، ایران

2 مرکز بیوتکنولوژی پزشکی، عضو هیئت علمی انستیتو پاستور، تهران، ایران

چکیده

هدف: در این تحقیق ارتباط miR-33a، miR-429 و miR-200c با مسیر EMT در سرطان سلول های غیرکوچک ریه، مورد بررسی قرار گرفت.
مواد و روش ها: در این مطالعه از روش Real Time-PCR برای ارزیابی تغییرات بیان miRNAهای مذکور از 30 بافت توموری سلول‏های غیرکوچک ریه (NSCLC) (66 درصد در مرحله I و II و 34 درصد بیماران در مرحله III) استفاده شد. پس از استخراجRNA  از نمونه‏های بافتی سنتز   cDNAبا استفاده از پرایمرهای ساقه حلقه انجام شد. بررسی کمی میزان بیان ژن‏های فوق الذکر با استفاده از پرایمرهای اختصاصی انجام و آنالیز داده ها با فرمول-∆∆ct 2 صورت گرفت.
نتایج: ارزیابی تغییرات بیان برای miR-33a نشان دادکه تعداد 11 نمونه از 30 نمونه توموری افزایش بیان داشتند.miR-429  افزایش بیان در 12 نمونه توموری و miR-200c افزایش بیان در 18 نمونه توموری داشتند. اما این تغییرات معنی‏دار نبود (به‏ترتیب 09/0p=، 084/0p= و 072/0p=).
نتیجه گیری: از آن‏جایی‏که نمونه‏های این مطالعه در مراحل ابتدایی سرطان بودند، شاید توجیه کننده عدم تغییر بیان معنی‏دار می‏باشد. همچنین این پژوهش در مقیاس کوچک طراحی شده، لذا برای به‏دست آوردن نتایج دقیق‌تر، تحقیقات بیشتر و افزایش تعداد نمونه‌ها نیاز است.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

سرطان ریه از علل شایع مرگ مرتبط باسرطان و در نتیجه یک مشکل عمده برای سلامت عمومی جامعه است (1). سرطان ریه به‏ دو نوع سرطان سلول‏های کوچک (SCLC) و سرطان سلول‏های غیرکوچک (NSCLC) تقسیم می‏شود که تقریبا 85 درصد سرطان ریه مربوط به انواع  NSCLCاست. این نوع سرطان از نظر بافت شناسی به سه نوع آدنوکارسینوم (AdC)، کارسینوم سلول سنگفرشی (SCC) و کارسینوم سلول بزرگ (LCC) طبقه‏بندی می‏شود (2،3). برآورده‏ای انجمن سرطان آمریکا در زمینه سرطان ریه در ایالات متحده تا سال 2017 حدود 222500 مورد جدید سرطان ریه و 155870 مرگ و میر ناشی از آن بود (4). از عواملی که باعث سرطان ریه می‏شوند می‏توان به سیگارکشیدن، قرارگرفتن در معرض دود تنباکو، نیکل، کروم، آزبست و آرسنیک اشاره کرد (5). سرطان ریه اغلب در مراحل پیشرفته تشخیص داده می‏شود زمانیکه درمان علاج‏بخش دیگر امکان‏پذیر نیست (6). درمان سرطان فردمحور مبتنی بر پایه ژنتیکی در 10 سال گذشته به‏خصوص در NSCLC پیشرفت کرده است (7). بنابراین، نیاز فوری به کشف اهداف تشخیصی و درمانی جدید بر پایه مطالعات مولکولی برای بیماران مبتلا به‏سرطان وجود دارد (8، 9). شواهد نشان می‏دهد که پیشرفت تومور با عوامل ژنتیکی، اپی‏ژنتیکی و محیطی کنترل می‏شود (10). مسیر EMTدر ایجاد تهاجم و متاستاز سرطان نقش دارد، تهاجم باعث متاستاز سرطان به ماتریکس خارج سلولی (ECM) می‏شود.  EMTیکی از مهم‏ترین فعالیت‏هایی است که موجب انتقال سلول به استروما شده، همچنین مولکول‏های وابسته به EMT آبشاری از سیگنال‏های داخل سلولی را می‏سازند که در کاهش فعالیت E-cadherin دخالت دارند. به‏دنبال کاهش فعالیتE-cadherine، چسبندگی بین سلولی نیز کاهش یافته و سلول به‏سمت متاستاز پیش می‏رود (11). مطالعات نشان داده که microRNAها از طریق تنظیم EMT به متاستاز کمک می‏کنند. همچنین شواهد اخیر نشان می‏دهد که عوامل رونویسی مرتبط با EMT ممکن است به‏طور مستقیم در متاستاز دخیل باشند (12). میکروRNAها می‏توانند به‏عنوان انکوژن و یا مهارکننده تومور از طریق مهار بیان ژن‏های هدف وابسته به‏سرطان عمل کنند (13، 14). در دهه گذشته مطالعات بسیاری، نقش میکروRNAهای موثر در مسیر  EMT را در سرطان مختلف از جمله ریه نشانداده است (15، 17). لذا در تحقیق حاضر، مطالعه این سهmiRNA که دارای اهداف ژنی بسیار مهمی در مسیر EMT می‏باشند در دستور کار قرار گرفت.

