اثر سطوح مختلف لسیتین سویا بر کیفیت منی و نسبت جنسیت اسپرم گاو هلشتاین با تکنیک Real-time qPCR

نوع مقاله: علمی - پژوهشی

نویسندگان

دانشگاه علوم کشاورزی و منابع طبیعی خوزستان، دانشکده علوم دامی و صنایع غذایی، گروه علوم دامی، اهواز، ایران

چکیده

هدف: پژوهش حاضر به­منظور بررسی استفاده از سطوح مختلف لسیتین سویا در رقیق­کننده تریس بر کیفیت منی و نسبت جنسیت با استفاده از تکنیک real-time qPCR اجرا شد.
مواد و روشها: نمونه­گیری از چهار گاو نر نژاد هلشتاین، یک بار در هفته انجام شد و سپس نمونه­های مناسب با هم مخلوط شدند. نمونههای اسپرم (در چهار تکرار) به سه گروه شامل صفر، یک و دو درصد لسیتین سویا اختصاص داده­شد. و فراسنجه­های کیفی و نیز نسبت جنسیت منی در آن­ها تعیین شد. در این تحقیق به­منظور شستشوی منی و حذف سلول­های مرده، از تکنیک شنا به‏سمت بالا (Swim up) استفاده شد. ژن‏های PLPو SRY به‏ترتیب برای جداسازی قطعات خاصی از توالی‏های کروموزوم X- وY- تکثیر شدند. در این روش PAR به‏عنوان ژن مرجع جهت نرمال­سازی داده­های حاصل از بیان ژن در واکنش real- time qPCR استفاده شد.
نتایج: نتایج پژوهش حاضر نشان داد که تکنیک Swim up و سطوح مختلف لسیتین سویا موجب بهبود کیفیت منی شدند. علاوه‏ براین، استفاده از تکنیک Swim up باعث کاهش معنی­دار بیان ژنPLP (11/0±75/0) و افزایش معنی­دار بیان ژن SRY (13/0±37/1) شد. اما استفاده از سطوح مختلف لسیتین سویا تغییری در نسبت جنسیت اسپرم ایجاد نکرد.
نتیجه گیری: به‏طورکلی، لسیتین سویا یک‏ جایگزین مناسب برای منابع حیوانی بوده و موجب بهبود کیفیت مایع منی می‏شود. با توجه به محدودیتهای موجود در استفاده از منابع حیوانی در رقیق کننده گاو، استفاده از لسیتین سویا به‏عنوان یک منبع گیاهی پیشنهاد می‏شود.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

حفظ باروری اسپرم برای مدت طولانی، نیازمند استفاده از رقیق­کننده­هایی است که محیط مناسبی را از نظر فیزیولوژیکی و متابولیکی برای بقای اسپرم فراهم کنند. رقیق­کننده­های متشکل از مواد مختلف (قند، الکترولیت‏ها، بافر، زرده تخم­مرغ و لسیتین سویا) برای نگهداری اسپرم در حیوان­های گوناگون پیشنهاد شده­اند (1). بیشتر رقیق­کننده­هایی که طی دهه­های گذشته برای رقیق­کردن منی گاو استفاده شده، بر پایه زرده تخم مرغ  و یا شیر بوده است، به­علت مشکلات حاصل از رقیق کننده‏های با منشا حیوانی از قبیل وجود آلودگی میکروبی و انتقال بیماری، متغیر بودن ترکیبات آن‏ها، دشواری مشاهدات میکروسکوپی و ظرفیت­دار شدن زود هنگام اسپرماتوزوئید، تمایل به‏عدم استفاده از منابع حیوانی در رقیق­کننده وجود دارد (2).

نتایج مطالعه محققان بر منی بز نشان داد که نوع رقیق‏کننده مورد استفاده در این مطالعه با آسیب DNA  اسپرم در ارتباط است (3). تغییر در نسبت اسپرماتوزوئیدهای حامل کروموزوم X و Y تنها می­تواند با تغییرات نسبت یا عملکرد اسپرم حامل کروموزوم X یا Y زنده در منی به‏دست آید. تفاوت بین اسپرم حامل کروموزوم X و Y در سرعت حمل از طریق دستگاه تولیدمثل جنس ماده و همچنین انتخاب ترجیحی اسپرم که ممکن است اثرات متفاوتی بر بقا یا عملکرد اسپرم حامل کروموزوم X یا Y داشته باشد، که می­تواند منجر به تغییر در نسبت جنسیت ­شود (4).

