بررسی تاثیر نانوذره و بالک اکسید روی بر بیان ژن‌های پراکسیداز و دلتا 1-پرولین-5-کربوکسیلات سنتتاز و فعالیت آنزیم پراکسیداز و محتوای پرولین در گیاه‫چه‌های ازمک

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته، دانشکده علوم و فناوری‌های نوین، گروه بیوتکنولوژی، کرمان، ایران

2 دانشگاه آزاد اسلامی، واحد علوم و تحقیقات، گروه علوم دامی، تهران، ایران

چکیده

هدف: ارزیابی تاثیر نانوذره اکسید روی در مقایسه با اثرات فرم بالک آن بر فعالیت آنزیم پراکسیداز، بیان ژن­ پراکسیداز، محتوای پرولین و بیان ژن آنزیم 1-پرولین-5-کربوکسیلات سنتتاز (P5CS) در گیاهچه­های ازمک.
مواد و روش‏ها: گیاه­چه­های ازمک با سه تکرار مستقل و در قالب طرح کاملاً تصادفی بمدت 7 روز در حضور غلظت‌های مختلف این ذرات رشد کردند، سپس پارامترهای مذکور اندازه­گیری شدند.
نتایج: درحالی‏که فعالیت آنزیم پراکسیداز در تیمار با ذرات نانو و بالک به‫ترتیب در حضور غلظت­های بالاتر از 50 و 100 میلی‫گرم بر لیتر نسبت به نمونه شاهد به‏طور معنی­داری افزایش نشان داد، بیان ژن پراکسیداز در آن‏ها مشابه نمونه شاهد بود. از طرف دیگر، محتوای پرولین گیاهچه‌های تیمار شده، هماهنگ با افزایش غلظت نانو­ذره در محیط در مقایسه با نمونه شاهد به‏طورمعنی­داری افزایش یافت، درحالی‏که تفاوت معنی‏داری در بیان ژن P5CS در تیمارهای مختلف نسبت به نمونه شاهد مشاهده نشد. در گیاهچه‫های تیمار شده با فرم بالک، محتوای این اسید­آمینه تا غلظت 100 میلی‏گرم بر لیتر به‏طور معنی­داری افزایش و در غلظت‏های بالاتر از 250 میلی‏گرم بر لیتر به‏صورت معنی­داری نسبت به نمونه شاهد کاهش نشان داد. بیان ژن P5CS درگیاهچه‫­های تیمار شده با فرم بالک نیز تا غلظت 500 میلی‏گرم بر لیتر مشابه نمونه شاهد بود و در حضور بالاترین غلظت این ذره به‏صورت معنی­داری کاهش نشان داد.
نتیجه گیری: از مجموع نتایج چنین به‏نظر می­رسد که نانوذره اکسید روی نسبت به فرم بالک تاثیر کمتری بر پارامترهای ذکر شده داشته است که احتمالا به‏دلیل آزاد شدن کمتر یون روی تحت این شرایط باشد.

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

کاربرد روزافزون نانو ذرات در شاخه‌های مختلف پزشکی و علوم پایه می‌طلبد تا اثرات سمی ممکن آن‌ها علیه سلول‌ها بیشتر مورد بررسی قرار گیرد (1، 2 و 3). نانوذرات به ذراتی با ابعاد کمتر از 100 نانومتر اطلاق میشود و شامل نانو ذرات فلزی و اکسیدی آنها و ... می‌باشند (4). این ذرات با سطح ویژه بالا و واکنش‌پذیری سطحی بالا نه تنها از طریق تماس فیزیکی جذب می‌شوند بلکه می‌توانند با پروتئین‌های زیستی میان­کنش دهند و حتی توسط سلول‌ها جذب گردند (5). اندازه، مهم‌ترین ویژگی نانو ذرات است، به همان میزان که اندازه ذرات کاهش می‌یابد نسبت سطح به حجم آن­ها افزایش و اجازه می‌دهد تا سهم بزرگ‌تری از اتم‌ها یا مولکول‌ها در سطح نسبت به لایه داخلی ماده ظاهر شود (6).
مکانیسم‌های مختلفی برای توجیه اعمال آسیب‌رسان نانو ذرات مطرح می‌شوند که در این میان بالا بردن سطح گونه‌های فعال اکسیژن (ROS) درون سلولی از اهمیت بیشتری برخوردار است. ثابت شده است که ROS­ها از روش‌های مختلفی نظیر آسیب رساندن به DNA، تداخل با مسیر سیگنالینگ سلولی، تغییرات در روند رونویسی ژن‌ها و غیره می‌توانند به سلول‌ها آسیب وارد کنند (7). علاوه بر این، تولید ROS در نتیجه حضور نانو ذرات می‌توانند آسیب‌های جدی و قابل وراثتی را به DNA وارد کند. به عنوان مثال تغییرات شیمیایی در هیستون‌ها و یا دیگر پروتئین‌هایی که در شکل‌دهی ساختار DNA نقش دارند، ساختار مارپیچی DNA را از هم باز می‌کند و DNA را در معرض هر گونه تغییر قرار می‌دهد (8 و 9). 
گیاهان برای مقابله با تنش اکسیداتیو ناشی از تولید ROSها مکانیسم­های آنزیمی و غیر آنزیمی مختلفی استفاده می­کنند. از مهمترین اجزای سیستم آنتی­اکسیدان آنزیمی می­توان به پراکسیدازها (POD) و کاتالاز (CAT) که موجب شکسته شدن هیدروژن پراکسید (H
2
O
2
) در سلول می­شوند و بدین شکل از تجمع­ROS ها در سلول جلوگیری می­کنند (10) و همچنین سوپراکسیددیسموتاز (SOD) که رادیکال‌های سوپراکسید را به اکسیژن و پراکسید هیدروژن کاتالیز می‌کند (11) اشاره نمود. سیستم دفاعی غیر­آنزیمی در گیاهان شامل ترکیبات آنتی‌اکسیدانی مانند ترکیبات فنلی و رنگیزه­ها اشاره نمود که به طور مستقیم و غیر آنزیمی باعث دفع رادیکال‌های آزاد اکسیژن می‌شوند (12).
علاوه بر این، مطالعات قبلی نشان داده است که پرولین به عنوان یک اسمولیت مهم در تعدیل فشار اسمزی سلول تحت تنش‌هایی مانند دمای پایین، کمبود مواد غذایی، قرار گرفتن در معرض فلزات سنگین و اسیدیته بالا نقش اساسی دارد (13). آنزیم کلیدی در مسیر بیوسنتز پرولین در گیاهان آنزیم‌های دلتا- ۱-پرولین ۵-کربوکسیلات سنتتاز(P5CS) است (14 و 15). در واقع P5CS یک آنزیم دوعملکردی است که دو واکنش ابتدایی را در مسیر بیوسنتز پرولین در گیاهان کاتالیز می­کند (16). نقش مثبت پرولین در تعدیل فشار اسمزی نسبت به شوری و خشکی توسط محققین در گیاهان مختلف مانند ذرت (17) ، یونجه (18) و آرابیدوپسیس (19) گزارش شده است.
گیاه ازمک (Lepidium draba) یک علف هرز چندساله با سیستم ریشه عمیق و متعلق به خانواده براسیکاسه است. این گیاه ویژه مناطق گرم و نواحی آفتاب‌گیر است و خاک‌هایی با بافت سنگین و حاصلخیز را ترجیح می‌دهد (20 و 21). ازمک، مشابه سایر گونه­های خانواده براسیکا حاوی گلوکوزینولات­ها می­باشد (22 و 23) که اثرات پیشگری و درمانی آنها و مشتقاتشان بر بیماریهای مختلف ثابت شده است (8، 24 و 25). 
ZnO یکی از پراستفاده‌ترین نانو ذرات است، به طوری که تولید این نانو ذره رتبه سوم را بعد از سیلیکا SiO
2
)) و تیتانیاTiO
2
)) رادارد و در آب نامحلول است (26). این نانو­ذره در صنایع مختلف می‌توانند جانشین ماکرومولکول ZnO شوند وبه طور گسترده در تولید لاستیک، سلول‌های خورشیدی، به عنوان یک جاذب uv در محصولات آرایشی مثل کرم‌های ضد آفتاب و محصولات زیبایی و غیره استفاده می‌شود (27). در این تحقیق، فعالیت آنزیم پراکسیداز و بیان ژن پراکسیداز و همچنین محتوای پرولین و بیان ژن P5CS در گیاهچه­های ازمک تیمار شده با فرم‌ نانوذره و بالک اکسید روی  مورد آنالیز قرار گرفتند.

