حساسیت و ویژگی استفاده همزمان DNA متیلاسیون ژن RASSF1A و بیان ژن FHL1 در تشخیص افتراقی تومورهای خوش خیم از پاپیلاری کارسینومای تیروئید

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی، دانشکده علوم، گروه بیوشیمی، واحد شوشتر، شوشتر، ایران

2 دانشگاه آزاد اسلامی، دانشکده علوم پزشکی، گروه دامپزشکی، واحد شوشتر، شوشتر، ایران

چکیده

هدف: هدف این تحقیق بررسی و تعیین حساسیت و ویژگی استفاده هم‫زمان DNA متیلاسیون ژن RASSF1A و بیان ژن FHL1 در تشخیص افتراقی تومورهای خوش خیم از پاپیلاری کارسینومای تیرویید می‏باشد.
مواد و روش‏ها: 160 نمونه از بیماران با تومورهای بدخیم تیرویید (80 نمونه) وخوش خیم تیرویید (80 نمونه) از بین کل بیماران مراجعه کننده به مراکز درمانی اهواز به این تحقیق وارد شدند، استخراج RNA از نمونه‏های پارافینه شده سپس از روی آنcDNA  ساخته شد. جهت بررسی بیان ژن از مخلوط واکنش  Real Time PCRحاوی ماده‏ی فلورسانت سایبر گرین استفاده شد همچنین برای بررسی هیپر‫متیلاسیون ژن پس از استخراج DNA نمونه‏های مختلف به‏روش  COBRAانجام شد در نهایت میزان حساسیت و ویژگی استفاده همزمان دو تست از محاسبات اپیدمیولوژیکی استفاده شد.
نتایج: در تومورهای بدخیم یک همبستگی معکوس معنی‏دار در سطح 05/0 بین هیپر‫متیلاسیون پروموتر ژن RASSF1A با بیان ژن FHL1 وجود دارد همچنین حساسیت استفاده همزمان تست هیپر متیلاسیون پروموتر ژن RASSF1A (کیفی و کمی) و تست بیان نسبی  mRNAژن FHL1 به‏ترتیب 2/98 و 32/79 درصد، همچنین ویژگی استفاده هم‫زمان تست هیپر‫متیلاسیون پروموتر ژن RASSF1A (کیفی و کمی) و تست بیان ژن FHL1 به‏ترتیب 47/39 و 29/75 درصد محاسبه شد.
نتیجه‏گیری: استفاده هم‫زمان تست هیپر‫متیلاسیون پروموتر ژنRASSF1A  به‏صورت کیفی و تست بیان ژن FHL1 جهت تشخیص افتراقی تومورهای خوش خیم از پاپیلاری کارسینومای تیروئید حساسیت بالاتری دارد.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

سرطان تیرویید شایع‏ترین بدخیمی غدد درون ریز است که در دو دهه اخیر در جهان موارد ابتلا به این سرطان افزایش یافته است (1). در آمریکـا افزایش سالیانه موارد ابتلا به سرطان تیرویید بین سال‏های 2000 تا 2009، 6 درصد می‏باشد که در میان همه انواع سرطان‏ها بالاترین  مقدار را دارد (1). اگرچه میزان مرگ ومیر ناشی از این سرطان پایین است میزان عود یا دوره درمان بیماری بالا است که موجب افزایش ناتوانی در درمان و مرگ و میر می‏شود (2). بر اساس آمار انیستیتو سرطان ایران، سرطان تیرویید 8/1 درصد کل میانگین سنی بیماران ایرانی 43 سال و نسبت زن به مرد 8/1 به 1 بوده است. سرطان تیرویید در ایران هفتمین سرطان شایع در زنان و چهاردهمین در مردان و یازدهمین سرطان شایع در هر دو جنس است (3).

بقا 10 ساله سرطان تیرویید در بالغین میانسال 80 تا 96 درصد است. عود مجدد در 5  تا 20 درصد موارد پاپیلاری تیرویید کارسینوما دیده می‏شود. عود مجدد ممکن است ناشی از درمان ناقص اولیه و یا به‏دلیل وجود تومور با سلول‏های خیلی مهاجم باشد (4). ریسک بدخیمی در نمونه‫های FNA (Fine Needle Aspiration) که مشکوک به سرطان بین 10 تا 40 درصد گزارش می‏شوند‌ لذا تمام بیماران نیازمند برداشت ندول مشکوک خواهند بود تا جواب دقیقتر با  بررسی نمونه‏های بیوپسی پاتولوژی مشخص شود و فقط در حدود 20 درصد این نمونه‏های مشکوک دارای نئوپلاسم بدخیم خواهند بود (5). از طرف دیگر در 10 درصد موارد FNA  جواب‏های منفی کاذب گزارش می‏شود که منجر به تشخیص دیر هنگام سرطان و در نتیجه درمان دیر هنگام می‏شود و این امر بر روی سیر بیماری تاثیر منفی می‏گذارد (5).

ژن (Ras association domain family 1) RASSF1A: نام دیگر این ژن NORE2A است و بر روی کروموزوم 3 در محل 3p21.3 قرار دارد. این ژن پروتئینی را رمزبندی می‏کند که به پروتئین‏های اثرگذارRAS RAS effector proteins)) شباهت دارد (6). تغییر بیان این ژن با پاتوژنز انواع مختلفی از سرطان‏ها ارتباط دارد که سرکوبگر تومور بودن این ژن را پیشنهاد می‏دهند. یکی از راه‏های غیر فعال شدن این ژن، هیپرمتیلاسیون جزایرCpG  در پروموتر آن است. پروتئین تولید شده با پروتئین‏های سیستم ترمیم DNA مانند XPA واکنش دارد (6). همچنین این پروتئین مانع تجمع سیکلین D1 می‏شود و بنابراین موجب توقف چرخه سلولی می‏شود (7).