استفاده از اسپرم تعیین جنسیت شده نقش مهمی در صنایع تولیدی حیوانات دارد. دلیل عمده تعیین جنسیت این است که اغلب یک جنس ارزش بیشتری نسبت به جنس دیگر دارد(5). برای دستیابی به این هدف، تکنیک جدا­سازی اسپرم حامل کروموزوم  X(ماده) و Y (نر) به‏طور مناسب توسعه یافته است و این کار در چند کشور تجاری برای گاو استفاده می­شود. این تکنیک به جریان فلوسایتومتری بر اساس دوام اسپرم حامل کروموزوم X و Y و تفاوت در DNA متکی است و دقت آن بیش از 90 درصد است (6). این روش تاکنون برای بهبود در زمینه ارزیابی سلول­های اسپرم قابل قبول بوده است اما گران بوده و به‏دست دامداران کوچک قابل انجام نیست. علاوه‏براین، بعضی از محققان باور دارند که در طول جداسازی اسپرم تابش اشعه در میان سلول­های اسپرم موجب خسارت به DNA شده و می­تواند موجب بروز جهش در ژنوم شود (7). با توجه به ضعف­های بیولوژیکی و اقتصادی فلوسایتومتری، تلاش برای ایجاد روش­های متداول برای تشخیص اسپرم بر اساس تراکم و تحرک اسپرم­های حامل کروموزوم X و Yصورت گرفته است (8). امروزه استفاده از روشreal time qPCR ، برای ارزیابی نسبت جنسیت اسپرم­های منی پیشنهاد شده است، با استفاده از این تکنیک می­توان نسبت جنسیت را به‏طور آسان­تر و با دقت 99 درصد ارزیابی کرد (9). کروموزوم Y حاوی ژن­هایی است که در تعیین جنسیت جنین در حیوانات اهلی مؤثرند. SRY یکی از ژن­های موثر در تعیین جنسیت است (10). بیان ژن SRY که متصل به کروموزوم Y است سبب تمایز سلول­های سرتولی از سلول­های پیش­ساز و در نهایت تشکیل بیضه می­شود (11). جهت شناسایی کروموزوم X از ژن PLP استفاده می­شود این ژن مسئول تولید پروتئولیپید پروتئین بر روی کروموزوم X می­باشد در تمام بافت­های عصبی و غیر عصبی بیان می­شود (12).

پژوهش حاضر به­منظور بررسی استفاده از سطوح مختلف لسیتین سویا در رقیق­کننده تریس بر کیفیت منی و نسبت جنسیت با استفاده از تکنیک real- time qPCR اجرا شد.

 

مواد و روش‌ها

تمامی مواد مورد استفاده در استخراج DNA از اسپرم­ها از شرکت Merck آلمان تهیه شدند، به­منظور انجام واکنش real-time qPCR از کیت تجاری Amplicon (Cat. NO: 5000830-1250) استفاده شد.

جهت انجام پژوهش حاضر، نمونه­گیری در مرکز تولید مواد ژنتیکی دام و طیور خوزستان، واقع در شهر ملاثانی در 37 کیلومتری شمال شرقی اهواز انجام گرفت. مراحل مربوط به استخراج DNA و سایر مراحل آزمایشگاهی، در آزمایشگاه دانشگاه کشاورزی و منابع طبیعی خوزستان انجام شد.

نمونه­گیری: نمونه­گیری از چهار گاو بالغ نر نژاد هلشتاین در سن چهار سالگی به­مدت چهار هفته، و یک‏بار در هر هفته با استفاده از مهبل مصنوعی انجام شد. بی‏درنگ پس از جمع­آوری منی و انتقال آن به آزمایشگاه بررسی­های ابتدایی روی منی اجرا شد. تحرک اسپرم­ها با استفاده از میکروسکوپ نوری، در دمای 37 درجه سانتی­گراد اندازه­گیری و نمونه­های دارای بیشتر از 70 درصد تحرک به­عنوان منی بهینه در نظر گرفته شد. پس از اطمینان از سالم بودن نمونه­ها، منی جمع­آوری شده از چهار گاو نر با هدف از میان برداشتن تاثیرات فردی با یک‏دیگر آمیخته شدند (13).

رقیق­سازی: نمونه­های منی به 3 بخش مساوی تقسیم شدند، به‏هرکدام از بخش­های جداشده به‏ترتیب رقیقکننده تریس حاوی تریس (25/30 گرم در لیتر)، اسید سیتریک (17 گرم در لیتر) و فروکتوز (5/12 گرم در لیتر) و پنی‏سیلین 100000 واحد بین‏المللی، استرپتو مایسین 100 میلی‏گرم، آب مقطر تا حجم 100 میل‏ لیتر) و به اضافه لسیتین 1 درصد و لسیتین 2 درصد به‏صورت جداگانه افزوده شد (14).