مواد و روش‌ها

کشت گیاه و تیمار آن‌ها: بذرهای مورد استفاده در این تحقیق از گیاهان رشد یافته در اطراف شهر کرمان در اواخر بهار و اوایل تابستان جمع‌آوری گردیدند. به منظور کشت، ابتدا بذرها با هیپوکلریت سدیم 5/2 درصد (15 دقیقه) و پس از آبکشی با  آب مقطر استریل (چهار مرتبه) در معرض الکل70 درصد (45 ثانیه) قرار داده شدند و سپس آبکشی (چهار مرتبه با آب مقطر استریل) شدند. سپس بذرها در پلیت­های نه سانتی‌متری حاوی محیط کشت MS  (28) (pH برابر 7) که با آگار (8/0 درصد) جامد شده و حاوی فرم­های مختلف اکسید روی (نانو و بالک) بودند قرار گرفتند. غلظت‌های مورد استفاده از فرم نانو­ و بالک اکسید روی شامل غلظت صفر (به عنوان شاهد)، 25، 50، 100، 250، 500 و 1000 میلی‌گرم بر لیتر بود. ابتدا پلیت­ها در دمای 2±28 درجه سانتی‌گراد و رطوبت نسبی 5±55 درصد در انکوباتور و در تاریکی مطلق قرار گرفتند. پس از گذشت دو روز پتری دیش‌ها به ژرمیناتور با دمای 2±25 درجه سانتی‌گراد با رطوبت نسبی 65-60 درصد و دوره نوری 16:8 (تاریکی/ روشنایی) منتقل شدند. پس از گذشت پنج روز گیاهچه جمع‌آوری شدند و بعد از شسته شدن با آب مقطر استریل، اندام‌های هوایی جدا و در داخل فویل آلومینیوم استریل قرار گرفتند. جهت انجماد سریع، بلافاصله فویل­ها در داخل ازت مایع قرار گرفتند و سپس به فریزر 80- درجه سانتی‌گراد منتقل شدند.

آنالیز بیان ژن­های P5CS  و POD:بیان ژن‌های P5CS و POD به این صورت اندازه­گیری شد که ابتدا استخراج RNA کل از گیاهچه‌های تیمار شده انجام و پس از سنتز کتابخانه cDNA و تکثیر ژن­های مذکور در حضور پرایمرهای اختصاصی، میزان بیان آنها به صورت نیمه کمی مورد آنالیز قرار گرفت (29).

