بررسی اثر بیسفنول A بر تمایز استئوژنیک در سلول‌های بنیادی مزانشیم مغز استخوان رت بالغ: یک مطالعه‌ی آزمایشگاهی

نوع مقاله: علمی - پژوهشی

نویسندگان

دانشگاه اراک، دانشکده علوم پایه، گروه زیست شناسی، اراک، ایران

چکیده

هدف: هدف از این مطالعه، بررسی اثر بیسفنول A بر تمایز استئوژنیک در سلول‌های بنیادی مزانشیم مغز استخوان مستخرج از رت بالغ بود.
مواد و روش‏ها: سلول‌های بنیادی مزانشیم مغز استخوان رت، با استفاده از روش فلشینگ استخراج شدند. در انتهای پاساژ سوم، سلول‌ها به گروه‌های کنترل و تیمار شده با غلظت‌های مختلف بیسفنول A (1، 5، 10، 50، 100، 250، 500، 1000، 2000 و 4000 نانومولار) برای مدت 21 روز، در محیط استئوژنیک حاوی 10 درصد سرم جنین گاوی، تقسیم شدند. سپس نسبت معدنی شدن ماتریکس استخوانی، میزان کلسیم خارج سلولی، سطح بیان پروتئین‌های استئوپونتین و استئوکلسین، طی روند تمایز استئوژنیک مورد بررسی قرار گرفت. داده‌ها با روش آماری آنالیز واریانس یک‌طرفه مورد تجزیه و تحلیل قرار گرفت و تفاوت میانگین‌ها در سطح 05/0>p معنی‌دار در نظر گرفته شد.
نتایج: کاهش معنی‌دار در میزان معدنی شدن ماتریکس استخوانی، سطح کلسیم، سطح بیان و سنتز استئوکلسین و استئوپونتین در گروه سلول‌های تیمار شده با بیسفنول A در  مقایسه با گروه کنترل، در یک رفتار وابسته به غلظت مشاهده شد (05/0>p). 
نتیجه‏گیری: این نتایج نشان داد که بیسفنولA، به‏عنوان یک آلاینده زیست محیطی، یک کاهش معنی‌دار در تمایز استئوژنیک در سلول‌های بنیادی مزانشیمی مغز استخوان رت ایجاد کرد؛ بنابراین، بیسفنولA می‌تواند به‌عنوان یک عامل کاهش‌دهنده در تمایز سلولی در نظر گرفته شود.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

سلول‌های بنیادی مزانشیم مغز استخوان سلول‌های پرتوانی است که به‏راحتی استخراج، تخلیص و تکثیر شده و توانایی تمایز به انواعی ازسلول‌ها نظیر سلول‌های استخوانی، غضروفی و چربی را دارا می‏باشند و می‌توان از آن‌ها درپیوندهای اتولوگ استفاده کرد. این سلو‌ل‌ها علاوه بر مغز استخوان در بافت‌هایی نظیر بافت چربی، پرده سینوویال و عضله اسکلتی نیز یافت می‏شوند (2-1). ازآنجایی‌که سلول‌های بنیادی مزانشیم مغز استخوان در تماس مستقیم با خون محیطی بوده و همچنین به‏علت داشتن پتانسیل بالای تمایزی و توان تکثیر برای مدت طولانی، این رده از سلول‌های بنیادی، می‌تواند یک انتخاب مناسب برای بررسی اثرمواد سمی و آلاینده‌‌ها برروی خواص بنیادین، میزان تکثیر و تمایز سلولی محسوب شود (3).

از سوی دیگر امروزه در جوامع صنعتی، انسان و دیگر موجودات زنده به‌طورمستقیم و غیرمستقیم در معرض آلاینده‌های زیست محیطی بسیاری قرار دارند. یکی از مهم‌ترین این آلاینده‌های محیطی، بیسفنول A می‌باشد که ورود آن به چرخه‌های غذایی طی30 سال اخیر به‌طور فزاینده‌ای افزایش یافته است (4).