 miR-33 aدر متاستاز سرطان سلول‏های غیر کوچک ریه در سطوح پایین بیان شده و مهار بیان miR-33a موجب القا EMT و بیان بالای miR-33a توسط تنظیم بیان  Twist1موجب توقف EMT در سلول‏های  NSCLCمی‏شود. همچنین miR-33a به‏عنوان سرکوبگر تومور شناخته شده، زیرا بیان بیش از حدmiR-33a  برای مهار رشد سلول‏های سرطانی گزارش شده است (18).

miR-200 c و miR-429 از اعضای خانواده miR-200 می‏باشند و اعضای این خانواده تنظیم کننده‏های مهمEMT  و متاستاز هستند.  miR-200 cیک سرکوب‏کننده تومور در انواع مختلف سرطان به‏شمار می‏رود (15). یافته‏های اخیر نشان داده است که miR-200 c حداقل تا حدی از طریق تحریک USP25، که یکی از اعضای خانواده پروتئازهای ubiquitin است تهاجم را سرکوب می‏کند (19).  miR-200 cتغییرات اپیتلیال- مزانشیمی را با کاهش مقادیر  ZEB1/2و افزایش مقادیر E-cadherin، تنظیم می‏کند که به‏عنوان نشانگر اپیتلیال شناخته شده است.  E-cadherin اصلی مورد نیاز برای اتصال بین سلولی است. miR-200 c می‏تواند موجب مهار پس از رونویسی این فاکتورهای رونویسی گردد و از این طریق موجب کنترل EMT شود (20). گزارش شده است که miR-429 در سرطان کولورکتال،کارسینوم هپاتوسلولار،کارسینوم مری،سرطان پستان و سرطان ریه نقش دارد (21). مطالعات اولیه گزارش دادند که سطح پایین  miR-429 بابقای کلی کوتاه در بیماران NSCLC ارتباط دارد و همچنین نقش miR-429 درتنظیم سلول‏های NSCLC به‏طور بالقوه ناشی از مهار بیانDLC-1 است (22).

 