استخراجRNA کل: استخراج RNA کل از گیاهچه­ها مطابق دستورالعمل پیشنهادی شرکت سازنده کیت استخراج RNA (RNX-Plus سیناژن) انجام شد. ابتدا مقدار یک گرم از اندام هوایی گیاهچه­های فریز شده در حضور نیتروژن مایع کاملاً ساییده شده تا پودر سفید رنگی حاصل شود. پودر حاصله به میکروتیوب 5/1 میلی­لیتری و فاقد RNase انتقال یافت. سپس یک میلی­لیتر از محلول RNX-plus به پودر مذکور اضافه و میکروتیوب ورتکس شد تا سوسپانسیون کاملاً همگن بدست آید. سوسپانسیون بدست آمده به مدت 60 دقیقه بر روی یخ نگهداری شد. در ادامه،200 میکرولیتر کلروفرم به سوسپانسیون اضافه و میکروتیوب ­­بشدت تکان داده شد و پس ازسانتریفوژ (12000 دور بر دقیقه در دمای 4 درجه سانتی­گراد، به مدت 15 دقیقه) فاز رویی به میکروتیوب جدید منتقل و هم حجم آن ایزوپروپانول به آن اضافه گردید و به مدت 20 دقیقه روی یخ نگهداری شد. یکبار دیگر، سانتریفیوژ با شرایط فوق الذکر تکرار شد و این بار پس از حذف محلول رویی، به رسوب موجود، یک میلی­لیتر اتانول 70 درصد اضافه شد و میکروتیوب­ها با 7500 دور بر دقیقه، به مدت 8 دقیقه در دمای 4 درجه سانتی­گراد سانتریفیوژ شدند. سپس محلول رویی خارج و درب میکروتیوب باز نگه­داشته شد تا باقیمانده الکل در دمای اتاق تبخیر شود. در انتها به رسوب حاصله، 30 میکرولیتر آب Diethylpyrocarbonate (DEPC) (%1/0) اضافه شد و نمونه­ها به فریزر 20- درجه سانتی­گراد انتقال داده شدند.

جهت تعیین کمیت (میزان غلظت) و کیفیت (نسبت میزان RNA به پروتئین) RNA استخراج ‌شده از دو روش اندازه­گیری جذب در طول ‌موج‌  nm۲۶۰ با استفاده از دستگاه اسپکتروفتومتری و الکتروفورز نمونه بر روی ژل آگارز (یک درصد) استفاده شد.

بمنظور حذف DNA ژنومی از RNA تخلیص شده، از کیت DNase I (Fermentas) استفاده شد. بدین منظور در یک میکروتیوب حاوی 4 میکروگرمRNA  استخراج شده، یک میکرولیتر آنزیم DNase و یک میکرولیتر از بافر آن اضافه گردید و حجم نهایی توسط آب DEPC زده به 10 میکرولیتر رسانده شد و به مدت 30 دقیقه در دمای 37 درجه سانتی گراد قرار گرفت. به منظور غیر­فعال­ نمودن آنزیم، یک میکرولیتر EDTA (25 میلی­مولار) به میکروتیوب اضافه شد و به مدت 10 دقیقه در حمام آب گرم با دمای 65 درجه سانتی­گراد قرار گرفت. در نهایت نمونه­ها جهت انجام مراحل بعدی آزمایش به فریزر 20- منتقل شدند.

سنتز کتابخانه cDNA: بدین منظور،  ابتدا مقدار لازم از RNA کل (یک میکروگرم) به پرایمر الیگو dT (یک میکرولیتر) و 5/0 میکرولیتر از مهار کننده RNase  (U/µL40) اضافه گردید و میکروتیوب­ها به مدت 10 دقیقه در دمای 65 درجه سانتی­گراد قرار گرفتند. سپس میکروتیوب­ها به روی یخ منتقل شدند و 5/2 میکرولیتر از بافر (X 10) (RT)Reverse Transcriptase ، 8/0 میکرولیتر از dNTP­ها، 5/0 میکرولیتر از مهار کنندهRNase ، 1 میکرولیتر از آنزیم رونوشت بردار معکوس(RT) (U/µL; MMuLV200) و در نهایت آب دیونیزه استریل فاقد RNase  تا حجم نهایی 25 میکرولیتر به تیوب­ها اضافه گردید. پس از اسپین کردن ویال­ها، در حمام آب گرم 42 درجه سانتی­گراد به مدت یک ساعت قرار گرفتند. در انتهای واکنش به منظور حذف اثر RT، تیوب­ها به مدت 10 دقیقه در دمای 70 درجه سانتی­گراد قرار گرفتند.

تکثیر ژن­ها و اندازه­گیری بیان آنها:

توالی آغازگرهای مربوط به ژن P5CS  بر اساس توالی ثبت شده در سایت NCBI از Arabidopsis thaliana  با شماره دسترسیNM_115419  و توالی آغازگرهای مربوط به ژن POD بر اساس توالی ثبت شده در سایت NCBI از گیاهLepidium draba  با شماره دسترسی  KJ819932 و همچنین توالی آغازگرهای مربوط به ژن کنترل داخلی GAPDH از روی توالی ژن این آنزیم در گیاه Armoracia rusticana (جدول 1) با استفاده از نرم افزار Gene Runner طراحی و توسط شرکتMWG  ساخته شدند. واکنش تکثیر ژن­های مذکور با استفاده از آنزیم Taq پلیمراز و در حضور آغازگرهای اختصاصی برای حجم µl 25 طبق جدول 2 در دستگاه ترموسایکلر  Eppendorfو طبق پروفایل حرارتی در جدول 3 انجام شد. در پایان، الکتروفورز محصولات واکنش روی ژل آگارز یک درصد انجام شد و پس از رنگ آمیزی با اتیدیوم بروماید در زیر نور  UVدر دستگاه  Gel documentationمشاهده شدند.

برای ارزیابی نیمه کمی بیان ژن­های مذکور در غلظت‌های مختلف فرم نانو و بالک ZnO از مقایسه شدت باند تکثیر شده حاصل از بارگذاری پنج میکرولیتر از محصول PCR مربوط به هر نمونه بر روی ژل آگارز یک درصد، نسبت به کنترل داخلی، توسط نرم افزار TotalLap TL120 استفاده شد.

 

 

 

 

 

 

جدول1: توالی آغازگرها.