ارزیابی نمونه­ها:pH نمونه­های منی و فراسنجه­های کیفی اسپرم نظیر تحرک، ناهنجاری، زنده‏مانی و سلامت غشا در طی دو مرحله قبل و بعد از رقیق­سازی بررسی شدند. درصد ناهنجاری­های مورفولوژیکی اسپرم با لام‏های رنگ­آمیزی­شده با ائوزین و نیگروزین بررسی شد. تحت بزگنمایی 1000× میکروسکوپ حداقل 200 اسپرم زنده در میدان­های میکروسکوپی مختلف در هر نمونه مورد ارزیابی قرار گرفته و سپس میزان اسپرم­های ناهنجار مشاهده شده بر حسب درصد بیان گردید. برای ارزیابی مورفولوژی اسپرم نقایصی چون سر جدا شده، قطره سیتوپلاسمی دور، دم پیچ‏خورده، سر باریک و سر بزرگ مد نظر قرار گرفت. سپس تخمین درصد اسپرم‏های زنده و مرده بعد از رنگ­آمیزی با ائوزین و نیگروزین انجام شد. در این روش، اسپرم­های مرده، رنگ ائوزین را به خود جذب می­کنند، ولی اسپرم­های زنده رنگ نمی­گیرند. برای ارزیابی نمونه ده میکرولیتر اسپرم بر روی یک لام گرم تمیز قرار داده شد. لام­ها پس از رنگ‏آمیزی، زیر میکروسکوپ با بزرگ‏نمایی 1000× ارزیابی شدند. از هر نمونه 200 اسپرم شمارش و درصد اسپرم­های رنگ­شده (مرده) و رنگ ­نشده (زنده) محاسبه شد (15).

فعالیت غشای پلاسمایی اسپرم، به­وسیله آزمایش تورم هایپواسموتیک بررسی شد. مقدار 30 میکرولیتر نمونه منی با 300 میکرولیتر محیط هایپواسموتیک، مخلوط و سپس 30 دقیقه در دمای 37 درجه سانتی­گراد انکوبه شد. سپس 10 میکرولیتر از مخلوط را روی لام ریخته و پس از تهیه گسترش روی لام و خشک شدن آن، در زیر میکروسکوپ نوری با بزرگنمایی 400× بررسی شدند. از هر لام، تعداد 200 اسپرم شمارش شد. اسپرم­های با دم گره­خورده و متورم به­عنوان اسپرم­های با غشای پلاسمایی سالم در نظر گرفته­شده و اسپرم­های با دم صاف به­عنوان اسپرم با غشای آسیب­دیده تعیین شدند.

جداسازی اسپرم­ها: در این تحقیق به منظور شستشوی منی و حذف سلول­های مرده و سایر مواد اضافی منی در مرحله قبل و بعد رقیق­سازی، ازتکنیک شنا به‏سمت بالا (Swim up) استفاده شد (16).

استخراج و تعیین کیفیت DNA: جهت استخراج DNA از اسپرماتوزوئیدهای زنده جداسازی شده با تکنیک Swim up، از پروتکل استخراج نمکی استفاده شد (17) و نیز جهت تعیین غلظت و خلوص DNA از دستگاه نانودراپ (Thermo Scientific) و ژل آگارز 1 درصد استفاده گردید.

طراحی آغازگرها:پرایمرهای اختصاصی برای ژن­های مورد نظر روی کروموزوم Y و X مشخص شدند. ژن SRY به‏عنوان ژن نرزایی روی کروموزوم Y با طول قطعه 89 جفت باز و با شماره بانک ژنی AJ009913-1 انتخاب شد. همچنینژن PLP به‏عنوان ژن ماده­زایی با طول قطعه 90 جفت بازو با شماره بانک ژنی EU581861-1 انتخاب شد. از ژن گیرنده پروتئیناز فعال(PAR) به‏عنوان ژن مرجع استفاده شد. این ژن با طول قطعه 79 جفت باز و شماره بانک ژنی AC234910-2 مورد استفاده قرار گرفت. به‏منظور تایید تکثیر اختصاصی ژن­های مورد نظر در این مطالعه با استفاده از پرایمرهای طراحی­شده ابتدا واکنشPCR  انجام شد. در صورت تکثیر ژن­های مورد نظر با استفاده از پرایمرهای مشخص شده، به‏منظور بررسی مقایسه­ای بیان ژن­ها از تکنیک real-time qPCR استفاده شد. لیست پرایمرهای مورد استفاده در این مطالعه از روش خلقی و همکاران (18) گرفته شد؛ توالی، طول قطعه­ و نیز دمای اتصال هر پرایمر درجدول1 آمده است.

 

 

جدول 1: آغازگرهای مورد استفاده در واکنش Real-Time qPCR

ژن

آغازگرها

طول محصول(جفت باز)

دمای اتصال(درجه سانتی­گراد)

SRY

 

 

F:5´CTCAGACATCAGCAAGCAGC3´

R:5´-GTAGTCTCTGTGCCTCCTCA-3´

89

 

60

PLP

 

 

F:5´GAGGGAGGGTGGATCATAGA3´

R:5´:CCTCTGGGACCTTCAACAAT3´

90

 

60

 

PAR

 

 

F:5´-GCCATCACATCTGAGACCAC-3´

R:5´-GACTCAGCATCTCGAAGCAA-3´

79

 

60

 

 

 

واکنش real- time qPCR:طی این مرحله، واکنش زنجیره­ای پلیمراز پیشرفته برای نمونه­های DNA حاصل از اسپرماتوزوئید با 2 تکرار آزمایشی برای ژن­های PLP، SRY و PAR با استفاده از دستگاه (Step one Plusreal time PCR System، کشور آمریکا) در حجم نهایی 25 میکرولیتردر پلت­های مجزا انجام شد. جدول 2 مراحل انجام واکنش­های زنجیره­ای پلیمراز را نشان می‏دهد.