بیسفنول  Aیا 2-2، بیس‌هیدروکسی‌فنل‌پروپان، مهم‌ترین الیل‌فنلی است که امروزه در صنایع بسته‌بندی غذایی کاربرد دارد (5). این آلاینده صنعتی به‌عنوان یک زنواستروژن محیطی شناخته می‌شود و به‏دلیل داشتن اثرات استروژنیک روی سیستم تولیدمثل، جزء مخرب‌های اندوکرینی نیز طبقه‌بندی می‌شد (6). بیسفنولA به‏طور وسیع در تولید انواع مواد و وسایل پزشکی از جمله لنزهای چشمی و کامپوزیت‌های دندانپزشکی و همچنین ظروف یک‌بار مصرف،پوشش داخلی قوطی‌های کنسرو، بطری‌ آب معدنی، شیشه‌ تغذیه اطفال، پلاستیک‌های(polyvinyl chloride) PVC ، پلی‌کربنات‌ها و غیره استفاده می‌شود (8-7) و می‌تواند از طریق آب، هوا و غذا وارد زنجیره غذایی انسان ‌شد (12-9).

طبق مطالعات صورت گرفته توسط Yang و همکارانش، اثرسیتوتوکسیسیتی بیسفنولA بر تمایزسلول‌های بنیادی جنینی انسان به‏سلول‌های اپی‌تلیال بررسی شده (13) ولی باوجود اهمیت سلول‌های بنیادی مزانشیم مغز استخوان به‏عنوان یک ذخیره با ارزش در جایگزینی سلول‌های استخوانی به‏هنگام صدمات بافتی، تاکنون اثر این آلاینده زیست محیطی بر تمایز این سلول‌ها به استئوبلاست گزارش نشده است.

بنابراین با توجه به ‏کاربرد گسترده بیسفنولA در محیط زیست و ورود آن به زنجیره غذائی طی 30 سال اخیر و تهدید سلامت انسان، این مطالعه با هدف بررسی اثر سمیت بیسفنول A بر میزان تمایز استئوژنیک در سلول‌های بنیادی مزانشیم مغز استخوان رت بالغ به‏عنوان یک مدل آزمایشگاهی طراحی شد.

 

مواد و روش‌ها

جداسازی وکشت سلول‌های مغز استخوان: در این مطالعه تجربی از رت‌های نژاد Wistar با سن 50 روز و وزن 20±140 گرم استفاده شد. حیوانات مورد استفاده در این پژوهش پس از خریداری از انستیتو پاستور ایران در خانه حیوانات دانشگاه اراک در شرایط استاندارد دمائی 3±27 درجه سانتی‏گراد و با دسترسی آزاد به ‏غذا و آب در قفس‏های پلی‏اتیلین نگه‫داری شد. در این پژوهش کلیه اصول اخلاقی کار با حیوانات آزمایشگاهی رعایت شده است. رت­ها به‏کمک دی‏اتیلن‏اتر بی‫هوش شده، استخوان‌های ران و ساق پای آن‌ها جدا و سپس بافت‌های پیوندی اطراف استخوان‌ها به‏طورکامل پاک شد. استخوان‌ها در محیط کشت  DMEM (Dulbecco’s Modified Eagles Medium ، Gibco، Germany) حاوی 15 درصد سرمFBS  (Fetal Bovine Serum، Gibco، Germany) و پنی‌سیلین-استرپتومایسین (تهیه شده از شرکت Gibco، Germany) در دمای 4 درجه سانتی‌گراد قرار گرفته و به زیر هود لامینار منتقل شد. دو سر استخوان با قیچی استریل قطع و مغز استخوان با عمل فلاشینگ خارج و به داخل لوله فالکون حاوی محیط کشت کامل هدایت و سپس به‏مدت 5 دقیقه در  rpm1200 سانتریفیوژ شد. محیط رویی خارج و رسوب سلولی در یک میلی‌لیتر محیط کشت تازه معلق شد و در فلاسک کشت T25 و در انکوباتور CO2‌دار (دمای 37 درجه سانتی‫گراد و 5 درصد CO2) انکوبه شد. پس از 24ساعت محیط رویی که حاوی سلول‌های غیرچسبنده بود، خارج و شستشوی سلول‌ها با PBS انجام شد.سپس به‏مدت دو هفته، هر سه روز یک‫بار محیط کشت سلول‌ها تعویض شد. زمانی‏که کف فلاسک به تراکم بالایی ازسلول رسید، سلول‌ها با کمک Trypsin/EDTA (تهیه شده از شرکت Sigma-Aldrich) ازکف فلاسک جدا و به فلاسک‏های جدید منتقل شدند. برای به‫دست ‏آوردن خلوص بالایی از این سلول‌ها سه مرحله پاساژ تکرار شد.