GC (%)

Tm (C˚)

توالی آغازگرها

نام آغازگر

45.4

60.3

5´- AAGAAAGCTGGTATGATCCCTC -3´

F-GAPDH

50

58.4

5´-TACCTTAACCGCAGTGCATC-3´

R-GAPDH

50

60.3

5´- CTTGTTCAGATAGCTTCGCTTG -3´

F-P5CS

50

65.3

5´-TTATTCCCACCTCAGCACCAAGTC -3´

R-P5CS

41.7

59.6

5ˊ-TGGACAGGTTATACGACTTTAGCAACACTGGTTTAC -3ˊ

F-POD

77.6

59.6

5ˊ- TCTATAAGCTTTTAAGAGTTAGTTCACCACCCTACA - 3ˊ

R-POD

 

جدول 2: مقدار و مواد مورد استفاده در واکنش .PCR

مقدار در 25 میکرو لیتر

غلظت محلول پایه

محلول پایه

2.5

10 X

PCR Buffer

1.5

50 mM

Mgcl2

0.6

10 mM

dNTPmix

0.6

10 pmol/µl

Forward Primer

0.6

10 pmol/µl

Reverse Primer

2

30-40ng/µl

Template

0.5

1Unit/ µl

DNATaq Polymerase

Up to 25

 

Water (ddw)

 

جدول 3:پروفایل حرارتی واکنش PCR.

مراحل PCR

دما (درجه سانتی‌گراد)

زمان (دقیقه)

سیکل

واسرشت سازی اولیه

95

5

1

واسرشت سازی هر چرخه

95

1

 

30

اتصال آغازگر

51

5/0

بسط

72

1

بسط نهایی

72

10

1

 

 

 

 

 

 

 

 

 

 

 

 

 

اندازهگیریمقدارپرولین: برای اندازه‌گیری پرولین از روش Bates  و همکاران استفاده شد (30). بدینمنظور مقدار نیم گرم از برگ گیاهچه‌های ازمک در 51 میلی‌لیتر محلول سه درصد سولفوسالیسیلیک اسید سائیده و عصاره حاصل بهمدت 01 دقیقه با دور g 0004 سانتریفوژ شد. سپس دو میلی‌لیتر از مایع رویی با دو میلی‌لیتر معرف نین هیدرین و دو میلی‌لیتر استیک اسید خالص مخلوط شد و یک ساعت در دمای 001 درجه سانتی‌گراد  در حمام آبگرم قرار گرفت. سپس بلافاصله لوله‌های محتوی مخلوط در حمام یخ سرد شد. در ادامه، چهار میلی‌لیتر تولوئن به مخلوط اضافه شد و لوله‌ها بهخوبی تکان داده شد. با ثابت نگه‌داشتن لوله‌ها به مدت 51 تا 02 ثانیه دو لایه مجزا تشکیل شد. میزان جذب لایه‌ رنگی فوقانی که حاوی پرولین بود در 025 نانومتر اندازه­گیری شد. جهت محاسبه‌ مقدار پرولین از منحنی استاندارد پرولین استفاده گردید و نتایج بر حسب میلی‌گرم بر گرم وزن­تر گزارش شد.

سنجش فعالیت پراکسیداز: عصاره­گیری آنزیمی و سنجش محتوای پروتئین محلول کل عصاره­گیری پروتئین­های محلول از گیاهچه­ها به این صورت انجام شد که مقدار 500 میلی­گرم از اندام هوایی (بافت فریز شده) در بافر فسفات پتاسیم mM  50 (5/7 pH) حاوی 1 درصد پلی وینیل پیرولیدین (PVP)، یک میلی­مولار EDTA و یک میلی­مولار PMSF ساییده شد. سوسپانسیون بدست آمده به مدت 20 دقیقه با دور rpm 9000 در دمای 4 درجه سانتی­گراد سانتریفیوژ شد (29). محلول رویی پس از تعیین غلظت جهت اندازه­گیری فعالیت آنزیم پراکسیداز (POD) مورد استفاده قرار گرفت. غلظت پروتئین استخراج شده توسط روش Bradford  (31) محاسبه گردید. بدین منظور، از سرم آلبومین گاوی (BSA) به عنوان استاندارد استفاده شد و میزان جذب نمونه­ها در طول موج nm 595 اندازه­گیری شد.

سنجش فعالیت آنزیم پراکسیداز: فعالیت آنزیم پراکسیداز (POD; EC.1.11.1.7 ) با استفاده از روش Plewa و همکاران سنجیده شد. در روش مذکور میزان جذب تتراگایاکل تشکیل شده از گایاکل در نتیجه فعالیت پراکسیداز در مدت زمان 3 دقیقه و طول موج 470 نانومتر محاسبه شد. مخلوط واکنش شامل بافر فسفات پتاسیمMm 50 با pH برابر 5/7، گایاکل 4 درصد و یک درصد H2O2 و 100 میکرولیتر عصاره پروتئین محلول بود. از ضریب خاموشی تتراگایاکل  25.5 cm-1 mM-1= ε جهت محاسبه فعالیت آنزیم استفاده شد. فعالیت آنزیم بر حسب واحد آنزیمی بر میلی­گرم پروتئین محلول گزارش شد (32).

 

آنالیز آماری

کلیه آزمایشات با سه تکرار مستقل انجام شدند. میانگین داده­ها با استفاده از نرم‌افزار SAS توسط آزمون چند دامنه ای دانکن با در نظر گرفتن سطح اطمینان پنج درصد مورد تجزیه واریانس قرار گرفتند و برای رسم نمودار از نرم‌افزار2010  Excel استفاده شد

نتایج

آنالیز بیان ژن­هایP5CS  و POD

استخراج RNAو سنتز کتابخانه cDNA

کیفیت RNA کل استخراج شده از گیاهچه‌های بر روی ژل آگارز یک درصد بررسی گردید. همانطور که در شکل 1 مشاهده می‌گردد دو باند S28 و S18 مربوط بهRNA  ریبوزومی به وضوح برای تمامی نمونه‌ها قابل مشاهده است که نشان دهنده کیفیت مناسب RNA استخراج شده می‌باشد. به منظور تکثیر ژن­های مذکور، از RNA استخراج شده با استفاده از پرایمرهای Oligo dT و آنزیم رونوشت بردار معکوس (RT)، کتابخانه cDNA مربوط به هر نمونه ساخته شد.