 

 

جدول 2: چرخه دمایی مورد استفاده در واکنش real-time qPCR

مراحل

تعداد چرخه­ها

 

دما

زمان

مرحله اول

1

واسرشت سازی اولیه

95

15دقیقه

مرحله دوم

40

واسرشت سازی

95

15-30ثانیه

 

 

اتصال پرایمر

60

30ثانیه

 

مرحله سوم

 

 

بسط

(رسم منحنی دمای ذوب)

72

95-70

 

30ثانیه

10 ثانیه

 

 

 آنالیز آماری

جهت تجزیه و تحلیل داده­های حاصل از real- time PCR ابتدا با استفاده از نرم­افزار Step-one ABI، یک گزارش از کلیه اطلاعات موجود به­صورت فایل Word (نسخه 2013) استخراج شده و سپس به نرم‏افزار Excel (نسخه 2013) انتقال داده شد. برای بررسی و تحلیل مراحل فوق مقادیر مربوط به چرخه آستانه (CT) حاصل از تکرارهای بیولوژیکی و تکنیکی هر نمونه وارد نرم­افزار Excel  شد. به‏منظور محاسبه درصد نسبی ژن PLP و SRY در اسپرماتوزوئیدهای جمع­آوری شده، میانگین CT برای تکرارهای تکنیکی محاسبه شد و پس از تعیین میزان ∆∆CT برای تمامی نمونه­ها، تفاوت نسبی نمونه مورد آزمایش در مقابل نمونه کنترل با فرمول: -ΔΔCT2 انجام گردید (19). بررسی آماری داده‌ها توسط نرم افزار SAS (نسخه 4/9) و آزمون t-test انجام شد.

 

نتایج

نتایج اثر تکنیک Swim up و افزودن سطوح مختلف لسیتین سویا (1 درصد و 2 درصد) در منی بر فراسنجه های کیفی اسپرم به حالت مایع مانند تحرک، زنده مانی، سلامت غشا و ناهنجاری و PH در جدول 3 ارائه شده است. نتایج به‏دست آمده نشان داد که تحرک اسپرم، زنده­مانی و سلامت غشا تحت تاثیر تکنیک Swim up و سطوح مختلف لسیتین سویا قرار گرفته و در مقایسه با گروه شاهد افزایش معنی­داری را نشان دادند (05/0p<) و تکنیک Swim up منجر به کاهش معنی­دار ناهنجاری در نمونه­های مورد آزمایش نسبت به گروه شاهد گردیده است (05/0p<). با توجه به نتایج ارائه شده، pH منی در همه رقیق­کننده­های استفاده شده نسبت به گروه شاهد اثر معنی­داری را نشان نمی­دهد.

 

 

جدول 3: اثر سطوح مختلف لسیتین سویا بر فراسنجه­های کیفی اسپرم  در حالت مایع

 

تحرک (درصد)

زنده­مانی (درصد)

سلامت غشاء(درصد)

ناهنجاری (درصد)

pH

 

منی تازه1

c1/1±25/72

 

c16/2±84

c1/1±25/74

abc47/0±75/4

01/0±96/6

Swim up

b7/1±25/79

ab47/1±92

a37/1±75/86

d47/0±5/2

0006/0±97/6

لسیتین 1

ab32/1±5/81

ab44/1±75/90

b75/0±25/79

ab47/0±25/5

0007/0±95/6

لسیتین 2

a31/1±75/84

a43/1±75/92

a49/1±25/91

bcd4/0±4

0006/0±95/6

a-c در هر ستون، میانگین­های با حروف نامشابه اختلاف آماری معنی­داری دارند (05/0>P).

1. منی رقیق­شده با محیط پایه تریس بدون زرده تخم­مرغ بعنوان شاهد در نظر گرفته شده است.

 

 

تکثیر ژن­های SRY، PLP و PAR  در شکل 1 نشان داده شده­است که تکثیر مناسب هر سه ژن را تایید نمود.

جدول 4 نتایج اثر تکنیک Swim up و افزودن سطوح مختلف لسیتین سویا (1 و 2 درصد) به رقیق­کننده تریس بر بیان ژن SRY و PLP نشان می­دهد. این نتایج نشان می­دهد که تکنیک Swim up منجر به افزایش معنی­دار ژن SRY و کاهش معنی­دار ژن  PLPنسبت به شاهد شده است (05/0p<) و استفاده از سطوح مختلف لسیتین سویا در رقیق­کننده تریس اثر معنی­داری بر نسبت جنسیت اسپرم نسبت به تیمار شاهد نداشت.