کشت سلول‌ها در غلظت‌های مختلف بیسفنول A و اندازه‏گیری میزان معدنی شدن ماتریکس استخوانی: سلول‌های پاساژ سوم به‏تعداد103×5 سلول در هر خانه‌ی پلیت 24 خانه ای به‏مدت 24 ساعت کشت و پس از چسبیدن این سلول‌ها به کف در حضور گروه‌کنترل (محیط استئوژنیک: محیط DMEM حاوی 10 درصد سرم گاوی، 10 میلی‫مولار بتاگلیسرول فسفات،10 نانومولار دگزامتازون و 50 میکروگرم در میلی‌لیتر آسکوربیک 3-فسفات) و غلظت‌های 1، 5، 10، 50، 100، 250، 500، 1000، 2000 و 4000 نانومولار بیسفنول A (تهیه شده از شرکت Sigma-Aldrich) در محیط استئوژنیک کشت شد (14). پس از 21 روز، میزان معدنی شدن ماتریکس استخوانی سلول‌ها با روش کمی و کیفی آلیزارین‌رد ارزیابی شد.  برای انجام این روش محیط کشت رویی برداشته و سلول‌ها با فرمالین 10 درصد فیکس شد و سپس با محلول رنگی آلیزارین‏رد(Sigma, St. Louis, MO, USA)  رنگ‌آمیزی شد. سلول‌ها با آب‏مقطر شستشو و سپس اسیداستیک 10 درصد به سلول‌ها افزوده و بدین ترتیب رنگ قرمز آلیزارین‌رد از ماتریکس استخوانی استخراج شد و با استفاده از میکروسکوپ نوری عکس‌برداری نمونه‌ها انجام شد. در پایان جذب محلول‌های قرمز رنگ حاصل در طول موج 405 نانومتر با دستگاه اسپکتروفوتومتر(PGplus-Germany) ثبت شد (14).

انتخاب غلظت موثر و بررسی‌های بیشتر: با توجه به‏نتایج به‏دست آمده از تکنیک رنگ‌آمیزی آلیزارین‌رد، 250 نانومولار بیسفنولA  به‏عنوان غلظت موثر انتخاب شد و مطالعه با دو گروه کنترل و تیمار با بیسفنول A (250 نانومولار) ادامه یافت.

بررسی میزان رسوب کلسیم خارج سلولی (وان کوزا): رنگ‌آمیزی و انکوزا با استفاده از نیترات نقره میزان رسوبات کلسیم ماتریکس خارج سلولی را نشان می‌دهد. جهت اندازه‌گیری میزان کلسیم موجود در ماتریکس خارج سلولی، سلول‌های بنیادی مزانشیم تمایز نیافته‌ی پاساژ سوم به‏تعداد 104×1 در هر ویال پلیت 24 خانه، با کمک فرمالدئید 10 درصد به‏مدت 10 دقیقه فیکس شدند و پس از شستشو با PBS، 500 میکرولیتر نیترات نقره (Sigma Chemical) 1/0 درصد به سلول‌ها اضافه شد و در انتها، بررسی سلول‌ها با میکروسکوپ فلورسانس (Olympus, IX70) انجام شد (15).