مواد و روش‌ها

جمعیت مورد مطالعه:جهت بررسی الگوی بیان miR-33a، miR-429 و miR-200c، پس از اخذ رضایت‏نامه تعداد ۳۰ نمونه ‌بافت تومور ریه و بافت نرمال حاشیه تومور از بیماران مبتلا به سرطان ریه غیر سلول کوچک در اطاق عمل توسط جراح در بیمارستان مسیح دانشوری تهران گرفته شد. نوع تومور توسط پاتولوژیست‏ها تشخیص داده شد. بیمارانی که وارد مطالعه شدند قبل از جراحی هیچ‏گونه درمانی اعم از شیمی‏درمانی و رادیوتراپی روی آن‏ها انجام نشده بود. نمونه‏هایی که تحت درمان بودند و یا پاتولوژی آن‏ها غیر از NSCLC بود از مطالعه خارج شدند، نمونه‏ها در داخل ازت مایع دراطاق عمل قرارداده شد و به آزمایشگاه منتقل شدند. پس از انتقال به آزمایشگاه نمونه تا زمان استفاده در دمای۷۰- درجه سانتی‏گراد ذخیره شد. استخراج RNA و سنتز cDNA از هر کدام ازنمونه‌های توموری و نمونه نرمال مجاور توموری (به‏عنوان کنترل)،RNA  با استفاده از کیت ((Gene All, Korea باتوجه به پروتکل شرکت سازنده استخراج شد. غلظت و کیفیت RNA استخراج شده با اسپکتروفتومتری در طول موج 260 و 260 به 280 نانومترمورد بررسی قرار گرفت. از نمونه‏هایی که نسبت جذب نوری 280/260 نانومتر بین 2/2-8/1 داشتند جهت سنتز cDNA استفاده شد. سنتز  cDNAبا استفاده از پرایمرهای ساقه حلقه اختصاصی توسط (Prime Script RT reagent kit ,Takara, Japan, Cat. NO RR037A) برطبق پروتکل شرکت سازنده صورت گرفت. نمونه‌ها تا زمان استفاده در دمای۸۰- درجه سانتی‏گراد ذخیره شدند. از RNU44 به‏عنوان کنترل داخلی استفاده شد. توالی پرایمرهای ساقه-حلقه اختصاصی جهت سنتز cDNA درجدول۱ ارایه شده است.

 

 

جدول1: پرایمرهای ساقه-حلقه طراحی شده جهت سنتز cDNA.

ژن

توالی (‍`۳ →`۵)

miR-200c-3p

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGACTCCATC

 

 

miR-429

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGACACGGTT

 

miR-33a-5p

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGACTGCAAT

 

RNU44

GTCGTATCCAGTGCAGGGTCCGACCGGTATTCGCACTGGATACGACAGTCAG

 

         

توالیهایی که زیر آنها خط کشیده شده اختصاصی هر miRNA می باشد و بقیه توالی ساقه-حلقه مشترک می باشد.

 

 

 

ارزیابی بیانmiR-33a ، miR-429 وmiR-200c:

واکنش  Real-time PCRدرحجم 15 µLشامل: 7.5μl ازRealQ Plus 2x Master Mix Green High ROX™ (Ampliqon, Denmark) ، 10 نانوگرمcDNA ، 5/5 میکرولیتر آب و یک میکرولیتر (۳ پیکومول) از مخلوط پرایمر رفت و برگشت صورت گرفت. برنامه دمایی و زمانی شامل: دناتوراسیون اولیه به‏مدت ۱۵دقیقه، سپس به‏مدت ۴۰ سیکل:  ۹۵درجه‌ی سانتی‏گراد به‏مدت ۱۵ ثانیه و ۵۸ درجه به‏مدت یک دقیقه. همه‌ی نمونه‌ها به‏صورت duplicate و روش بررسی سایبرگری نبود. جهت طراحی پرایمر از نرم افزار AlleleID v7.4 (Premier Biosoft, US و سایت   (NCBIاستفاده شد. پرایمرهای مورد استفاده برای واکنش فوق در جدول ۲ ارایه شده است.

 

جدول2: پرایمرهای طراحی شده و توالی آن‌ها.

نام miRNA

طول محصول                                 توالی (‍`۳ `۵)

 

miR-200c-3p

CACGCCTAATACTGCCGGGT

Forward

pb ۸۵

 

GTATGCAGAGCAGGGTCC

Reverse

 

miR-429

AGCCGCCTAATACTGTCTGGTA

Forward

pb ۹۱

 

GTATGCAGAGCAGGGTCC

Reverse

 

miR-33a-5p

CATCCGCAGTGCATTGTAGTTG

Forward

pb ۸۹

 

GTATGCAGAGCAGGGTCC

Reverse

 

RNU44

CCTGGATGATGATAGCAAATG

Forward

bp ۸۰

 

GTATGCAGAGCAGGGTCC

Reverse

           

پرایمر Reverse برای همه forwardها مشترک است.

 


آنالیز آماری

جهت آنالیز نتایج PCR  Real-time از فرمول-∆∆ct 2 و از آزمون T-test و نرم افزارGraphPad Prism v7.03 (GraphPad Software Inc., USA) جهت مقایسه معنی‏دار بود نتایج در دو گروه توموری و نرمال استفاده شد. همچنین برای همه‌ی آزمون‌ها میزان 05/0p< به‏عنوان سطح معنی‏داری تست درنظر گرفته شد.