 

 

 

شکل 1: نمونه‌ای از ژل آگارز یک درصد از RNAهای استخراج‌شده از گیاهچه‌های L. drabaتیمار شده با ZnO. M مارکر وزن مولکولی می­باشد.

 

 

 

بیان ژن  P5CS

تکثیر ژن­های  P5CSو GAPDH با استفاده از cDNA سنتز شده در حضور پرایمرهای اختصاصی و آنزیم Taq پلیمراز صورت گرفت. همانطور که در شکل 2 مشاهده می‌شود طول قطعه تکثیر شده مربوط به ژن P5CS ، bp 757 به دست آمد.

 

نتایج مربوط به تأثیر غلظت‌های مختلف فرم بالک و میزان بیان ژن P5CS در گیاهچه‌های  L. draba تیمار شده با نانو ذره ZnOدر مقایسه با نمونه کنترل تفاوت معنی داری را نشان نداد. همان طور که در شکل 3،  قابل مشاهده است تغییر بیان این ژن در تیمار با فرم بالک ZnOنیز مشابه نمونه شاهد بود و تنها در حضور بالاترین غلظت این ذره نسبت به نمونه شاهد کاهش معنی­دار بیان مشاهده گردید.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 2: نمونه­ای از ژل آگارز مربوط به تکثیر ژن P5CS در حضور غلظت‌های مختلف نانوذره ZnO (الف) و فرم بالک ZnO(ب). M مارکر وزن مولکولی می­باشد.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 3: مقایسه میزان نسبی بیان ژن P5CS در گیاهچه‌های تیمار شده L. draba با غلظت‌های مختلف فرم بالک ZnO. حروف متفاوت بالای نمودارها نشان دهنده معنی داری در سطح پنج درصد است.

 

 

بیان ژن  POD

همانطور که در شکل 4 مشاهده می‌شود طول قطعه تکثیر شده مربوط به ژن POD در ژل یک درصد، bp 367 به دست آمد. غلظت‌های مختلف فرم بالک و نانو ذره ZnO بر میزان بیان ژن POD گیاهچه‌های هفت‌روزه  L. draba تاثیری نداشتند.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 4: نمونه­ای از ژل آگارز مربوط به تکثیر ژن POD در حضور غلظت‌های مختلف نانوذره ZnO (الف) و فرم بالک ZnO (ب). M  مارکر وزن مولکولی می­باشد.

 

 

محتوی پرولین

همان طور که درشکل 5،الف  مشاهده می‌شود محتوای پرولین گیاهچه‌های تیمار شده با غلظت‌های مختلف فرم نانو با افزایش میزان غلظت نانوذره در محیط به طور معنی­داری در مقایسه با نمونه شاهد افزایش یافته است به طوری که محتوی پرولین در غلظت‌ mg/L 1000 این ذره بیش از سه برابر نمونه شاهد می­باشد. بر اساس شکل 5،ب محتوی پرولین گیاهچه‌های تیمار شده با غلظت‌های مختلف فرم بالک تا غلظت  mg/L100 در مقایسه با نمونه شاهد به طور معنی‌داری افزایش یافته است و بالاترین میزان پرولین در حضور غلظت  mg/L100  این ذره مشاهده ­گردید. با افزایش غلظت این ذره در محیط محتوای پرولین کاهش یافت بطوریکه در حضور غلظت‌های mg/L 1000 و 500 کاهش معنی‌داری در سطح پنج درصد با نمونه شاهد مشاهده شد.

 

 

 

 

 

 

شکل 5: محتوای پرولین گیاهچه‌های L. draba تیمار شده با غلظت‌های مختلف نانو ذره ZnO (الف) و فرم بالک ZnO(ب). حرف‌های متفاوت بالای نمودارها سطح معنی‌داری را در سطح پنج درصد نشان می‌دهند.

 

 

فعالیت پراکسیداز

همان­طور که درشکل 6،الف  و ب مشاهده می‌شود فعالیت آنزیم پراکسیداز گیاهچه‌های تیمار شده با غلظت‌های مختلف فرم بالک تا غلظت 50 میلی­گرم بر لیتر تفاوت معنی­داری در سطح 5 درصد نسبت به نمونه شاهد نشان نداد ولی در غلظت­های بالاتر به صورت گرادیان هماهنگ با افزایش غلظت این ذره در محیط به طور معنی­داری در مقایسه با نمونه شاهد افزایش نشان داد. همچنین فعالیت این آنزیم در حضور نانوذره اکسید روی تا غلظت 100 میلی­گرم بر لیتر تفاوت معنی­داری با نمونه شاهد نداشت ولی در غلظت­های بالاتر به صورت گرادیان هماهنگ با افزایش غلظت نانوذره در محیط به طور معنی­داری در مقایسه با نمونه شاهد افزایش نشان داد. فعالیت این آنزیم در حضور بالاترین غلظت فرم بالک نزدیک به 3 برابر و در حضور نانوذره نزدیک به 5/2 برابر نمونه شاهد افزایش یافت

 

 

 

 

 

شکل 6- فعالیت آنزیم پراکسیداز گیاهچه‌های L. draba تیمار شده با غلظت‌های مختلف فرم بالک ZnO (الف) و نانو ذره ZnO(ب). حرف‌های متفاوت بالای نمودار، معنی‌داری را در سطح پنج درصد نشان می‌دهند.