بررسی بر روی وضعیت متیلاسیون پروموتر ژن RASSF1A نشان داده است که در 35 درصد تومورهای خوش خیم و بدخیم تیرویید این ژن متیله می‏شود (8). در تحقیقی هیپرمتیلاسیون پروموتر این ژن در سرطان‏ها از جمله تیرویید گزارش شده بود و از آن به‏عنوان یک نشان‏های زیستی مولکولی که امکان تشخیص سلول‏های سرطانی را فراهم می‏سازد، ذکر شده بود (9). هیپر‫متیلاسیون RASSF1A در خون و مایعات بدن افراد مبتلا به برخی بدخیمی‏ها مثل سرطان‫های تیرویید هم مشاهده شده بود و بنابراین می‏تواند به‏عنوان یک نشان‏های زیستی در تشخیص زودرس سرطان تیروئید کاربرد داشته باشد (9). در یک بررسی بر روی 89 تومور تیرویید و 3 رده سلولی نشان داده شد که در هر سه رده سلولی و در 35 درصد موارد تومورهای خوش‫خیم و بدخیم هیپر‫متیلاسیون RASSF1Aدیده می‏شود، این تحقیق نشان داد که میزان هیپر‫متیلاسیون RASSF1A با مقدار بیان آن ارتباط دارد.

ژن  FHL1(Four and a half LIM domains 1): این ژن بر روی کروموزوم X و در محل Xq26 قرار دارد و شماره شناسایی آن 2273 و از 7 اگزون تشکیل شده است. محصول آن از رشد سلول‏های سرطانی از طریق مسیر پیام‏رسانی مشابه با TGFb جلوگیری می‏کند. این ژن کنترل کننده پرولیفراسیون، تکامل و آپوپتوز سلولی است (10). در تحقیقی مشخص شد که ژن FHL1 بیشترین تفاوت بیان نسبی mRNA را در بین دو گروه تومورهای فولیکولار خوش خیم و بدخیم تیرویید دارد و نتیجه‏گیری شده بود که با بررسی تعداد اندکی ژن مانندFHL1  امکان افتراق تومورهای خوش خیم از بدخیم تیرویید وجود دارد (11).

تاکنون هیچ نشان زیستی منفردی که بتواند تمام تومورهای خوش خیم را از بدخیم افتراق دهد شناخته نشده است و به‏همین دلیل از ترکیب‏های انواع مختلف نشان‫های زیستی استفاده می‏شود تا بهترین نتایج به‏دست آید (12). به‏هرحال، به‏جز تعداد اندکی از این ژن‏ها که در مطالعات گوناگون به‏عنوان نشان‏های زیستی برای بدخیمی معرفی شده‏اند، بیشتر آن‏ها فقط در یک مطالعه بررسی شده اند و درمطالعات جداگانه دیگر کارایی آن‏ها به اثبات نرسیده است. در این تحقیق تصمیم گرفته شد تا حساسیت و ویژگی استفاده همزمان تست‏های تشخیصی مولکولی DNA متیلاسیون ژن RASSF1A و بیان ژن FHL1 در تشخیص افتراقی تومورهای خوش خیم از پاپیلاری کارسینومای تیروئید بررسی و تعیین شود.

 

مواد و روش‌ها

حجم نمونه در این تحقیق 160 مورد بود و 80 نمونه از بیماران با تومورهای بدخیم تیرویید و 80 نمونه با تومورهای خوش‏خیم تیرویید در این تحقیق وارد شدند. بلوک‏های پارافینی بعد از بازبینی مجدد توسط یک پاتولوژیست مناسب‏ترین آن‏ها انتخاب شدند. سه نمونه که در گزارش پاتولوژی هیچ ضایعه خوش خیم یا بدخیم گزارش نشده بود به‏عنوان بافت نرمال انتخاب شدند.

برای انجام مایکرودایسکشن در ابتدا به‏وسیله میکروتوم برش‏های 6 میکرونی از بلوک‏های پارافینی داده شد. سپس این برش‏ها در یک محیط عاری از RNase بر روی لام‏های مخصوص مایکرو دایسکشن گذاشته شدند. از هر بلوک 5  لام تهیه شد و در هر لام بین 2 تا 3 برش گذاشته شد. دو عدد از این لام‏ها برای استخراجRNA  و دو عدد دیگر برای استخراج DNA  در نظر گرفته شدند و یک لام هم با رنگ هماتوکسلین ائوزین (Sigma) رنگ آمیزی شد تا در زمان مایکرودایسکشن به‏عنوان راهنما برای شناسایی محدوده سلول‏ها استفاده شود. لام‏های مخصوص برای استخراج RNA  در فریزر 80- سانتی‏گراد نگه‫داری شدند و لام‏های مخصوص برای استخراج DNA  در دمای اتاق نگه‫داری شدند. سپس با مقایسه بین لام‏های رنگ‏آمیزی شده با رنگ هماتوکسلین ائوزین و لام‏های رنگ‏آمیزی شده با متیلن گرین و با کمک دستگاه لیزر مایکرو دایسکشن (LEICA) و یا با کمک استریومیکروسکپ و تیغ جراحی سلول‏های مورد نیاز از سطح لام‏ها برش داده شده و در میکرو تیوب‏های 5/1 میکرولیتری قرار داده شدند و تا زمان استخراجDNA  و یا RNA در فریزر80- سانتی‏گراد نگه‏داری شدند. برای استخراج DNA از نمونه‏های پارافینی از کیت QIAamp DNA Micro  Kit شرکتQIAGEN  استفاده شد. برای استخراج DNA از بافت تازه از روش فنل و کلروفرم استفاده شد.

در سال 1997 برای اولین بار روش Combined Bisulfit Restriction Analysis (COBRA) برای بررسی کمی هیپر متیلاسیون ابداع شد (13). در این روش بعد از تیمار DNA با بی‏سولفیت و انجامPCR ، محصولات آن تحت برش آنزیمی قرار می‏گیرند. با توجه به ردیف بازهای اولیهDNA  این آنزیم به‏گونه‏ای انتخاب می‏شود که عمل برش را فقط در جزایرCpG  دارای هیپرمتیلاسیون انجام دهد. میزان هیپرمتیلاسیون درDNA  اولیه با میزان کمی برش محصولاتPCR  متناسب است (13). اگر CpG درDNA  اولیه فاقد هیپر‫‫متیلاسیون باشد در اثر تیمار بی‏سولفیت سیتوزین تبدیل به تیمین شده و جایگاه برش آنزیم از بین می‏رود و عمل برش انجام نخواهد شد. اگر در  DNA اولیه مخلوط آلل‏های متیله و غیرمتیله وجود داشته باشد در زمان هضم آنزیمی، میزان برش‏ها وابسته به مقدارCpG های متیله دارد. سپس با غلظت سنجی باندها در ژل پلی اکریل آمید (با کمک نرم‏افزار ImageJ) میزان کمی هیپر‫متیلاسیون محاسبه می‏شود. درصد هیپر‫متیلاسیون براساس فرمولX 100% Methylation= C / (C + B) محاسبه شد که در آن B دانسیته باند محصولات قبل از برش و C دانسیته باند حاصل از برش آنزیمی است (شکل 1).