 

نتایج

30 نمونه بافت توموری و بافت نرمال مجاور توموری بارضایت بیماران از بیمارستان مسیح دانشوری تهیه شد. بیماران از نظر سیگاری و غیرسیگاری بودن و پاتولوژی تومور شامل هر دو نوع سرطان سلول غیرکوچک ریه (سلول سنگفرشی و ادنوکارسینوما) دسته‏بندی شدند. به‏طوری‏که بیماران از نظر نوع زیرگروه بافتی 57 درصد مبتلا به آدنوکارسینوما و 43 درصد مبتلا به سرطان سلول‏های سنگفرشی، 66 درصد در مرحله I و II و 34درصد بیماران در مرحله III بودند. از نظر جنسیت، 27 درصد زن و 73 درصد مرد و از نظر سنی، 3 درصد زیر 40 سال، 3 درصد بین 40 تا 50 سال، 47 درصد بین  50 تا 60  سال و 47 درصد بین 60 تا 70 سال داشتند، همچنین از نظر استعمال دخانیات 73 درصد غیرسیگاری و 27 درصد سیگاری بودند.

نتایج ارزیابی بیانmiR-33a  در بیماران مبتلا به سرطان سلول‏های غیر کوچک ریه

میزان بیان  miR-33aبا استفاده از روش Real Time-PCR در 30 نمونه بافت NSCLC و 30 نمونه بافت مجاور سالم آن بررسی شد. بررسی‏ها نشان‏دهنده‏ افزایش بیان در 37 درصد نمونه‏ها و کاهش بیان در 63 درصد نمونه‏ها می‏باشد ( شکل 1).

 

 

 

 

 

شکل1: نمودار مربوط به تغییرات بیان miR-33a در نمونه های توموری

 

 

تجزیه و تحلیل آماری داده‏های این ژن با 09/0p=، بیان‏گر عدم وجود اختلاف معنی‏دار در سطح بیان این میکروRNA در نمونه‏های توموری در مقایسه بانمونه‏های سالم است (شکل –a2).

نتایج ارزیابی بیانmiR-429  در بیماران مبتلا به سرطان سلول‏های غیر کوچک ریه

تغییرات بیان miR-429 در نمونه‏های توموری در مقایسه با نمونه‏های سالم نشان داد که اختلاف معنی‏داری بین بیان miR-429 در نمونه‏های توموری و نمونه‏های سالم وجود ندارد (084/0p=) ( شکل-b2). به‏طوری‏که از 30 نمونه توموری، 12 نمونه  (40 درصد) افزایش بیان و بقیه نمونه‏های توموری (60 درصد) نشان‏دهنده کاهش بیان  miR-429بودند (شکل3).

 

 

 

شکل3: نمودار مربوط به تغییرات بیان miR-429 در نمونه های توموری

 

نتایج ارزیابی بیانmiR-200c  در بیماران مبتلا به سرطان سلول‏های غیر کوچک ریه

ارزیابی بیان  miR-200cدر 30 نمونه توموری و 30 نمونه سالم مجاور آن براساس شکل 4، بیان‏گر کاهش بیان 12 نمونه (40 درصد) و افزایش بیان 18 نمونه از 30 نمونه توموری (60 درصد) می‏باشد. در نهایت با آنالیزهای آماری هیچ اختلاف معنی‏داری بین سطح بیان این میکروRNA  درنمونه‏های توموری در مقایسه با نمونه‏های سالم مشاهده نشد (072/0p=) (شکل –c2).

 

 

شکل4: نمودار مربوط به تغییرات بیان miR-200c در نمونه های توموری

 

شکل2: نمودار (a) مربوط به مقایسه بیان miR-33a ،(b)  مربوط به مقایسه بیانmiR-429  و (c) مربوط به مقایسه بیان   miR-200c میان نمونه های توموری و نمونه های سالم.