 

 

 

 

 

 

بحث

استفاده روزافزون از نانوذرات در نهایت منجر به رها شدن این مواد به طبیعت می­شود (33 و 34). درحالیکه مطالعات مختلف حاکی از تحت تاثیر قرار گرفتن موجودات زنده پس از در معر ض قرار گرفتن این مواد می­باشد، هنوز مکانیسم اصلی عملکرد نانو ذرات شناخته نشده است (6). مطالعات مختلف در محیط‌های in vitro و in vivo پیشنهاد می‌کنند که آن‌ها قادرند گونه‌های فعال اکسیژن (ROS) را تولید کنند و روی غلظت کلسیم درون سلولی، فعال نمودن فاکتورهای رونویسی و ایجاد تغییر در سیتوکینین‌ها نقش داشته باشند (7). بر حسب میزان تنش، گیاهان ممکن است با تولید متابولیت‌های سازگاری نظیر اسیدآمینه، آنتی‌ اکسیدانت‌های و هورمون‌ها اثرات تنش را خنثی نموده و به رشد خود ادامه دهند (13). در این تحقیق، بمنظور بررسی اثرات نانو ذره اکسید روی بر گیاه ازمک، فعالیت آنزیم پراکسیداز و محتوی پرولین و همچنین بیان ژن­های آنزیم­های POD و P5CS  که در سنتز آنها درگیر هستند در مقایسه با اثرات فرم بالک این ذره مورد آنالیز قرار گرفتند.

همانطور که در نتایج قابل مشاهده است، فعالیت آنزیم پراکسیداز در گیاهچه­های تیمار شده با نانوذره در حضور غلظت­های بالاتر از 100 میلی­گرم بر لیتر و در حضور فرم بالک در غظلت­های بالاتر از 50 میلی­گرم بر لیتر به صورت معنی­داری در مقایسه با نمونه شاهد افزایش یافته است. همچنین در حضور بالاترین غلظت این ذرات بیشترین فعالیت آنزیم در حضور فرم بالک مشاهده گردید (حدود 3 برابر نسبت به شاهد). آنزیم پراکسیداز در گیاهان نقش­های فیزیولوژیکی متعددی دارد و یکی از آنزیم­های کلیدی در جاروب کردن  H2O2 می­باشد (35). افزایش فعالیت آنزیم­های جاروب کننده H2O2 تحت تنش با فلزات سنگین از قبیل آهن و مس و همچنین نانوذرات اکسید آهن و اکسید مس در این گیاه مشاهده شده است (36 و 37). همچنین مطالعات انجام شده بر روی این گیاه نشان داده شده است که فعالیت آنزیم­های کاتالاز (جاروب کننده H2O2) و SOD (جاروب کننده سوپر اکسید) در تیمار با یون روی افزایش می­یابد که با نتایج حاصل از این تحقیق همخوانی دارد (38).

در مقابل با تغییر فعالیت آنزیم پراکسیداز  در تیمار با هر دو ذره، تغییر معنی­داری در بیان ژن آنزیم پراکسیداز در تیمار با هر دو فرم این ذره در مقایسه با نمونه شاهد مشاهده ­نشد. بنابراین بنظر می­رسد که افزایش فعالیت پراکسیداز می­تواند به دلیل پایداری حضور این آنزیم در سلول بوده که می­تواند سبب حذف H2O2 شود و یا به دلیل وجود ایزو­آنزیم­های دیگری از این آنزیم. مطالعات گذشته نشان داده است که در گیاه ترب وحشی (Horseradish) از خانواده براسیکاسه هم­خانواده گیاه ازمک بیش از 15 ایزو­آنزیم وجود دارد (39). بیان ژن آنزیم پراکسیدازی که در این مطالعه مورد بررسی قرار گرفت مربوط به ایزوآنزیم خنثی LDP بوده که اخیراً ژن آن از این گیاه استخراج و در بانک جهانی ژن ثبت شده است و ویژگی­های آن مورد آنالیز قرار گرفته است (40). ثابت شده است که پرولین پایدارترین اسیدآمینه‌ای است که در برابر تنش‌های اکسیداتیو مقاومت کرده و کمترین اثر بازدارندگی را بر رشد سلول‌ها در بین تمام اسیدآمینه‌ها دارد (13) و تولید آن تحت تنش­های مختلف افزایش یافته است (41 و 42). بر اساس نتایج حاصله، تولید پرولین در گیاهچه­های تحت تیمار با هر کدام از فرم نانو و بالک بسته به نوع و غلظت تحت تاثیر قرار گرفته است. نکته قابل توجه در ارتباط با تولید پرولین تحت شرایط تنش با این ذرات این است که در حضور نانوذره، محتوای این اسید آمینه به صورت گرادیان همزمان با افزایش غلظت نانوذره در محیط افزایش می­یابد، در حالیکه در حضور فرم بالک تا غلظت 100 میلی­گرم بر لیتر به صورت گرادیان افزایش و در غلظت­های بالاتر، محتوای آن کاهش یافته بطوریکه کاهش معنی­دار آن در حضور غلظت­های 500 و 1000 میلی­گرم بر لیتر قابل مشاهده است. هماهنگ با این نتایج، گزارشات قبلی نیز نشان داده است که برخی ترکیبات آنتی­اکسیدان از قبیل محتوای فلاونوئیدی­ کل  گیاهچه­های ازمک در تیمار با یون روی افزایش یافته است (38).  

همانطور که در نتایج نشان داده شده است، بیان ژن P5CS در تیمار گیاهچه‌های L. draba با غلظت‌های مختلف نانوذره ZnOنسبت به نمونه شاهد تغییر معنی­داری نشان نداد. در حالیکه در تیمار گیاهچه‌ها با غلظت‌های مختلف فرم بالک ZnOبیان این ژن تا غلظت mg/L 100 مشابه نمونه شاهد بود و با افزایش غلظت این ذره در محیط کاهش بیان آن مشاهده شد بطوریکه کاهش معنی­دار آن تنها در بالاترین غلظت این ذره در محیط مشاهده گردید. این نتایج با تغییرات محتوای پرولین گیاهچه­های تیمار شده با فرم بالک این ذره مطابقت دارد. نشان داده شده است که افزایش سطح پرولین، حتی پس از حذف شرایط تنش تا مدتی حدود یک ماه باقی می‌ماند. در واقع تجمع افزایشی پرولین در سلول به دلیل القاء فعالیت آنزیم‌های  P5CSو پرولین۵- کربوکسیلات ردوکتاز (P5CR) در چرخه تولید این ماده و نیز ممانعت از فعالیت آنزیم‌های اکسیدکننده پرولین مانند پرولین دهیدروژناز (ProDH) و پرولین ۵- کربوکسیلات دهیدروژناز (P5CDH) در سلول است (43).