 

 

شکل1: نتایج بررسی هیپرمتیلاسیون RASSF1A: نتایج آنالیز MS-PCR برای ژن RASSF1A در نوارM و نوارN به‏ترتیب مقصود متیله شده و غیرمتیله شده است، نوار انتهایی(L) به‏عنوان مارکر با جرم مولکولی bp 100 می‏باشد.

 

در بررسی هیپر‫متیلاسیون ازDNA  محصول شرکتMillipore  به‏نامCpGenome™ Universal Methylated DNA به‏عنوان کنترل مثبت استفاده شد. در اینDNA  تمام جزایرCpG  دارای هیپر‫متیلاسیون هستند. همچنین از DNA لنفوسیت‏های خون محیطی (PBL) به‏عنوان کنترل منفی استفاده شد. برای انجام تیمار بی‏سولفیت از کیت EZ DNA Methylation Kit ™CA, USA) (ZYMO REASERCH استفاده شد.

پرایمرهای مورد نیاز برای بررسی هیپر‫متیلاسیون RASSF1A با کمک سایت Primer 3 طراحی شد(جدول1). در ابتدا توالیDNA  در محدوده اگزون شماره یک این ژن‏ها در سایت Meth Primer وارد شد و جزایرCpG  در این منطقه شناسایی شدند. سپس ردیف بازهایDNA  بعد از تیمار با بی‏سولفیت به‏دست آمد (مطابق راهنمای کیت متیلاسیون). سپس یک جایگاه برش آنزیمی که واجد یکCpG  باشد انتخاب و پرایمر لازم در اطراف این جایگاه طراحی شد. به‏دلیل این‏که نمونه‏هایDNA  از بافت‏های پارافینی به‏دست آمده بودند سعی شد که طول محصولPCR  زیر 90 جفت باز طراحی شود. 


جدول1: ردیف بازی، ‌طول محصول و آنزیم استفاده شده برای بررسی هیپر متیلاسیون به‏روش COBRA

نام ژن

ردیف بازی  پرایمرها

طول قطعه

طول بعد از برش

آنزیم

RASSF1A

F:GGTTYGYGTTTGTTAGYGTTTAAAGTT

R:CTCAAACTCCCCCRACATAA

70

35-35

RsaI

 

 

سه آنزیم استفاده شده برای بررسی هیپر‫متیلاسیون دارای جایگاه برش به‏شرح زیر بودند. آنزیم Taq1 (TCGA)، آنزیم  RsaI (GTAC) و آنزیم ‌BstUI (CGCG). شرایط دمایی و مدت زمان تیمار بر اساس توصیه شرکت سازنده عمل شد.

برای استخراجRNA  از نمونه‏های مایکرو دایسکت شده از کیت شرکت Roche به‫نام High Pure RNA Paraffin Kit  استفاده شد.

همچنین برای ساخت cDNA از کیت شرکت Qiagen به‏نام Quanti TechRT بر اساس دستور العمل شرکت سازنده استفاده شد.

واکنش Real Time PCR  در حجم 20 میکرولیتر و به‏صورت دوپلیکیت انجام گرفت. از مخلوط واکنشReal Time PCR  که دارای ماده فلورسانس سایبر گرین و محصول شرکت TAKARA به‏نامSYBR ®Premix Ex Taq ™ استفاده شد چون نسبت به مخلوط واکنشی رنگ EvaGreen جواب‫های بهتری به‏دست آمده بود.در هر تیوب واکنش، مواد با مقادیر زیر اضافه شد.

1-PreMix 2X               10 μl

2-primer 2μM each      1 μl

3-D.W                         7 μl

4-cDNA                      2μl

واکنش‫هایReal Time PCR  هم با دستگاه مارک CORBET به‏نام Rotor-Gene 6000 انجام شد. چرخه دمایی به‏صورت 10 ثانیه 95 درجه سپس 45 سیکل شامل 5 ثانیه 95 درجه،  15 ثانیه 60 درجه و 10 ثانیه 72 درجه بود. در انتهای هر سیکل در دمای 72 درجه نور سنجی با نور سبز و طول موج  تابش 470 و بازتاب 510 نانومتر انجام می‏گرفت. سپس منحنی ذوب از دمای 65 تا 95 درجه محاسبه می‏شود (مطابق راهنمای کیت مورد استفاده).

برای بررسی بیان FHL1 با تکنیک Real Time PCR از پرایمری‏هایی استفاده شد که با کمک سایت اینترنتیPrimer3  طراحی شده بودند. پرایمرها طوری طراحی شدند که هر کدام در اگزون جداگانه‏ای قرار بگیرند تا از تکثیرDNA  ژنومیک جلوگیری شود. طول محصولPCR  کمتر از 80 جفت باز طراحی شد تا برای تکثیر نمونه‏های پارافینی مشکلی ایجاد نشود. از ژن GAPDH به‏عنوان کنترل استفاده شد. ردیف بازی پرایمرها و طول قطعه تکثیر شده در جدول 2 ارائه شده است. بعد از انجام موفقیت‏آمیز PCRها،  مقدارCycle threshold) )Ct  که نمایان‏گر سیکل آستانه‏ای PCR است محاسبه شد. این کار با استفاده از منحنی‏های تکثیرPCR  که توسط دستگاهReal Time  تهیه می‏شود و نرم‏افزار دستگاهCORBET  انجام شد. برای هر ژن میزان تعدیل شده بیان mRNA  بر حسب درصد با استفاده از فرمول زیر محاسبه شد.