 

شکل 1: نتیجه الکتروفورز محصولات واکنش زنجیره­ای پلیمراز بر روی ژل آگارز دو درصد


جدول 4: اثر سطوح مختلف لسیتین سویا بر بیان ژنSRY و  PLP(خطای استاندارد ± میانگین)

 

SRY

PLP

شاهد

*b1

*a1

Swim up

a13/0±37/1

b11/0±75/0

تریس-لسیتین 1درصد

b12/0±94/0

a07/0±96/0

تریس- لسیتین 2درصد

b 07/0±92/0

a07/0±97/0

* Arbitrray unit (AU)به‏طور اختیاری بیان ژن شاهد عدد 1در نظر گرفته می­شود (20)

 


بحث

نتیجه گزارش‏های مختلف نشان می‏دهد که لسیتین سویا می‏تواند جایگزین مناسبی برای پروتئین زرده تخم مرغ باشد که بررسی­های مختلف با نتایج متفاوتی بر روی آن انجام شده است. اما مطالعات در مورد اسپرم انسان و اثرات پروتئین زرده تخم­مرغ و لسیتین سویا بر کیفیت اسپرم، سلامت DNA و توانایی اسپرم در اتصال به اسید هیالورونیک نشان دادند که اختلافی بین زرده تخم­مرغ و لسیتین سویا در حفاظت اسپرم وجود ندارد (21). سویا حاوی مقدار بالایی از فسفولیپیدهای شبیه زرده تخم­مرغ است. لسیتین در حدود 10 درصد از فسفولیپیدهای زرده را تشکیل می­دهد و با توجه به‏حضور فسفولیپیدهای مشابه زرده در سویا می­توان از آن به‏عنوان یک جایگزین گیاهی مناسب استفاده نمود (22). البته علاوه بر ویژگیهای ذکر شده ویژگی امولسیون­کننده لسیتین نیز می­تواند رقیق­کننده یکنواختی ایجاد کند که باعث میشود تاثیر محافظتی بهتری در سطح مولکولی برای غشا اسپرم ایجاد شود (23).

محققان با بررسی تاثیر رقیق­کننده سویا بر فراسنجه­های گاو هلشتاین در شرایط مایع گزارش کردند که زنده­مانی، تحرک و سلامت غشای پلاسمایی اسپرم در رقیق­کننده سویا همانند زرده تخم­مرغ بوده و می­تواند جایگزین مناسبی برای زرده تخم­مرغ برای مایع منی گاو در  ذخیره­سازی در شرایط مایع باشد (24). از دلایل افزایش تحرک در استفاده از لسیتین سویا می­توان به غلظت بهینه لسیتین با ویسکوزیته و فشار اسمزی مناسب و همچنین ذرات ریز باقی­مانده کمتر باشد (25). یک‏پارچگی غشا اسپرم به‏دلیل تاثیر فسفولیپیدهای موجود در لسیتین سویا باشد که با ایجاد یک لایه محافظتی در سطح غشا باعث جلوگیری از آسیب­های مکانیکی به غشا باشد (26). پژوهشگران در طی آزمایشی روی رقیق­کننده­های مایع منی گاو گزارش کردند که استفاده از سطوح پایین­تر لسیتین در مقایسه با سطح بالاتر آن باعث کاهش تحرک اسپرم شد که آن‏را به‏قدرت حفاظتی پایین سطوح کمتر لسیتین مرتبط ساختند (27). به­طورکلی توانایی حرکت اسپرم در رقیق­کننده حاوی لسیتین، نسبت به رقیق­کننده­های حاوی منابع حیوانی که ویسکوزیته بیشتری دارند بهتر است، تاکنون سازوکارهای مولکولی علت تاثیر بهتر لسیتین بر جنبایی اسپرم مشخص نشده­است اما گمان می­رود که تغییر ساختار لیپیدی غشا اسپرم و تاثیرگذاری آن بر روانی غشا از دلایل آن باشد (28). البته علاوه بر ویژگی­های ذکر شده ویژگی­های امولسیون­کننده­ی لسیتین می­تواند رقیق­کننده‏ی یکنواختی ایجاد کند که باعث می­شود تاثیر محافظتی یکنواخت بهتری در سطح مولکولی برای غشا اسپرم ایجاد شود (23).