 

بحث

یکی از مسیرهای مهم در پیشروی سرطانی شدن سلول، مسیر EMT می‏باشد. EMT دارای نقش مهم در افزایش پتانسیل بدخیمی و کاهش حساسیت به درمان‏های معمول در سلول‏های NSCLC است. از دست دادن بیان مارکرهای EMTمانند E-cadherin وcytokeratin  و به‏دست آوردن بیان مارکرهای مزانشیمی مانندN-cadherin  وvime ntin به‏طور قابل توجهی با پیشرفت مرحله NSCLC ارتباط دارد. اکنون مشخص شده است کهRNAهای غیرکدکننده از قبیلmicroRNAها از طریق تنظیمEMT  در ایجاد و یا جلوگیری از متاستاز کمک می‏کنند (10). به‏همین ‏منظورmiR-33 a ، miR-429 وmiR-200 c  در این مطالعه، به‏عنوان میکروRNAهای درگیر در این مسیر بررسی شدند، زیرا این miRNAها هدف‌های ژنی مهمی در مسیر EMT ازجمله ZEB2، Snail-1،TWIST ،N-cadherin ،PI3K ، Akt دارند. مطالعات پیشین روی اینmicroRNA ها نتایج مختلفی را در سرطان‌های مختلف نشان داده‏اند.  Changو همکاران با تحقیق روی رده‌ی سلولی MCF-7 پیشنهاد کردند که miR-200 c تهاجم و مهاجرت را در سرطان پستان را از طریق هدف قرار دادن بیان HMGB1 مهار می‏کند (23). نتایج مطالعه‌ای دیگر روی این miRNA در ۷۹ بیمار نشان داد که بیان سطح miR-200 c در بافت‏های NSCLC پایین‏تر از بافت‏های غیرتوموری بود. این کاهش بیان سبب برداشته شدن اثر مهاری miR-200 c روی ژن‌های  ZEB1/2و کاهش بیانE-cadherin و در نهایت کاهش چسبندگی سلولی می‌شود. اما در تحقیق حاضر این کاهش بیان معنی‌دارنبود. ازجمله دلایلی که می‏توان برای این تناقض مطرح کرد می‏توان به کم‏بودن تعداد نمونه‏ها اشاره کرد. همچنین نمونه‌ها در مراحل ابتدایی سرطان ریه بودند و شاید همین امر توجیه‏کننده عدم تغییر بیان mir-200 c باشد.

دیگر عضو متعلق به‏خانواده‌یmiR-200 ، یعنی miR-429 نیز در این پژوهش مورد بررسی قرارگرفت که تغییر بیان هدف‏داری را در نمونه‌های NSCLC نشان نداد. هر چند که پیش‌تر افزایش بیان آن در سرطان روده گزارش شده بود (24). درسال 2014،Lang  و همکاران بررسی کردند که افزایش mir-429 باعث ایجاد تومور در سرطان سلول‏های غیر کوچک ریه می‏شود و چندین ژن سرکوب‏کننده تومور را هدف قرار می‏دهد. بیان بیش از حد miR-429 در رده‌ی سلول‏های (A549 NSCLC) به‏طور قابل توجهی باعث مهاجرت و تهاجم سلول شده، درحالی‏که مهار miR-429 مانع از این اثرات می‏شود. miR- 429 با هدف قرار دادن ژن‌های PTEN، RASSF8  و TIMP2، بیان آن‌ها را کاهش می‏دهد. این ژن‌ها جز سرکوب‏کننده‌های تومور هستند و به این ترتیب باعث متاستاز و سرطانی شدن سلول‌ها می‌شوند (22). اما در تحقیق حاضر تغییر بیان معنی‏داری برایmiR429  مشاهده نشد، ازجمله دلایلی که برای عدم تغییر بیان می‌توانیم مطرح کنیم این است که بیانmiR429 وابسته به بافت است و در بافت‌های مختلف ژن‌های متفاوتی هدف قرار می‌دهد. باتوجه به گزارش کاهش بیان این miRNA در مطالعه‌ی Lang و همکاران افزایش تعداد نمونه‌ها می‌تواند راهکاری منطقی برای به‏دست‏آوردن نتایج قابل اطمینان در این زمینه باشد.