بررسی سنتز پروتئین‌های استئوکلسین و استئوپونتین به‏روش ایمونوسیتوشیمی:ابتدا 104×1 سلول در هر خانه از پلیت 12 خانه ریخته و به‏مدت 21 روز سلول‌ها در گروه­های مذکور، تیمار شد. پس از 21 روز سلول‌ها در پارافرمالدهید فیکس و پس از شستشو با PBS، جهت افزایش نفوذپذیری، سلول‌ها با 10 دقیقه با Triton-x100 (T8532, Sigma) 25درصد انکوبه شد. سپس سلول‌ها با سرم آلبومین گاوی (BSABovine Serum Albumin) 1 درصد در PBST (1/0 درصد PBS-Tween) ( Phosphate Buffered Saline Tween) به‏مدت 30 دقیقه انکوبه شد. در ادامه آنتی بادی اولیه رقیق شده در BSA 1 درصد و PBST (آنتی‌بادیپلی‌‍‌کلونال استئوپونتین از شرکت (ab8448, ABCAM  با رقت 1:250 و آنتی‌بادی مونوکلونال موشی استئوکلسین (شرکت ab13418, ABCAM و با رقت 1:1000) به‏مدت 4 ساعت، روی سلول‌ها قرار داده شد و پس از آن آنتی بادی ثانویه خرگوش (هر دو نوع آنتی‌بادی 555Alexa Fluor®-United Kingdom و با رقت 1:500) در دمای 4 درجه سانتی‌گراد روی سلول‌ها ریخته شد. سپس رنگ­آمیزی هوخست u/μl) 1-1/0) صورت گرفت (16) و با میکروسکوپ فلورسانس عکس‌برداری انجام شد.

 

استخراج RNA و آنالیزRT-PCR

کشت سلولی و جداسازیRNA: در این مرحله سلول‌ها به‏تعداد 102×5 در فلاسک‌های T شکل ‫Cm225 کشت و به‏مدت 21 روز با محیط استئوژنیک و غلظت 250 نانومولار بیسفنولA کشت و تیمار شدند و سپس با کمک اسکالپر، سلول‌ها از کف فلاسک تراشیده و به اپندورف منتقل شدند. سلول‌ها در ازت مایع به فریزر80- درجه سانتی‌گراد انتقال یافتند. جهت جداسازی RNAاز این سلول‌ها از کیتRNeasy mini kit (Qiagen)  و بر طبق دستوالعمل کارخانه سازنده استفاده شد و به‏منظور سنجش میزان RNA استخراج شده از دستگاه اسپکتروفتومتر استفاده شد و پس از صفر کردن دستگاه توسط آب دیونیزه به‏عنوان blank، 3 میکرولیتراز نمونه با 97 میکرولیتر آب دیونیزه رقیق و پس از وارد کردن ضریب رقت، مقدار RNA  استخراج شده و همچنین نسبت بین جذب در طول موج‏های 260 و 280 ثبت شد. تمامی مراحل در زیر هود لامینار صورت گرفت.

سنتز (reverse transcription reaction) c-DNA: ابتدا 2 میکرولیتر از عصاره سلولی حاوی RNA (با غلظتμg/μl  5/0) برداشته شد. به‏هرکدام از اپندورف‌ها 1 میکرولیتر پرایمر oligo dT18 اضافه و حدود 3-5 ثانیه نمونه را ورتکس شد. سپس نمونه‌ها به‏مدت 5 دقیقه در 70 درجه سانتی‌گراد قرار داده شد و پس از آن روی یخ نگه‏داشته شد. در ادامه 4 میکرولیتر 5x reaction buffer، 1 میکرولیتر مهارکنندهu/μl) 20) RNase Ribo Lock، 1 میکرولیتر از مخلوط dNTP به‏نمونه‌ها اضافه شد. پس از یک ورتکس کوتاه، 2 میکرولیتر آنزیم رونویسی معکوس u/μl) 20) M-MuLV به اپندورف‌ها اضافه و به‏مدت 5 دقیقه در دمای 37 درجه سانتی‌گراد قرار داشته شد و جهت متوقف کردن واکنش، نمونه‌ها در دمای 70 درجه سانتی‏گراد انکوبه شد. در پایان نیز اپندورف‌ها در دمای 20- درجه سانتی‌گراد نگه‏داری شد.

واکنش زنجیره پلی‌مراز (PCR):واکنش RT-PCR در حجم 25 میکرولیتر و با دمای آنیلینگ برابر با 58 درجه سانتی‌گراد، در 35 سیکل صورت گرفت و از ژنGAPDH  (Glyceraldehyde 3-phosphate dehydrogenase) به‏عنوان کنترل داخلی استفاده شد. توالی پرایمر ژن‏های مورد نظر در جدول 1 آورده شده است.