در تئوری شتلز چنین ذکر شده است که اسپرم Y نسبت به اسپرم X سریع­تر است و علت آن­را سر کوچک­تر اسپرم Yنسبت به اسپرم X عنوان کردند (29). اسپرم حامل کروموزوم X حاوی DNA بیشتری نسبت به اسپرم حامل کروموزوم Y است که منجر به مهاجرت کند­تر می­شود و سرعت حرکت اسپرم حامل کروموزوم Y بیشتر از اسپرم حامل کروموزوم X است، اسپرم حامل کروموزوم Y دارای 4 درصد DNA کمتری نسبت به اسپرم حامل کروموزوم X است پس سریع­تر شنا می­کند (30). روش شنا کردن اسپرم، نمونه را به دو قسمت­ حرکتی و غیر حرکتی تقسیم می­کند. پس با توجه به این بیان می‏توان گفت که Swim up منجر به جداسازی اسپرم­های زنده با تحرک بالاتر از اسپرم های مرده یا اسپرم­های با تحرک پایین­تر می­شود. جداسازی اسپرم از اهمیت بالایی برخوردار است. اسپرم حامل کروموزوم X بزرگ­تر و بلندتر از اسپرم حامل کروموزومY است و اسپرم حامل کروموزوم X، DNA بیشتری نسبت به اسپرم حامل کروموزوم Y دارد (31). پس از شنا کردن، سرعت و درصد سلول­های حرکتی به‏طور معنی­داری افزایش پیدا می­کند. تکنیک Swim up، اسپرم با حرکت سریع­تر را انتخاب می­کند (32). با توجه به این‏که اسپرم­های حامل کروموزوم X و Y گاو نر با سرعت­های مختلف شنا می­کنند و دارای فرصت­های مختلف برای لقاح هستند. در طی آزمایشات محققان این نتایج به‏دست آمد که شنا کردن با استفاده از ستون عمودی موجب تولید مخزن غنی از اسپرم حامل کروموزم Y شده که قادر به باروری تخمک­ها و تولید جنین­هایی با درصد بالاتر جنس نر میشود (8).

طبق نتایج ارائه ­شده برای رقیق­کننده­های حاوی سطوح مختلف لسیتین سویا نشان داده­ شده­است که این    رقیق­کننده­ها اثرات مشابهی روی زنده­مانی و دوام سلول­های اسپرم­ حامل کروموزوم X و Y داشته به‏گونه­ای که استفاده از این رقیق‏کننده­ها، اثر معنی­داری در نسبت جنسیت اسپرم ایجاد نکرده است. ازآن‏جاکه استفاده از رقیق­کننده تریس- لسیتین سویا تغییری در نسبت جنسیت ایجاد نکرده است، دو فرضیه ارائه می­گردد، فرضیه اول این‏که ترکیبات مشترک دو رقیق­کننده استفاده­ شده، حساسیت یکسان سلول­های اسپرم­ حامل کروموزومX  و Y نسبت به محیط رقیق­کننده­ها را نشان می­دهد به­گونه­ای که اگر مرگ و میر و آسیب DNA، در نمونه­ها رخ داده درصد برابری از اسپرماتوزوئیدهای حامل کروموزوم X وY را از بین برده است، فرضیه دیگر اثر محافظتی بالای دو رقیق­کننده است که منجر به حفظ اسپرماتوزوئیدها و نیز نسبت جنسیت نمونه­ها شده است.

یکی از فاکتورهای ضروری جهت لقاح و باروری، سلامت DNA اسپرم است که هرگونه عوامل آندوژنی و اگزوژنی می‏تواند منجر به آسیب آن گردد و سلامت جنین را به مخاطره بیندازد، از مهم‏ترین عوامل آسیب DNA اسپرم که در اکثر انواع ناباروری­های مردان تاثیرات مضری دارد می­توان به افزایش سطح استرس اکسیداتیو اشاره نمود (33). دو عامل می‏تواند اساس منشا آسیب DNA اسپرم باشد: یکی از این عوامل در طی فرایند اسپرمیوژنز، نقص در پروتامین منجر به بسته­بندی ضعیف کروماتین و ایجاد یک وضعیت آسیب­پذیری در اسپرم می­گردد و دیگری هنگامی­که اسپرم از طریق منابع مختلف  از جمله قرار گرفتن در معرض ROS برون­زاد یا ROS درون­زاد موجب فعال شدن آبشار آپوپتوز ذاتی و در نهایت آسیب اکسیداتیو DNA می­شود (34).

محققان بر این باورند که اسپرم بالغ به‏علت دارا بودن مقدار سیتوپلاسم محدود و سطح آنتی­اکسیدانت پایین نسبت به سایر سلول­ها و همچنین سطوح بالای اسیدهای چرب اشباع­ نشده در ساختار غشا خود، نسبت به سایر سلول­ها، به استرس اکسیداتیو حساس­تر است (35). در سطوح بالای استرس اکسیداتیو، کروماتین اسپرم شروع به قطعه­قطعه شدن می­کند که این موضوع تاثیرات عمده­ای را بر سلامت نسل­های آینده اعمال می­کند (36)، در سطوح بالای استرس اکسیداتیو، کروماتین اسپرم شروع به قطعه قطعه شدن می­کند و در نهایت آسیب DNA اسپرم را به‏همراه دارد که این موضوع می­تواند بر میزان تخریب تلومرها کمک کند و باعث کوتاه­شدگی طول تلومر در رده سلول­های زایا گردد (37).

منشا استرس اکسیداتیو اسپرم، میتوکندری است که تمایل به تولید سطوح بالای آنیون سوپراکسید دارد که منجر به شروع آبشار آپوپتوزی می­گردد، البته تفاوت بین سلول­های اسپرم با سایر سلول­ها در این راستا وجود دارد (38). از طرف دیگر، به‏نظر می­رسد لسیتین باعث تخریب میتوکندری و کاهش انرژی در دسترس اسپرم برای جنبایی از طریق کاهش میزان کاردیولیپین و نهایتا تخریب غشا میتوکندری شده­ باشد (39).