تغییرات نابه‌جا در الگوی بیان  miR-33 aنیز در سرطان‌های متعددی گزارش شده است. مطالعات نشان داده است که miR-33a می‏تواند با تنظیم بیان β-catenin مانع از گسترش سلول‏های سرطانی ریه و تهاجم در رده‌ی سلولی بافت ریه  A549شود. β-catenin در پیشرفت چرخه سلولی نقش دارد و بیان غیرطبیعی آن در سلول‏های مختلف تومور مشاهده شده است. همچنین MiR-33a با کاهش بیان نابه‌جای خود سبب متاستاز سرطان ریه سلول غیر کوچک می‏شود و با بیان Twist1 رابطه معکوس دارد (25). درسال 2017،Li-Kun Hou  و همکاران به‏بررسی بیان  microRNA-33 a در  NSCLCsو بافت نرمال ریه پرداختند. در مطالعه مذکور ۱۴۷ نمونه توموری که در مراحل انتهایی سرطان قرار داشتند و ۳۲ نمونه طبیعی ریه گنجانده شدند. تجزیه و تحلیل miR-33a در این نمونه‏ها توسط qRT-PCR نشان داد که میزان بیان آن در بیوپسی‏های تومور NSCLC نسبت به بافت‏های غیر سرطانی مجاور پایین‏تر است. این تفاوت از نظر آماری معنی‏دار بود (05/0p<). علاوه‏براین، سطح بیان miR-33 a در هر در جهاز بیوپسی تومور NSCLC به‏طور قابل توجهی پایین‏تر از بافت ریه طبیعی بود (26). درمطالعه حاضر تغییر بیان معنی‏داری در miR-33a مشاهده نشد. شاید بتوان با افزایش تعداد نمونه‌ها نتایج دقیق‌تری را برای miR-33 a به‏دست آورد.

درنهایت، برایmicroRNA های انتخابی در این پژوهش تغییر بیان معنی‏داری مشاهده نشد. ازآن‏جایی‏که این پژوهش در مقیاس کوچک طراحی شده، لذا برای به‏دست‏آوردن نتایج دقیق‌تر، تحقیقات بیشتر و افزایش تعداد نمونه‌ها نیاز است. این یافته‏ها می‏تواند سطح اهمیتmicroRNA ها را ارتقا داده وکمکی به درک مکانیسمهای مولکولی سرطان ریه باشد.

 

  

تشکر و قدردانی

این مقاله بخشی از پایان‏نامه دانشجویی در مقطع کارشناسی ارشد می‏باشد که با حمایت دانشگاه آزاد اسلامی واحد ورامین-پیشوا به ‏انجام رسیده است، بدین وسیله از کلیه‏ی افرادی که ما را در انجام این تحقیق یاری کردند تشکر و قدردانی می‏شود.

 

 

 

1. Chen W, Zheng R, Baade PD, Zhang S, et al. Cancer statistics in China, 2015. CA Cancer J Clin. 2016; 66(2): 115-132.

2. Devarakonda S, Morgensztern D, Govindan R. Genomic alterations in lung adenocarcinoma. lancet oncol. 2015; 16(7): e342-e351.

3. Shackelford RE, Vora M, Mayhall K, Cotelingam J. ALK-rearrangements and testing methods in non-small cell lung cancer: a review. Gene canc. 2014; 5(1-2): 1-7.

4. Ahmadi AM, Ghasemi H, Nooshin S, Zayani Z, et al. Assessing Gene Expression and Methylation of KMT2D and IGF2 Genes in Patients with Non-Small Cell Lung Cancer. Canc Clin Oncol. 2018; 7(1): 55-59.

5. Alberg AJ, Samet J M. Epidemiology of lung cancer. Chest. 2003; 123(1): 21S-49S.

6. Jemal A, SiegelR, Xu J, Ward E. Cancer statistics, 2010. CA Cancer J Clin. 2010; 60(5): 277-300.

7. Chen G, Noor A, Kronenberger P, Teugels E, et al. Synergistic effect of afatinib with su11274 in non-small cell lung cancer cells resistant to gefitinib or erlotinib. PloS one. 2013; 8(3): e59708.