= بیان نسبی mRNA  (درصد)

 [2 -(Ct of gene ofinterest - Ct of GAPDH) x 100%] 


 

جدول2: ردیف بازی پرایمرها و طول محصول PCR  در آزمایش بررسی بیان نسبی mRNA


نام ژن

ردیف بازی پرایمر

طول قطعه (bp)

FHL1

F:  GCCAACACCTGTGTGGAAT

R:  GCCAGAAGCGGTTCTTATAGTG

76

GAPDH

F :  ATGGGGAAGGTGAAGGTCG

R:  GTTAAAAGCAGCCCTGGTGA

72


 

برای انجاممحاسبات آماری از نرم‏افزار SPSS نسخه 16 استفاده شد. از آزمون مجذور مربع کای برای بررسی ارتباط بین متغیرهایی همچون گروه سنی، جنس، ‌تهاجم و ‌متاستاز با وضعیت کیفی هیپرمتیلاسیون استفاده شد. در موارد خاصی از آزمون دقیق فیشر برای این منظور استفاده شد. برای بررسی ارتباط احتمالی بین مقدار کمی هیپرمتیلاسیون و بیان mRNA با متغیرهایی مانند گروه

 

سنی، جنس،  تهاجم و متاستاز از آزمون t استفاده شد. در تمامی آزمون های استفاده شده ارزش p برابر 05/0 ملاک عمل قرار گرفت.

برای محاسبه حساسیت (Sensitivity)، ویژگی (Specificity)، ارزش اخباری مثبت (Positive predictive value)،  ارزش اخباری منفی(Negative predictive value) و صحت (Accuracy) جواب آزمایش از فرمول‏های زیر استفاده شد. در این محاسبات جواب گزارشات پاتولوژی به‏عنوان آزمایش استاندارد در نظر گرفته شد که حقیقی یا کاذب بودن نتایج هیپرمتیلاسیون و بیانmRNA  در مقایسه با گزارشات پاتولوژی سنجیده شد. (مثبت حقیقی(TP): شخص بیمار، به‏درستی بیمار تشخیص داده شود. مثبت کاذب(FP): شخص سالم، به اشتباه بیمار تشخیص داده شود. منفی حقیقی(TN): شخص سالم، به‏درستی سالم تشخیص داده شود. منفی کاذب(FN): شخص بیمار، به اشتباه سالم تشخیص داده شود).

 

 

 

 

 

 

 

 

 

 

 

همچنین برای محاسبه حساسیت دو تست همزمان حاصلضرب حساسیت دو تست از مجموع حساسیت دو تست کم شد و برای محاسبه ویژگی دو تست همزمان؛ ویزگی دو تست در هم ضرب شدند.

از آزمون ROC برای محاسبه بهترین مقدار مرزی در بررسی های نتایج هیپر‫متیلاسیون DNA بیان نسبیmRNA  استفاده شد. این آزمون بهترین مقدار مرزی برای نتایج هر آزمایش را که بالاترین حساسیت و ویژگی را به‏دست آورد در اختیار ما قرار می‏دهد و با محاسبه سطح زیر منحنی(AUC) کارایی آزمایش برای افتراق تومورهای خوش‏خیم از بدخیم محاسبه شد.

 

نتایج

نتایج اطلاعات توصیفی بیماران

در تحقیق جاری تعداد 160 نمونه بلوک پارافینی مربوط به نمونه‏های بایگانی طی سال‏های  1385 تا 1395 از آزمایشگاه‏های پاتولوژی مراکز درمانی شهر اهواز بعد از بازبینی توسط یک پاتولوژیست جمع آوری و انتخاب شدند. نمونه‏ها مشتمل بر 80  مورد تومورهای بدخیم و همچنین تعداد 80 مورد تومورهای خوش خیم شامل 40 مورد گواتر، ‌13 مورد تیروئیدیت هاشیماتو، 12 مورد آدنوم فولیکولار بودند که در تحقیق حاضر مورد بررسی قرار گرفتند. علاوه بر این تعداد 23 نمونه بافت تازه تیرویید در خلال انجام طرح مربوط به 4 مورد تومورهایCV-PTC  و 19 مورد تومورهای خوش خیم از اتاق عمل به‏طور مستقیم جمع‏آوری شد. در جدول 3  اطلاعات مربوط به گسترش جنسی،  سنی و نوع هیستولوژیک تومورها ارائه شده است.

بررسی ارتباط هیپر متیلاسیون ژنRASSF1A  با نوع تومورها

بررسی هیپرمتیلاسیون در 160 مورد تومورهای خوش خیم و بدخیم تیرویید نشانگر 138 مورد هیپرمتیلاسیون مثبت بود. از این تعداد 67 مورد خوش‏خیم و 71 مورد بدخیم بودند. مابقی 22 نمونه‏هایی که هیپرمتیلاسیون را نشان ندادند 9 مورد بدخیم و 13 مورد خوش‏خیم بودند (جدول3). اگر چه فراوانی هیپرمتیلاسیون در نمونه‏های بدخیم (75/88 درصد) بیشتر از خوش‏خیم (75/83 درصد) بود اما تفاوت این دو گروه از نظر آماری معنی‏دار نبود (123/0=p).

بررسی کمی هیپرمتیلاسیون ژنRASSF1A  

بررسی کمی هیپرمتیلاسیون در ژن RASSF1A به‏صورت میانگین و انحراف از معیار به تفکیک گروه‏های مختلف انجام و مشخص شد که در گروه تومورهای بدخیم میزان آلل های دارای هیپر‫متیلاسیون 28/28 درصد بود درحالی‏که در گروه تومورهای خوش خیم این میزان 40/11 درصد بود و تفاوت بین این دو گروه معنی‏دار بود (01/0=p).