 

نتیجه­گیری

از مجموع نتایج چنین بر می‌آید که هر دو فرم بالک و نانو ذره ZnO بر محتوای پرولین و فعالیت آنزیم پراکسیداز تاثیر داشته­اند. افزایش محتوای پرولین و همچنین فعالیت این آنزیم می­تواند دلیلی بر بروز تنش اکسیداتیو تحت این شرایط باشد. اما فرم بالک در مقایسه با نانو اثر سمیتی بیشتری داشته است که سبب افزایش بیشتر فعالیت آنزیم پراکسیداز و همچنین کاهش محتوای پرولین و بیان ژن P5CS در مقایسه با نمونه شاهد در غلظت­های بالای این ذره شود. این نتیجه احتمالاً به دلیل حضور یون روی و یا آزاد شدن سریعتر یون روی بیشتر در فرم بالک نسبت به نانو بوده است و در نتیجه در حضور فرم بالک در غلظت‌های به‌کاربرده شده ایجاد رادیکال‌های آزاد بیشتر سبب تنش اکسیداتیو می­شود. با این وجود مطالعات بیشتری لازم است تا اثرات فرم نانو و بالک ZnOبر بیان این ژن­ها و همچنین سایر پارامترهای گیاهان اثبات شود.

 

تشکر و قدردانی

این تحقیق با حمایت مالی پژوهشگاه علوم و تکنولوژی پیشرفته و علوم محیطی، دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته با قرارداد شماره 401/95/ص/7 مورخ 26/2/1395 انجام شده است. بنابراین مجری و همکاران مراتب سپاس و قدردانی خود را از آن دانشگاه محترم اعلام می­دارند.

1. Li JJMuralikrishnan SNg CTYung LYet al. Nanoparticle-Induced Pulmonary Toxicity. Exp Biol Med. 2010; 235(9): 1025-1033.

2. Kaur S, Singhal B. When Nano Meets Stem: The Impact Of Nanotechnology In Stem Cell Biology. J Biosci Bioeng. 2012; 113(1): 1-4.

3. Kim JA, Lee N, Kim BH, Rhee WJ, et al. Enhancement Of Neurite Outgrowth In PC12 Cells By Iron Oxide Nanoparticles. Biomaterials. 2011; 32(11): 2871-2877.

4. Roco MC, Bainbridge WS. Societal Implications Of Nanoscience And Nanotechnology: Maximizing Human Benefit. ‎J Nanoparticle Res. 2005; 7(1): 1-13.

5. Badawyame, Luxton TP, Silva RG, Scheckel KG, et al. Impact Of Environmental Conditions (Ph, Ionic Strength, And Electrolyte Type) On The

 

Surface Charge And Aggregation Of Silver Nanoparticles Suspensions. Environ Sci Technol. 2010; 44(4): 1260-1266.

6. Nel A, Xia T, Mädler L, Li N. Toxic Potential Of Materials At The Nanolevel. Science. 2006; 311(5761): 622-627.

7. Buzea C, Pacheco II, Robbie K. Nanomaterials And Nanoparticles: Sources And Toxicity. Biointerphases. 2007; 2(4): 17-71.

8. Singh SV, Warin R, Xiao D, Powolny AA, et al. Sulforaphane Inhibits Prostate Carcinogenesis And Pulmonary Metastasis In TRAMP Mice In Association With Increased Cytotoxicity Of Natural Killer Cells. Cancer Res. 2009; 69: 2117-2125

9. Trouiller B, Reliene R, Westbrook A, Solaimani P, et al. Titanium Dioxide Nanoparticles Induce DNA Damage And Genetic Instability In Vivo In Mice. Cancer Res. 2009; 69(22): 8784-8789.

10. Fang WC, Kao CH. Enhanced Peroxidase Activity In Rice Leaves In Response To Excess Iron, Copper And Zinc. Plant Sci. 2000; 158(1): 71-76.

11. Dong B, Sang WL, Jiang X, Zhou JM, et al. Effects Of Aluminum On Physiological Metabolism And Antioxidant System Of Wheat (Triticum Aestivum L). Chemosphere. 2002; 47: 87-92.

12. Foyer CH, Noctor G. Ascorbate And Glutathione: The Heart Of The Redox Hub. Plant Physiol. 2011; 155(1): 2-18.

13. Delauney AJ, Verma DPS. Proline Biosynthesis And Osmoregulation In Plants. The Plant Journal. 1993; 4(2): 215-223.

14. Sharma S, Villamor JGC, Verslues PE. Essential Role Of Tissue Specific Proline Synthesis And Catabolism In Growth And Redox Balance At Low Water Potential. Plant Physiol.  2011; 157(1): 292-304.

15. Chaitanya KV, Rasineni GK, Reddy AR. Biochemical Responses To Drought Stress In Mulberry (Morus Alba L.): Evaluation Of Proline, Glycine Betaine And Abscisic Acid Accumulation In Five Cultivars. Acta Physiol Plant. 2009; 31 (3):437-443.

16. Orcutt DM, Nilsen ET. The physiology of plants under stress: soil and biotic factors, John Wiley & Sons. 2000; 696.

17. Rayapati PJ, Stewart CR. Solubilization Of A Proline Dehydrogenase From Maize (Zea Mays L.) Mitochondria. Plant Physiol. 1991; 95(3): 787-791.