8. Brothers JF, Hijazi K, Mascaux C, El-Zein RA, et al. Bridging the clinical gaps: genetic, epigenetic and transcriptomic biomarkers for the early detection of lung cancer in the post-National Lung Screening Trial era. BMC medicine. 2013; 11(1): 168-172.

9. Gazala S, Pelletier JS, StorieD, Johnson JA, et al. A systematic review and meta-analysis to assess patient-reported outcomes after lung cancer surgery. Sci World J. 2013; 2013(3): 1-8.

10. Behrens C, Feng L, Kadara H, Kim HJ, et al. Expression of interleukin-1 receptor–associated kinase-1 in non–small cell lung carcinoma and preneoplastic lesions. Clin Cancer Res. 2009; 16(1):34-44.

11. Brabletz T, Kalluri R, Nieto MA, Weinberg RA. EMT in cancer. Nat Rev Cancer. 2018; 18(2): 128-133.

 

12. Singh A, Settleman J. EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer. Oncogene. 2010; 29(34): 4741-51.

13. Lin P, Yu S, YangP. MicroRNA in lung cancer. Br J cancer. 2010; 103(8): 1144-1148.

14. Wouters MD, van Gent DC, Hoeijmakers JH, Pothof J. MicroRNAs, the DNA damage response and cancer. Mutat Res-Fund Mol M. 2011; 717(1-2): 54-66.

15. Ceppi P, Mudduluru G, Kumarswamy R, Rapa I, et al. Loss of miR-200c expression induces an aggressive, invasive, and chemoresistant phenotype in non–small cell lung cancer. Mol Cancer Res. 2010; 8(9): 1207-16.

16. Yang L, Yang J, Li J, Shen X, et al. MircoRNA-33a inhibits epithelial-to-mesenchymal transition and metastasis and could be a prognostic marker in non-small cell lung cancer. Sci Rep. 2015; 5: 13677.

17. Zhu W, He J, Chen D, Zhang B, et al. Expression of miR-29c, miR-93, and miR-429 as potential biomarkers for detection

 

of early stage non-small lung cancer. PloS one. 2014; 9(2): e87780.

18. Kuo PL, Liao SH, HungJY, Huang MS, et al. MicroRNA-33a functions as a bone metastasis suppressor in lung cancer by targeting parathyroid hormone related protein. Biochim Biophys Acta. 2013;1830(6): 3756-3766.

19. Hur K, Toiyama Y, Takahashi M, Balaguer F, et al. MicroRNA-200c modulates epithelial-to-mesenchymal transition (EMT) in human colorectal cancer metastasis. Gut. 2013; 62(9): 1315-1326.

20. Wellner U, SchubertJ, Burk UC, Schmalhofer O, et al. The EMT-activator ZEB1 promotes tumorigenicity by repressing stemness-inhibiting microRNAs. Nat cell biol. 2009; 11(12): 1487-1493.

21. Xing L, Todd NW, Yu L, Fang H, et al. Early detection of squamous cell lung cancer in sputum by a panel of microRNA markers. Mod Pathol. 2010; 23(8): 1157-1163.

22. Lang Y, Xu S, Ma J, Wu J, et al. MicroRNA-429 induces tumorigenesis of human non-small cell lung cancer cells and targets multiple tumor suppressor genes. Biochem Biophys Res Commun. 2014; 450(1): 154-159.

23. Chang I, Mitsui Y, Fukuhara S, Gill A, et al. Loss of miR-200c up-regulates CYP1B1 and confers docetaxel resistance in renal cell carcinoma. Oncotarget. 2009; 6 (10):7774-84.

24. Han Y, Zhao Q, Zhou J, Shi R. miR-429 mediates tumor growth and metastasis in colorectal cancer. Am J Cancer Res. 2017; 7 (2): 218-225.

25. Cao L, Xie J, LinY, Zheng L, et al. miR-183 inhibits invasion of gastric cancer by targeting Ezrin. Int J Clin Exp Pathol. 2014; 7(9): 5582-5594.

26. Hou L, Ma Y, Han Y, Gai-Xia L, et al. Association of microRNA-33a molecular signature with non-small cell lung cancer diagnosis and prognosis after chemotherapy. In PloS one. 2017; 12 (1): e0170431.