 

جدول 3: میانگین و انحراف معیار سن در زمان تشخیص بیماری (سال) و فراوانی جنس در بیماران مبتلا به تومورهای خوش خیم و بدخیم تیرویید به تفکیک طبقه‏بندی هیستوپاتولوژی (183n=)

توزیع سنی(سال)

 Mean ± SD             Min – Max

جنس (تعداد)

مرد       زن

نوع هیستوپاتولوژی

نوع تومور

82 - 15

78 - 21

13 - 13

85 - 58

17/21 ± 20/41

18/39 ± 01/48

00/0 ± 00/13

19/18 ± 51/71

18

6

5

6

32

6

1

6

CV-PTC

TC-PTC

FV-PTC

UTC

بدخیم

(n=80)

 

پارافینی

56 - 29

83 - 38

68 - 22

72 - 22

22/11 ± 33/44

78/15 ± 41/56

87/14 ± 74/46

99/26 ± 33/49

1

2

5

6

12

10

35

9

HT

FA

GT

N

خوش خیم / طبیعی

(n=80)

57 - 28

16/12 ± 00/47

0

4

CV-PTC

بدخیم

(n=4)

بافت تازه

42 - 42

55 - 26

65 - 25

56 - 23

00/0 ± 00/42

42/13 ± 27/38

68/13 ± 82/38

93/22 ± 52/38

0

0

1

1

1

5

10

1

HT

FA

GT

N

 

خوش‏خیم / طبیعی

(n=19)

               

CV-PTC, Classic Variant Papillary Thyroid Carcinoma. TC-PTC, Tall cell variant papillary thyroid carcinoma. FV-PTC, follicμlar variant papillary thyroid carcinoma. UTC, Undifferentiated thyroid carcinoma. HT, Hashimato’s thyroiditis. FA, Follicμlar adenoma. GT, goiter. N, Normal.

 

 


بررسی هیپر متیلاسیون ژنRASSF1A  در جهت افتراق تومورها


بررسی هیپر متیلاسیون به‏صورت کیفی نشان داد که اگر هیپرمتیلاسیون ژنRASSF1A  به‏عنوان یک آزمایش تشخیصی برای سرطان تیرویید استفاده می‏شد برای 73 مورد بدخیم و 12 مورد خوش خیم درست تشخیص داده می‏شدند. اما 7 مورد بدخیم و 68 مورد خوش‏خیم به‏طور کاذب تشخیص داده می‏شدند. حساسیت و ویژگی این آزمایش به‏ترتیب 25/91 و 15 درصد به‏دست بود (جدول 4).

اما اگر بررسی کمی به‏عنوان ملاک تشخیصی قرار می‏گرفت بهترین نقطه مرزی برای افتراق تومورهای خوش‏خیم از بدخیم میزان بالاتر از 40 درصد هیپرمتیلاسیون در ژنRASSF1A  بود و با این میزان نقطه مرزی تعداد 22 مورد بدخیم و 79 مورد خوش‏خیم درست تشخیص داده می‏شدند. اما 58 مورد بدخیم و یک مورد خوش‏خیم به‏طور کاذب تشخیص داده می‏شدند. بنابراین حساسیت و ویژگی این آزمایش به‏ترتیب 5/27 و 75/98 درصد به‏دست بود (جدول 4).

 

جدول4: نتایج صحت تشخیص تومورهای خوش خیم و بدخیم بر اساس بررسی کیفی و کمّی هیپر متیلاسیون ژن RASSF1A

متغیر

نتایج کیفی هیپرمتیلاسیون

تعداد/درصد

نتایج کمی هیپرمتیلاسیون

تعداد/درصد

مثبت حقیقی

منفی حقیقی

مثبت کاذب

منفی کاذب

73

12

68

7

22

79

1

58

حساسیت

ویژگی

25/91%

15%

5/27%

75/98%

ارزش اخباری مثبت

ارزش اخباری منفی

صحت آزمایش

77/51%

15/63%

12/53%

65/95%

66/57%

12/6%

 


 

بررسی بیان ژنFHL1  

 

 

بیان در ژنFHL1  در گروه بدخیم برابر 50/0 درصد بود درحالی‏که در گروه خوش‏خیم این میزان خیلی بالاتر بود (29/5 درصد) و تفاوت بین این دو گروه معنی‏دار بود (019/0=p). تجزیه و تحلیلROC  نشان داد که این ژن برای افتراق بین دو گروه تومورهای خوش خیم و بدخیم تیرویید کارایی خوبی دارد (92/0=AUC).

اگر بررسی بیان ژنFHL1  به‏عنوان ملاک تشخیصی قرار می‏گرفت بهترین نقطه مرزی برای افتراق دو نوع تومورهای خوش خیم از بدخیم میزان کمتر از 57/0 درصد‌ بود و با این میزان نقطه مرزی تعداد 63 مورد بدخیم و 61 مورد خوش‏خیم درست تشخیص داده شدند. اما 17 مورد بدخیم و 19 مورد خوش‏خیم به‏طور کاذب تشخیص داده شدند. بنابراین حساسیت و ویژگی این آزمایش به‏ترتیب 75/78 و 25/76 درصد به‏دست آمد (جدول 5).

 

 

 

 

جدول5: نتایج صحت تشخیص تومورهای خوش خیم و بدخیم بر اساس بررسی بیان ژن FHL1

متغیر

نتایج بیان

تعداد / درصد

مثبت حقیقی

منفی حقیقی

مثبت کاذب

منفی کاذب

63

61

19

17

حساسیت

ویژگی

75/78 %

25/76 %

ارزش اخباری مثبت

ارزش اخباری منفی

صحت آزمایش

82/76 %

76/80 %

5/77 %

 

 

 

 

 

 

در تومورهای بدخیم یک همبستگی معکوس(431/0-r=) معنی‏دار در سطح 05/0 بین هیپرمتیلاسیون پروموتر ژن RASSF1A با بیان نسبی ژن FHL1 وجود دارد. با توجه به اطلاعات جدول 6 مقدار حساسیت و ویژگی کلی استفاده هم‫زمان (Simultaneously) دو تست DNAمتیلاسیون پروموتر ژنRASSF1A  به‏صورت کمی و کیفی و بیان ژن FHL1 در جدول 7 ارائه شده است.