نتایج مطالعات گسترده بیانگر خطر بالای انتقال بیماری‏های بین­گونه­ای و درون­گونه­ای در استفاده از رقیق­کننده­های با منشا گیاهی توسط کشورهای اروپایی به بازار مصرف عرضه شده که فرمول آن­ها ناشناخته است. با توجه به هزینه نسبتا بالای خرید این رقیق­کننده­ها لازم است که جهت ساخت رقیق­کننده کارآمد با بهره­گیری از نگهدارنده­های با منشا گیاهی در داخل کشور اقدام شود. لسیتین سویا یک جایگزین مناسب برای منابع حیوانی بوده و موجب بهبود کیفیت منی می­شود.

 

نتیجه­گیری

نتایج پژوهش حاضر نشان داد ­که، لسیتین سویا منجر به بهبود فراسنجه­های کیفی منی و عدم تغییر در نسبت اسپرماتوزوئیدهای حامل کروموزوم X و Y شده است با در نظر گرفتن محدودیت­های موجود در استفاده از منابع حیوانی در رقیق­کننده­ها، استفاده از لسیتین سویا به‏عنوان یک منبع گیاهی پیشنهاد می‏شود.

1. Hopkins BK, Herr C, Sheppard W. S. Sequential generations of honey bee (Apis mellifera) queens produced using cryopreserved semen. Reproduction, Fertility and Development. 2012; 24(8): 1079-1083.‏

2. Gil J, Lundeheim N, Söderquist L, Rodrı́guez-Martı́nez H. Influence of extender, temperature, and addition of glycerol on post-thaw sperm parameters in ram semen. Theriogenology. 2003; 59(5-6): 1241-1255.‏

3. Hu JH, Li QW, Jiang ZL, Li WY. Effects of different extenders on DNA integrity of boar spermatozoa following freezing–thawing. Cryobiology. 2008; 57(3): 257-262.‏

4. Gillan L, Evans G, Maxwell WMC. Capacitation status and fertility of fresh and frozen–thawed ram spermatozoa. Reprod Fertil Dev. 1997; 9(5): 481-488.‏

5. Sullivan KM, Mannucci A, Kimpton CP, Gill P. A rapid and quantitative DNA sex test: fluorescence-based PCR analysis of XY homologous gene amelogenin. Biotechniques. 1993; 15(4): 636-8.

6. Morrell JM, Keeler KD, Noakes DE, Mackenzie NM, et. Sexing of sperm by flow cytometry. Vet Rec. 1988; 122(14): 322-324.

7. Song M, Zhang R, Wang X. Nano-titanium dioxide enhanced biosensing of the interaction of dacarbazine with DNA and DNA bases. Mater lett. 2006; 60(17): 2143-2147.

8. Azizeddin A, Ashkar FA, King WA. Revay T. Enrichment of Y‐Chromosome‐Bearing Bull Spermatozoa by Swim‐up Through a Column. Reprod Domest Anim. 2014; 49(1): e1-e4.‏

9. Delgado PA, Lester TD, Rorie RW. Variation in the Ratio of X-to Y-Chromosome Bearing Spermatozoa in Ejaculates of Semen Collected Weekly from Beef Bulls. Animal Science. 2010; 28-30.

10. Said L, Banni M, Kerkeni A, Said K, et al. Influence of combined treatment whit zinc and selenium on cadmium induced testicular pathophysiology in rat. Food Chem Toxicol. 2010; 48(10): 2759-65.

11. Baarske LA, Capel B. B luring the edge in vertebrate sex determination. Curr Opin Genet Dev. 2008; 18(6): 499-505.

 

12. Sharawy SM, Saleh NH, Attalah SA, Absy GM, et al. Effect of plant extract of Tribulusterrestris and probiotics on the reproductive performance, total cholesterol and testosterone hormone levels of rams. MENASJ. 2015; 1(1): 14-19.

13. Gil J, Lundeheim N, Söderquist L, Rodrı́guez-Martı́nez H. Influence of extender, temperature, and addition of glycerol on post-thaw sperm parameters in ram semen. Theriogenology. 2003; 59(5-6): 1241-1255.‏

14. Mousavi SM, Tohidi A, Zhandi M, Mohammadi Sang Cheshmeh A, et al. Effect of osmolarity and glycerol different levels in spybean lecithin-based external on boving sperm quality after cryopresevation. J Anim Prod. 2016; 18(3): 593-601.

15. De Graaf  SP, Evans GL, Gillan MM, Guerra WM, et al. The influence ofantioxidant, cholesterol and seminal plasma on the in vitro quality of sorted and non-sorted ram spermatozoa. Theriogenology. 2007; 67(2): 217-227.