 


جدول 1: توالی پرایمرهای استفاده شده در این مطالعه

Gene

 

Primer sequences (5′-3′)

Product size

(bp)

 

GAPDH

 

Forward     TGATTCTACCCACGGCAAGTT

Reverse      TGATGGGTTTCCCATTGATGA

 

162 bp

 

Osteocalcin

 

 

Forward      CGCCTGGGTCTCTTCACTAC

Reverse      CTCACACTCCTCGCCCTATT

 

143 bp

 

Osteopontin

 

 

Forward       TTGCAGCCTTCTCAGCCAA

Reverse        GGAGGCAAAAGCAAATCACTG

 

74 bp

 


آنالیز آماری

داده‌های به‏دست آمده با استفاده از آزمون آماری One-Way ANOVA، تست Tukey و همچنینT-Test ، تجزیه و تحلیل و تفاوت میانگین‌ها در سطح 05/0>p معنی‌دار در نظر گرفته شد.

 

نتایج

 

 

بررسی میزان معدنی شدن ماتریکس استخوانی سلول­ها و انتخاب غلظت موثر

از مقایسه روند میزان معدنی شدن ماتریکس استخوانی در سلول‌های بنیادی مزانشیم مغزاستخوان تیمارشده با غلظت‌های مختلف بیسفنول A، پس از‌ 21 روز، در شرایط وابسته به غلظت، نسبت به گروه کنترل، کاهش معنی‌داری مشاهده شد (05/0>p) (نمودار 1) (شکل1، C-D).


                       

نمودار 1: میانگین میزان معدنی شدن ماتریکس استخوانی سلول‌های بنیادی مزانشیم مغز استخوان رت پس ازتیمار با غلظت‌های مختلف بیسفنول A در روز 21.

میانگین‌های با کد حرف‌های مختلف دارای تفاوت معنی‌دار هستند (one way ANOVA,Tukey,s test, p<0.05).

 

 

با توجه به نتایج حاصل از میزان معدنی شدن ماتریکس استخوانی سلول‌ها، غلظت 250 نانومولار بیسفنولA طی 21 روز، به‌عنوان غلظت موثر انتخاب شد و مطالعه با دو گروه کنترل و تیمار با بیسفنول A (250 نانومولار) ادامه یافت.

بررسی رسوب کلسیم به روش وان­کوزا  (Von Kossa)

مقایسه تصاویر حاصل از بررسی میزان رسوب کلسیم ماتریکس خارج سلولی توسط رنگ­آمیزیVon Kossa  پس از 21 روز در گروه سلول‌های تیمار شده با 250 نانومولار بیسفنولA، کاهش قابل توجه سطح رسوب کلسیم را نسبت به‏گروه کنترل نشان داد (شکل1،A-B ). (در رنگ‌آمیزی آلیزارین ‌رد، رنگ قرمز نشان‏دهنده معدنی شدن ماتریکس استخوانی در سلول‌های تمایز یافته به استئوبلاست و در رنگ‌آمیزی وان‌کوزا، ندول‌های قهوه‌ای رنگ، نشان‌دهنده رسوبات فسفات کلسیم حاصل از معدنی شدن ماتریکس خارج سلولی درسلول‌های تمایز یافته می‌باشند).

 

 

 

شکل1: رنگ‌آمیزی سلول‌های بنیادی مزانشیم مغز استخوان رت با نیترات نقره (وان‌کوزا) (AوB) (بزرگنماییx200) و رنگ آلیزارین‌رد (C, D) (بزرگنمایی10x).A, C) گروه سلول‌های کنترل. B, D) سلول‌های تیمارشده با 250 نانومولار بیسفنول A.

 

 

ایمنوسیتوشیمی

از مقایسه رنگ‌آمیزی ایمنوسیتوشیمی،کاهش قابل توجهی در میزان سنتز پروتئین‌های استئوکلسین و 

 

 

استئوپونتین درگروه سلول‌های تیمارشده بابیسفنولA  نسبت به گروه کنترل مشاهده شد (شکل2).