 

 

 

 

جدول 6: خلاصه حساسیت و ویژگی تست هیپرمتیلاسیون پروموتر ژن RASSF1A (کمی و کیفی) و تست بیان نسبی  mRNAژن FHL1 به‏طور جداگانه

 

بیان نسبی mRNA ژن FHL1

هیپرمتیلاسیون پروموترژن RASSF1A

(کیفی)

هیپرمتیلاسیون پروموترژن RASSF1A

(کمی)

 

75/78%

25/91%

5/27 %

حساسیت تست

25/76%

15%

75/98%

ویژگی تست

 

 

جدول 7: حساسیت و ویژگی کلی استفاده همزمان تست هیپرمتیلاسیون پروموتر ژن RASSF1A  (کمی و کیفی) و تست بیان ژن FHL1

 

استفاده همزمان تست هیپر متیلاسیون پروموتر ژنRASSF1A  (کیفی) و تست بیان ژن FHL1

 

استفاده همزمان تست هیپر متیلاسیون پروموتر ژن RASSF1A (کمی) و تست بیان ژن FHL1

 

 

2/98%

32/79%

حساسیت کلی استفاده همزمان دو تست

47/39%

29/75%

ویژگی کلی استفاده همزمان دو تست


 

بحث

تکامل و پیشرفت تومورهای تیرویید توسط انکوژن‏ها و ژن‏های سرکوبگر تومور کنترل می‏شوند که تنها تعداد معدودی از آن‏ها تاکنون شناسایی شده اند (14، 15). ژن RASSF1A به‏عنوان یک ژن سرکوبگر تومور است که در سال 2000 مشخص شد بیان آن با هیپرمتیلاسیون کنترل می‏شود. این ژن در انواع مختلفی از سلول‏های بدن بیان می‏شود‏ (16). فرم جهش یافته آن به‏طور معنی‏داری باعث کاهش فعالیت توقف رشد سلولی می‏شود (17). بیان مجدد آن در انواع رده‏های سلولی مانند پروستات و

 

 

ریه، باعث توقف رشد سلولی می‏شود (16، 17). عملکرد آن باعث توقف پیشرفت چرخه سلولی و جلوگیری از تجمع سیکلین D1  می‏شود (18). غیر فعال شدن آن در انواعی از تومورها منجمله ریه، پستان، کلیه، پروستات، تخمدان، کولون و تیرویید و دیگر سرطان‏ها گزارش شده است (16، 19). هیپرمتیلاسیون این ژن موجب کاهش بیان پروتئین آن می‏شود (16، 20، 21). این ژن یکی از شایع‏ترین ژن‏های سرکوبگر تومور است که به‏طور معمول در نئوپلاسم‏ها دچار هیپر‫متیلاسیون می‏شود (16،22).

در تحقیق حاضر بررسی کیفی هیپر‫متیلاسیون ژنRASSF1A  نشان داد که هم در تومورهای خوش‏خیم و هم بدخیم هیپر‏متیلاسیون یافت می‏شود. فراوانی هیپرمتیلاسیون در تومورهای خوش خیم بیشتر بود اما در تومورهای بدخیم سطح کمی هیپرمتیلاسیون بالاتر بود. این نتایج تاییدکننده گزارشات قبلی مشابه است که عنوان کرده‏اند هیپرمتیلاسیون RASSF1A در هر دو نوع تومورهای خوش خیم و بدخیم تیرویید مشاهده می‏شود. در تحقیقی توسطXing  و همکاران (20) که بر روی تومورهای تیرویید انجام شده بود مشخص شد که هیپرمتیلاسیون در هر دو گروه تومورهای خوش‏خیم و بدخیم مشاهده می‏شود. نتایج پژوهش حاضر با نتایج مطالعهNakamura  و همکاران (23) نیز هم‏خوانی دارد در نتایج آنها هیپرمتیلاسیون ژنRASSF1A  در تومورهایPTC ، ATC وFA  با فراوانی نسبتا یکسانی مشاهده شده بود. همچنین در مطالعه‏ای دیگر روی تومورهای تیرویید،  نتایج مشابهی به‏دست آمده بود. در آن تحقیق با بررسی 22 مورد تومورهای خوش خیم و 22 مورد تومورهای بدخیم تیرویید به‏این نتیجه رسیده بودند که در 62 درصد مواردPTC ، ‌77 درصد مواردUTC ، 75 درصد موارد گواتر و 70 درصد موارد آدنوم فولیکولار هیپر‫متیلاسیون ژن RASSF1A مشاهده شده بود (2).

نتایج پژوهش حاضر نشان داد که در هر دو گروه تومورهای خوش خیم و بدخیم، هیپر‫متیلاسیون ژن RASSF1A  به‏وفور مشاهده می‏شود و از این یافته می‏توان چنین نتیجه گیری کرد که احتمالا هیپرمتیلاسیون در مراحل اولیه تومورزایی تیرویید رخ می‏دهد که تایید کننده نتایج به‏دست آمده در تحقیقات قبلی است (23، 24). RASSF1A یک ژن سرکوب‏گر تومور است در اثر هیپرمتیلاسیون، احتمالا بیان پروتئین آن کاهش یافته و میزان تکثیر سلولی افزایش می‏یابد و سلول‏ها به‏سمت مراحل بعدی تومورزایی پیشرفت می‏کنند. 

در بررسی هیپرمتیلاسیون توسط Schagdarsurengin و همکارانش بر روی نمونه‏های تیرویید؛ارتباط معنی‏داری بین هیپرمتیلاسیون ژن RASSF1A با سن شناسایی کرده بودند. یعنی با افزایش سن فراوانی هیپرمتیلاسیون هم بیشتر مشاهده شده بود (2) که با نتایج پژوهش حاضر مطابقت دارد. در بررسی هیپر متیلاسیون ژن RASSF1A در سلول‏های اپیتلیال پستان نشان داده شده بود که سن می‏تواند باعث افزایش فراوانی هیپرمتیلاسیون در سلول‏های اپیتلیال شود (25). بنابراین نتایج پژوهش حاضر تایید کننده این نظریه است که در افراد مسن احتمالا سرکوب بعضی از ژن‏های سرکوب‏گر تومور مانندRASSF1A  به‏وسیله هیپرمتیلاسیون آن‏ها را بیشتر مستعد ابتلا به سرطان تیرویید می‏کند.