16. Hansen PJ. Alternative Sperm Purification Proce. University of Florida. Animal Science. 2013.

17. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988; 16(3): 12-15.‏

18. Kholghi M, Heidari F, Rostamzadeh J, Razmkabir M. Investigation of the ratio of X and Y chromosomes population in Holstein bulls’ ejaculation and the role of blood testosterone concentration on population ratio. JCMR. 2016; 29(1):72-79.

19. Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002; 30(9): 1-10.

20. Larionov A, Krause A, Miller W. A standard curve based method for relative real time PCR data processing. BMC Bioinform. 2005; 6(62): 1-16.‏

21. Yeste M. Sperm cryopreservation update: Cryodamage, markers, and factors affecting the sperm freezability in pigs. Theriogenology. 2016; 85(1): 47-64.

22. Fukui Y, Kohno H, Togari T, Hiwasa, et al. Fertility after artificial insemination using a soybean-based semen extender in sheep. J Reprod Develop. 2008; 54(4): 286-289.‏

23. Zhang S, Hu J, Li Q, Jiang, Z. et al. The cryoprotective effects of soybean lecithin on boar spermatozoa quality. Afr J Biotechnol. 2009; 8(22): 76-80.

24. Rehman FU, Qureshi MS, Khan RU. Effect of soybean based extenders on sperm parameters of holesteinfriesian bull diuring liquid storage at 4. Pakist J Zool. 2014; 46(1): 185-189.

25. Emamverdi M, Zhandi M, Zare Shahneh A, Sharafi M, et al. Optimization of Ram Semen Cryopreservation Using a Chemically Defined Soybean Lecithin‐Based Extender. Reprod Domest Anim. 2013; 48(6): 899-904.‏

26. Sharafi M, Forouzanfar M, Hosseini SM, Hajian M, et al. In vitro comparison of soybean lecithin based-extender with commercially available extender for ram semen cryopreservation. Int J Fertil Steril. 2009; 3(3): 149-152.

27. Van Wagtendonk-de Leeuw AM, Haring RM, Kaal-Lansbergen LMTE, Den Doas JHG.  Fertility result using bovine semen cryopreserved with extenders based on egg yolk and soyben extract. Theriogenology. 2000; 54(1): 57-67.

28. Johnson LA, Weitze KF, Fiser P, Maxwell WMC. Storage of boar semen. Anim Reprod Sci. 2000; 62(1-3): 143-172.‏

29. Spaulding GF. Sex-associated membrane proteins and methods for increasing the probability that offspring will be of a desired sex. Washington: United States patent; 1995.

30. Yan J, Feng HL, Chen ZJ, Hu J, et al. Influence of swim-up time on the ratio of X-and Y-bearing spermatozoa. Eur J Obstet Gynecol Reprod Biol. 2006; 129(2): 150-154.‏

31. Awan MA, Mehmood A, Sultana T, Shahzad Q, et al. Sperm sexing in Nili-Ravi buffalo through modified swim up: validation using SYBR® green real-time PCR. Anim Reprod Sci. 2017; 182: 69-76.‏

32. Henkel RR, Schill, WB. Sperm preparation for ART. Reprod Biol Endocrinol. 2003; 1(1): 108-130.‏

33. Gharagozloo P, Gutiérrez-Adán A, Champroux A, Noblanc A, et al. A novel antioxidant formulation designed to treat male infertility associated with oxidative stress: promising preclinical evidence from animal models. Hum Reprod. 2016; 31(2): 252-262.‏

34. Nasr-Esfahani MH, Razavi S, Tavalaee M. Failed fertilization after ICSI and spermiogenic defects. Fertil Steril. 2008; 89(4): 892-898.‏

35. Du Plessis SS, Agarwal A, Halabi J, Tvrda E. Contemporary evidence on the physiological role of reactive oxygen species in human sperm function. J assist Reprod Genet. 2015; 32(4): 509-520.‏

36. De Iuliis, GN, Thomson LK, Mitchell LA, Finnie JM, et al. DNA damage in human spermatozoa is highly correlated with the efficiency of chromatin remodeling and the formation of 8-hydroxy-2′-deoxyguanosine, a marker of oxidative stress. Biol Reprod. 2009; 81(3): 517-524.‏

37. Cariati F, Jaroudi S, Alfarawati S, Raberi A, et al. Investigation of sperm telomere length as a potential marker of paternal genome integrity and semen quality. Reprod Biomed online. 2016; 33(3): 404-411.‏

38. Koppers AJ, Mitchell LA, Wang P, Lin M, et al. Phosphoinositide 3-kinase signalling pathway involvement in a truncated apoptotic cascade associated with motility loss and oxidative DNA damage in human spermatozoa. Biochem J. 2011; 436: 687-698.‏

39. Del Valle I, Gómez‐Durán A, Holt W V, Muiño‐Blanco T, et al. Soy lecithin interferes with mitochondrial function in frozen‐thawed ram spermatozoa. J Androl. 2012; 33(4): 717-725.‏‏