 

 

 

شکل2: ایمنوسیتوشیمی، ]پروتئین‌های استئوکلسین A). گروه کنترل B). گروه سلول‌های تیمارشده با 250 نانومولار بیسفنولA . به‌مدت 21 روز، (بزرگنماییx400)[ و ]استئوپونتینC ) گروه کنترل D) گروه سلول‌های تیمارشده با بیسفنولA، (بزرگنماییx200) [چنانچه مشاهده می‌شود از مقایسه میزان سنتز پروتئین‌های مذکور در گروه سلول‌های تیمارشده با بیسفنول A نسبت به گروه کنترل، کاهش قابل توجهی دیده شد.

 


آنالیز کیفی سطح بیان ژن‌های استئوکلسین و استئوپونتین

بررسی میزان سطح بیان ژن‌های استئوکلسین و استئوپونتین توسط آنالیزRT-PCR در گروه سلول‌های   تیمار شده با بیسفنولA نسبت به گروه کنترل، کاهش قابل توجهی را نشان داد (شکل3).

 

 

 

 

شکل3: آنالیزکیفی سطح بیان ژن‌‍‌های استئوکلسین و استئوپونتین در سلول‌های بنیادی مزانشیم مغز استخوان رت، 21 روز پس از تیمار با بیسفنول A با استفاده از تکنیک RT-PCR. A) گروه کنترل. B)گروه سلول‌های تیمارشده با بیسفنول A (250 نانومولار)، نشان‌دهنده کاهش قابل توجه سطح بیان ژن‌های مذکور نسبت به گروه کنترل می‌باشد. ژن GAPDH به‏عنوان کنترل داخلی در نظر گرفته شده است.

 

 


بحث

در مطالعه حاضر بیسفنولA باعث کاهش سطح رسوبات فسفات کلسیمی ماتریکس خارج سلولی و درنتیجه مهار تمایز استئوژنیک در سلول‌های بنیادی مزانشیم مغز استخوان شد. این یافته‌ها در راستای نتایج تحقیقات دیگر محققین نیز می‌باشد.

به‌عنوان مثال Hwang و همکاران در سال 2013 اثر بیسفنول A (5/12-5/0 میکرومولار) را بر سلول‌های ماکروفاژ ردهRAW264.7  و سلول‌های رده MC3T3-E1 موش مورد بررسی قرار دادند و مشاهده کردند که بیسفنولA  در پروسه‌ی تمایز استئوبلاست و استئوکلاست‌ها باعث کاهش بیان ژن‌هایRunx2  و osterix به‏همراه  Wnt/β-cateninمی‌شود (17).

پروتئینRunx2یک تنظیم‌کننده ضروری برای فرآیند استئوبلاستوژنزیس و تنظیم توده استخوانی می‌باشد (18). بیسفنول A هم از طریق مهار مسیر سیگنال‏دهی wnt/β–Catenin باعث مهار بیان ژن‌های Runx2، osterix،آلکالین فسفاتاز (ALP) و رسوب کلسیم می‌شود. فرایند تمایز استئوژنیک، فرآیندی وابسته به مسیر سیگنالینگ wnt می باشد و β–Catenin هم یک

 

پروتئین ضروری برای تمایز استئوبلاست و تنظیم توده‏ی استخوانی است. در این مسیر، کمپلکس  wntباعث ایجاد کمپلکس بتاکاتنین و فاکتور Tcf/Lef در سلول شده و این کمپلکس باعث افزایش سطح کلسیم می‌شود. اما بیسفنولA با تولید رادیکال‌های آزاد و اثر بر فاکتور رونویسیFoxO باعث تخریب کمپلکس بتاکاتنین و فاکتور رونویسی Tcf/Lef می‌شود به‏دنبال آن با آزاد شدن بتاکاتنین، کمپلکس FoxO/β – Catenin تشکیل می‌شود، که تشکیل این کمپلکس، سبب مهار مسیر wnt شده و در نتیجه باعث  مهار بیان ژن Runx2 و تشکیل کلسیم می‌شود (19).