نتایج پژوهش حاضر نشان داد که در  ژن مورد بررسی برای هیپرمتیلاسیون ارتباط معنی‏داری با جنسیت بیماران نداشتند که تاییدکننده نتایج به‏دست آمده از تحقیقات قبلی است و با آن‏ها هم‏خوانی دارد (26). نظر به اینکه سرطان تیرویید بیشتر در خانم‏ها رخ می‏دهد و این تفاوت بروز باید علت و اساس مولکولی داشته باشد. در این بررسی نشان داده شد که تفاوتی در هیپرمتیلاسیون بین دو جنس در ژن بررسی شده وجود ندارد بنابراین می‏توان از نتایج پژوهش حاضر چنین برداشت کرد که احتمالا هیپر متیلاسیون ژنRASSF1A  عامل ایجاد تفاوت بروز سرطان تیرویید در دو جنس نیست. 

نتایج پژوهش حاضر نشان داد که بین تهاجم و متاستاز در تومورهای بدخیم تیرویید با هیپرمتیلاسیون ژنRASSF1A  ارتباط معنی‏داری وجود ندارد که تاییدکننده نتایج مطالعاتSchagdarsurengin  و Hu می‏باشد (26،2). عدم وجود ارتباط بین هیپرمتیلاسیون این ژن‏ها با متاستاز و تهاجم را می‏توان این‏گونه تفسیر کرد که ژن‏های درگیر در روند متاستاز و تهاجم در مراحل انتهایی تومورزایی درگیر هستند و سلول‏ها را وادار به مهاجرت می‏کنند. اما ژن بررسی شده در پژوهش حاضر در تومورهای خوش خیم هم هیپرمتیلاسیون را نشان دادند بنابراین عملکرد احتمالی آنها در تومورزایی در همان مراحل اولیه است (24،23).

یکی از اهداف پژوهش حاضر این بود تا با بررسی وضعیت هیپر متیلاسیون ژن، بتوان از آن در افتراق تومورهای خوش خیم از بدخیم کمک گرفت. نتایج تحقیق حاضر نشان داد که بررسی های کیفی برای این منظور قابل استفاده نیست. به‏دلیل اینکه هیپرمتیلاسیون این ژن فقط مختص تومورهای بدخیم تیرویید نبوده و به‏وفور در تومورهای خوش خیم هم دیده می‏شود و این از نقاط ضعف های بررسی هیپرمتیلاسیون به‏عنوان یک نشان زیستی در تشخیص سرطان‏ها است.

با بررسی سطح کمی هیپرمتیلاسیون بهتر از بررسی کیفی دو گروه تومورهای خوش‏خیم را از بدخیم افتراق داده شدند. چون در ژن بررسی شده سطح کمی هیپرمتیلاسیون در گروه بدخیم بالاتر از گروه خوش‏خیم به‏دست آمد و با تعیین نقطه‏ای مرزی برای ژن توانستیم تعدادی از تومورهای بدخیم را از خوش خیم افتراق دهیم. با وجود این در تعدادی از تومورهای بدخیم این کار عملی نبود.

در تحقیق حاضر مشخص شد که بیان نسبی mRNA ژنFHL1  در تومورهای بدخیم خیلی کمتر از خوش خیم بود و این تفاوت در سطح 019/0= معنی‏دار بود به‏طوری‏که شاید بتواند به‏عنوان یک نشان زیستی برای افتراق تومورهای بدخیم از خوش‏خیم تیرویید قابل استفاده شود. این نتیجه تایید کننده گزارشFryknas  و همکارانش است. در مطالعه آنها برای شناسایی نشان‏های زیستی جدید برای افتراق تومورهای بدخیم از خوش خیم فولیکولار تیرویید که با روش میکروآرری انجام داده بودند چندین ژن را معرفی کرده بودند و بهترین این ژن‏ها، ‌FHL1 معرفی شده بود که بیان mRNA  آن در تومورهای بدخیم فولیکولار تیرویید نسبت به خوش‏خیم کاهش می یافت (11).

مطالعه Fryknas و همکاران تنها مطالعه‏ای بود که بر روی تیرویید انجام شده بود. اما چندین مطالعه دیگر بر روی انواع مختلف سرطان‏ها از جمله پروستات، ‌کلیه، پستان (27)، معده (28) و کبد (11) نشان داده‏اند که در تمام این نوع سرطان‏ها بیان mRNA این ژن در تومورهای بدخیم نسبت به گروه خوش‏خیم و بافت طبیعی کاهش بیان دارد و به‏عنوان یک نشان زیستی خوب برای تشخیص بدخیمی‏ها معرفی شده بود.  محصول ژنFHL1  از رشد سلول‏های سرطانی جلوگیری می‏کند بنابراین با کاهش بیان، باعث افزایش رشد سلول‏ها می‏شود. اگر چه نقش دقیق آن در تکامل سلول‏های سرطانی هنوز مشخص نشده است (27).

 

نتیجه‏گیری

از این نتایج می‏توان چنین نتیجه‏گیری کردکه: استفاده همزمان تست هیپرمتیلاسیون پروموتر ژن RASSF1A به‏صورت کیفی و تست بیان ژن FHL1 جهت تشخیص افتراقی تومورهای خوش‏خیم از پاپیلاری کارسینومای تیروئید حساسیتبالاتری دارد. همچنین بررسی همبستگی بین هیپرمتیلاسیون با بیان نسبی mRNA نشان داد که هیپرمتیلاسیون ژن RASSF1A یک همبستگی منفی با بیان نسبی mRNA داشت وافزایش هیپرمتیلاسیون در ژنRASSF1A  احتمالا موجب کاهش بیانFHL1  می‏شود و احتمالا این کاهش بیان به‏وسیله هیپرمتیلاسیون در پروموتر ژنFHL1  ایجاد می‏شود. یعنی کاهش بیان RASSF1A با کاهش بیانFHL1  هماهنگ است. بنابراین توصیه می‏شود که ارتباط هیپرمتیلاسیون بین دو ژنRASSF1A  باFHL1  در تحقیقات بعدی مورد بررسی بیشتری قرار گیرد.