18. Ginzberg I, Stein H, Kapulnik Y, Szabados L, et al. Isolation And Characterization Of Two Different Cdnas Of 1-Pyrroline-5-Carboxylate Synthase In Alfalfa, Transcriptionally Induced Upon Salt Stress. Plant Mol Biol. 1998; 38(5): 755-764.

19. Kiyosue T, Yoshiba Y, Yamaguchi-Shinozaki K, Shinozaki K. A Nuclear Gene Encoding Mitochondrial Proline Dehydrogenase, An Enzyme Involved In Proline Metabolism, Is Upregulated By Proline But Downregulated By Dehydration In Arabidopsis. The Plant Cell  1996; 8(8): 1323-1335.

20. King LJ. Weeds of the world: biology and control. Plant Science Monographs. London : Leonard Hill, - Plant science monographs1966; 526.

21. Scurfield G. Cardaria Draba (L.) Desv. The Journal Of Ecology. 1962; 489-499.

22. Fréchard A, Fabre N, Hannedouche S, Fourasté I. Glucosinolates From Cardaria Draba. Fitoterapia. 2002; 73(2): 177-178.

23. Fahey JW, Zalcmann AT, Talalay P. The Chemical Diversity And Distribution Of Glucosinolates And Isothiocyanates Among Plants. Phytochemistry. 2001; 56(1): 5-51.

24. Yeh CT, Yen GC. Chemopreventive Functions Of Sulforaphane: A Potent Inducer Of Antioxidant Enzymes And Apoptosis. J Funct Foods. 2009; 1: 23-32.

25. Fahey  JW, Haristoy  X, Dolan  PM, Kensler  TW, Scholtus I, Stephenson KK, Talalay P , Lozniewski A. Sulforaphane Inhibits Extracellular, Intracellular, And Antibiotic-Resistant Strains Of Helicobacter Pylori And Prevents Benzo [A] Pyrene-Induced Stomach Tumors. PNAS. 2002; 99: 7610-7615.

26. Lin D, Xing B. Phytotoxicity Of Nanoparticles: Inhibition Of Seed Germination And Root Growth. Environ Pollut. 2007; 150:243-250.

27. Ji S, Ye C. Synthesis, Growth Mechanism, And Applications Of Zinc Oxide Nanomaterials. J Mater Sci Technol. 2008; 24(4): 457.

28. Murashige T, Skoog F. A Revised Medium For Rapid Growth And Bio Assays With Tobacco Tissue Cultures. Physiol Plantarum. 1962; 15, 473–497.

29. Nasiri-Bezenjani M, Riahi-Madvar A, Baghizadeh A, Ahmadi A. Rosmarinic Acid Production And Expression Of Tyrosine Aminotransferase Gene In Melissa Officinalis Seedlings In Response To Yeast Extract. JAST. 2014; 16(4): 921-930

30. Bates L, Waldren R, Teare I. Rapid Determination Of Free Proline For Water-Stress Studies. Plant And Soil. 1973; 39(1): 205-207.

31. Bradford  MM. Rapid And Sensitive Method For The Quantitation Of Microgram Quantities Of Protein Utilizing The Principle Of Protein–Dye Binding. Anal. Biochem. 1967; 72: 248-254.

32. Plewa MJ, Smith SR, Wagner ED. Diethyldithiocarbamate Suppresses The Plant Activation Of Aromatic Amines Into Mutagens By Inhibiting Tobacco Cell Peroxidase. Mutat Res-Fund Mol M. 1991; 247(1): 57-64.

33. Owen R, Handy R. Formulatin the problems for environmental risk assessment of nanomaterials. Environmental Science & Technology, 2007; 41: 5582-5588.

34. Behra R, Krug H. Nanoecotoxicology-Nanoparticles at large. Nat Nanotechnol. 2008; 3: 253-254.

35. Swathy Lekshmi S, Jayadev A. Influence of salt stress on the morphological physiological activity and anatomy of Cow pea plant (Vigna unguiculata). IJAR. 2017; 3 (8): 281-288.

36. Aminizadeh M, Riahi-Madvar A, Mohammadi M. Effects of iron and cupper ions on sulforaphane content and peroxidase activity in Lepidium draba seedlings. EPP. 2014; 1: 8–14.

37. Aminizadeh M, Riahi-Madvar A, Mohammadi M. Nano-Metal oxides induced sulforaphane production and peroxidase activity in seedlings of Lepidium draba (Brassicaceae). PBS.  2016; 6(1): 75-83.

38. Riahi-Madvar A, Nasiri-Bezenjani MA, Yousefi K,  Mohammadi M. Investigation of the ability of Lepidium draba L. seedlings in zinc and silver ions absorption and effect of the ions on morphological and biochemical characteristics of the seedlings. Journal of Cell & Tissue, 2015; 6(1): 59-70.

39. Welinder KG. Superfamily of plant, fungal and bacterial peroxidases. Curr Med Res Opin. 1992; 2(3): 388-393.

40. Fattahian Y, Riahi‑Madvar A, Mirzaee R, Torkzadeh‑Mahani M, et al. Heterologous expression, purification and characterization of a peroxidase isolated from Lepidium draba. Protein J. 2017; 36(6): 461-471.

41. Ashraf M. Some important physiological selection criteria for salt tolerance in plants. Flora-Morphology, Distribution. Funct Ecol. 2004; 199 (5): 361-376.

42. Hong Z, Lakkinen, K, Zhang Z, Verma DPS. Removal of feedback inhibition of  delta(1)-pyrroline-5-carboxylate synthetase results in increased proline accumulation and protection of plants from osmotic stress. Plant Physiol. 2000; 122 (4):1129-1136.

43. Solomon A, Beer S. Effect of NaCl on the carboxylating activity of rubisco and absence of proline related compatible solutes. Plant Physiol. 1994; 108: 1387-1394.