بنابراین بیسفنول A بدین طریق و با مهار مسیر سیگنال‌دهی wnt، میزان رسوبات فسفات کلسیمی ماتریکس خارج سلولی و در نتیجه تمایز استئوژنیک را در سلول‌های بنیادی مزانشیم مغز استخوان مهار می‏کند.

در این پژوهش سطح بیان ژن‌های استئوکلسین، استئوپونتین و همچنین میزان سنتز پروتئین‌های استئوکلسین و استئوپونتین که در تشکیل و حفظ شبکه استخوانی، افزایش معدنی شدن ماتریکس استخوانی و تمایز استئوژنیک نقش اساسی دارند و برای معدنی شدن بافت استخوان ضروری می‌باشند (20-21)، نیز مورد بررسی قرار گرفت. از آنجاکه این فاکتورهای پروتئینی، خود به‏واسطه‌ی پروتئینRunx-2 بیان می‌شوند و طبق مطالعات صورت گرفته بیسفنولA هم از طریق مهار مسیر سیگنال‌دهی باعث کاهش سطح بیان ژن Runx-2، می‌شود ( 20، 22)، بنابراین بیسفنول A به‌طور غیرمستقیم و با مهار بیان ژن‌ Runx2 و کاهش سطح رسوب کلسیم، باعث کاهش سطح بیان و میزان سنتز پروتئین‌های استئوپونتین و استئوکلسین که ازمهم‌ترین شاخص‌های تمایز استئوژنیک هستند نیز می‌شود (23، 24).

بنابراین نتایج ما پیشنهاد می‌کند که بیسفنول A باعث سرکوب تمایز استئوژنیک در سلول‌های بنیادی مزانشیم مشتق از مغز استخوان رت بالغ می‌شود.

 

نتیجه­گیری

بیسفنولA، به‏عنوان یک آلاینده زیست محیطی و همچنین یک مخرب اندوکرینی، قادر است موجب مهار استئوبلاستوژنزیسو در نتیجه تشکیل استخوان در سلول‌های بنیادی مزانشیم مغز استخوان شود. بنابراین بر اساس نتایج این مطالعه، پیشنهاد می‌شود که در زمینه ارتباط بین بیماری‌های استخوانی ازجمله استئوپروزیس و سمیت بیسفنولA مطالعه و تحقیقات بیشتری در جوامع انسانی صورت گیرد.

 

تشکر و قدردانی

با تشکر از حوزه معاونت محترم پژوهش و فناوری دانشگاه اراک که با پشتیبانی، انجام این پروژه تحقیقاتی را امکان‌پذیر نمودند.

 