1. Howlader N, Noone AM, Krapcho M, Neyman N, et al. Editors.SEER Cancer Statistics Review, 1975- 2009 (Vintage 2009 Populations), National Cancer Institute [Internet]. 2012 Apr [cited 2018 Jan 15].

2. Tuttle RM, Ball DW, Byrd D, Dilawari RA, et al. NationalComprehensive Cancer Network. Thyroid carcinoma. J Natl Compr Canc Netw. 2010; 8(11): 1228-74.

3.Taghavi Kojidi H, Farzadfar F, Peykari N, Larijani B, et al. A comprehensive study on national and sub national trend in thyroid cancer prevalence in the Iranian population, 1990-2010. Iran J Diabetes Metab. 2016; 15(2): 91-100.

4. Lee, JH, Lee ES, Kim YS. Clinicopathologic significance of BRAF V600E mutation in papillary carcinomas of the thyroid: a meta-analysis. Cancer. 2007; 110(1): 38-46.

5. Kebebew E, Peng M, Reiff E, Duh QY, et al. Diagnostic and prognostic value of angiogenesis-modulating genes in malignant thyroid neoplasms. Surgery. 2005; 138: 1102-9; discussion 1109-10.

  1. 6.  Dammann RC, Li JH, Yoon PL, Chin S, et al. Pfeifer, Epigenetic inactivation of a RAS association domain family protein from the lung tumour suppressor locus 3p21.3. Nat Genet. 2000. 25(3): 315-9.
7. Shivakumar L, Minna J, Sakamaki T, Pestell R, et al. The RASSF1A tumor suppressor blocks cell cycle progression and inhibits cyclin D1accumulation. Mol Cell Biol. 2002; 22: 4309-18.

8. Nakamura N, Carney JA, Jin L, Kajita S, et al. Rassfia and noreia methylation and BRAFV600E mutations in thyroid tumors. Lab Invest. 2005; 85(9): 1065-75.

9. Pfeifer GP, Dammann R. Methylation of thetumor suppressor gene RASSF1A in human tumors. Biochemistry (Mosc), 2005; 70(5): 576-83.

10. Ding L, Wang Z, Yan J, Yang X, et al. Human four-and-a-half LIM family members suppress tumor cell growth through a TGF-beta-like signaling pathway. J ClinInvest. 2009; 119: 349-61.

11. Fryknas MU, Wickenberg-Bolin H, Goransson MG, et al. Molecular markers for discrimination of benign and malignant follicular thyroid tumors. Tumour Biol, 2006; 27(4): 211-20.

12. Asa SL. The role of immunohistochemical markers in the diagnosis of follicular-patterned lesions of the thyroid. Endocr Pathol. 2005; 16(4): 295-309.

13. Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997; 25(12): 2532-4.

14. Soares P, Maximo V, Sobrinho-Simoes M. Molecular pathology of papillary, follicular and Hurthle cell carcinomas of the thyroid. Arkh Patol, 2003; 65: 45-7.

15. Segev DL, Umbricht C, Zeiger MA. Molecular pathogenesis of thyroid cancer. Surg Oncol. 2003; 12(2): 69-90.

16. Dammann R, Li C, Yoon JH, Chin PL, et al. Epigenetic inactivation of a RAS association domain family protein from the lung tumour suppressor locus 3p21.3. Nat Genet. 2000; 25(3): 315-9.

17. Dreijerink K, Braga E, Kuzmin I, Geil L, et al. The candidate tumor suppressor gene, RASSF1A, from human chromosome 3p21.3 is involved in kidney tumorigenesis. Proc Natl Acad Sci U S A. 2001; 98(3): 7504-9.

18. Shivakumar LJ, Minna T, Sakamaki R, Pestell R, et al. The RASSF1A tumor suppressor blocks cell cycle progression and inhibits cyclin D1accumulation. Mol Cell Biol. 2002; 22(12): 4309-18.

19. Schagdarsurengin UO, Gimm C, Hoang-Vu H, Dralle GP, et al. Frequent epigenetic silencing of the CpG island promoter of RASSF1A in thyroid carcinoma. Cancer Res. 2002; 62(13): 3698-701.

20. Xing M, Cohen Y, Mambo E, Tallini G, et al. Early occurrence of RASSF1A hypermethylation and its mutual exclusion

 

with BRAF mutation in thyroid tumorigenesis. Cancer Res. 2004; 64(5): 1664-8.

21. Ruebel KH, Jin L, Qian X,  Scheithauer BW, et al. Effects of DNA methylation on galectin-3 expression in pituitary tumors. Cancer Res. 2005; 65(4): 1136-40.

22. Burbee DG, Forgacs E, Zochbauer-Muller S, Shivakumar L, et al. Epigenetic inactivationof RASSF1A in lung and breast cancers and malignant phenotype suppression. J Natl Cancer Inst. 2001; 93(9): 691-9.

23. Nakamura N, Carney JA, Jin L, Kajita S, et al. RASSF1A and NORE1A methylation and BRAFV600E mutations in thyroid tumors. Lab Invest. 2005; 85(9): 1065-75.

24. Trovisco V, Soares P, Sobrinho-Simoes M. B-RAF mutations in the etiopathogenesis, diagnosis, and prognosis of thyroid carcinomas. Hum Pathol. 2006; 37(7): 781-6.

25. Sakashita K, Mimori K, Tanaka F, Kamohara Y, et al. Clinical significance of loss of Fhl1 expression in human gastric cancer. Ann Surg Oncol. 2008; 15(8): 2293-300.

26. Hu S, Liu D, Tufano RP, Carson KA, et al. Association of aberrant methylation of tumor suppressor genes with tumor aggressiveness and BRAF mutation in papillary thyroid cancer. Int J Cancer. 2006; 119(10): 2322-9.

27. Strunnikova M, Schagdarsurengin U, Kehlen A, Garbe JC, et al. Chromatin inactivation precedes de novo DNA methylation during the progressive epigenetic silencing of the RASSF1A promoter. Mol Cell Biol. 2005; 25(10): 3923-33.

28. Ding L, Wang Z, Yan J, Yang X, et al. Human four-and-a-half LIM family members suppress tumor cell growth through a TGF-beta-like signaling pathway. J Clin Invest. 2009; 119(2): 349-61.