Eslaminejad MB. Mesenchymal Stem Cell: Isolation and biology. J Iran Anat Sci. 2007; 5: 61-73.##Abnosi MH, Soleimani Mehranjani M, Shariatzadeh SMA, Mahdiyeh M, et al. The effect of long term treatment oflowest effective dose of para-nonylphenolon viability, morphology and proliferation of rat bone marrow mesenchymal stem cells. Physiol Pharmacol. 2011; 15(3): 308-317##Kermani S, Karbalaie K, Madani H, Jahangirnejad AA, et al. Bone marrow mesenchymal stem cells as a suitable model for assessment of environmental pollution. J Arak Univ Med Sci. 2008; 11: 117-125.##Goetz NV, Wormuth M, Scheringer M, Hungerbühler K. Bisphenol a: how the most relevant exposuresources contribute to total consumer exposure. Risk Anal. 2010; 30(3): 473-87.##Terasaka H, Kadoma Y, Sakagami H, Fujisawa S. Cytotoxicity and apoptosis-inducing activity of Bisphenol A and hydroquinone in HL-60 cells. Anticancer Res. 2005; 25: 2241-2248.##Wang SW, Kim JM, Hwang KG. Effect of gestational exposure to Bisphenol A on neuronal stem cell differentiation in the neonatal rat hippocampus. J Korean Child Neurol Soc. 2011; 19(3): 218-230.##Cabado AG, Aldea S, Porro C, Ojea G, et al. Migration of BADGE (bisphenol A diglycidyl-ether) and BFDGE (bisphenol F diglycidyl-ether) in canned sea­food. Food Chem Toxicol. 2008; 46(5): 1674–1680.##Cao XL, Dufresne G, Clement G, Belisle S, et al. Levels of bisphenol A diglycidyl ether (BADGE) and bisphenol F diglycidyl ether (BFDGE) in canned liquid infant formula products in Canada and dietary intake estimates. J AOAC Int. 2009; 92(6): 1780–1789.##Kuo HW, Ding WH. Trace determination of bisphenol A and phytoestrogens in infant formula powders by gas chromatography-mass spectrometry. J Chromatogr Sci. 2004; 1027: 67–74.##Munguia-Lopez EM, Gerardo-Lugo S, Peralta E, Bolumen S, et al. Migration of bisphenol A (BPA) from can coatings into a fatty-food stimulant and tuna fish. Food Addit Contam. 2005; 22(9): 892–898.##Thomson BM, Grounds PR. Bisphenol A in canned foods in New Zealand: an exposure assessment. Food Addit Contam. 2005; 22(1): 65–72.##Wolfgang D, Wolfgang V. Human exposure to bisphenol A by biomonitoring: methods, results and assessment of environmental exposures. Toxicol Appl Pharmacol. 2008; 228: 114–134.##Yang L, Luo L, Ji W, Gong C, et al. Effect of low dose bisphenol A on the early differentiation of human embryonic stem cells into mammary epithelial cells. Toxicol Lett. 2013; 26: 218(3):187-93. ##Soleimani Mehranjani M, Mosavi M. Cadmium chloride toxicity suppresses osteogenic potential of rat bone marrow mesenchymal stem cells through reducing cell viability and matrix mineralization. Indian J Med Res. 2011; 67(4): 157-167.##Soleimani Mehranjani M, Azimi AS. In vitro study of the effect of vitamin e on viability, morphological changes and induction of osteogenic differentiation in adult rat bone marrow mesenchymal stem cells. J Shahid Sadoughi Univ Med Sci 2014; 22(4): 1406-18.##Juhasova J, Juhas S, Klim J, Strnadel J, et al. Osteogenic differentiation of miniature pig mesenchymal stem cells in 2d and 3d environment. Physiol Res. 2011; 60(3): 559-571.##Hwang JK, Min KH, Choi KH, Hwang YC, et al. Bisphenol A reduces differentiation and stimulates apoptosis of osteoclasts and osteoblasts. Life Sci. 2013; 93(9-11): 367-372.##Westhauser F, Karadjian M, Essers C, Senger AS, et al. Osteogenic differentiation of mesenchymal stem cells is enhanced in a 45S5- supplemented β-TCP composite scaffold: an in-vitro comparison of Vitoss and Vitoss BA. PloS One. 2019; 14(2): e0212799.##Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, et al. Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem. 2005; 30: 280(39): 33132-40.##Ahn KH, Jung HK, Jung SE, Yi KW, et al. Microarray Analysis of Gene Expression During Differentiationof Human Mesenchymal Stem Cells Treated withVitamin E in vitro into Osteoblasts. Korean J of bone metab. 2011; 18(1): 23-32.##Tsai MT, Lin YS, Chen WC, Ho CH, et al. Runx2 and Osterix gene expression in human bone marrow stromal cells are mediated by far-infrared radiation. Proc World Cong Eng. 2011; 3: 1-5.##Bae HK, Jung BD, Lee S, Park CK, et al. Correlation of spontaneous adipocyte generation with osteogenic differentiation of porcine skin-derived stem cells. J Vet Sci. 2019; 20(1): 16-26.# Birmingham E, Niebur GL, McHugh PE, Shaw G, et al. Osteogenic differentiation of mesenchymal stem cells is regulated by osteocyte and osteoblast cells in a simplified bone niche. Eur cell Mater. 2012; 23: 13-27.##Gilbert L, He X, Farmer P, Rubin J, et al. Expression of the osteoblast differentiation factor RUNX2 (Cbfa1/AML3/PebpαA) is inhibited by tumor necrosis factor-α. Journal of Biological Chemistry. 2002; 277(4): 2695-2701.