بررسی اثرداروی تاموکسیفن برروی بیان ژنCTNNBIP1 در سلول‏های بنیادی سرطانی مشتق شده از رده‏ی سلولیMKN-45

نوع مقاله: علمی - پژوهشی

نویسندگان

- دانشگاه رازی، دانشکده علوم، گروه زیست شناسی، کرمانشاه، ایران

چکیده

هدف: هدف از این تحقیق بررسی اثر غلظت‏های مختلفی از داروی تاموکسیفن بر روی بیان ژن  CTNNBIP1در سلول‌های بنیادی سرطانی مشتق شده از رده‌ی سلولیMKN-45 مربوط به سرطان معده به‌عنوان یک پتانسیل درمانی است.
مواد و روشها: در این تحقیق بقای سلول را با استفاده از تست تریپان بلو ارزیابی شد. پس از به‏دست آوردن IC50 سلول‌های بنیادی سرطانی مورد نظر را با غلظت مشخص دارو طی 48 ساعت تیمار دادیم. با توجه به این اطلاعات به بررسی اثر غلظت‏های مختلفی از داروی تاموکسیفن بر روی بیان ژن  CTNNBIP1در سلول‌های بنیادی سرطانی مشتق شده از رده‌ی سلولیMKN-45 مربوط به سرطان معده به‌عنوان یک پتانسیل درمانی پرداخته شد.
نتایج: آنالیز داده‌های Real-time RT-PCR نشان داد که غلظت 100 میکرومولار از داروی تاموکسیفن طی تیمار 48 ساعته می‌تواند بیان ژن  CTNNBIP1را افزایش دهد.
نتیجه گیری: با توجه به نتایج به‏دست آمده می‏توان نتیجه گرفت که داروی تاموکسیفن از طریق افزایش بیان ژن CTNNBIP1 بر روی مسیر سیگنالی Wnt و پروتئین بتا کاتنین اثر مهاری دارد.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

سرطان معده (gasteric cancer) یکی ازعوامل اصلی تهدید سلامت در سراسرجهان است. این سرطان دومین علت مرگ‌ومیر ناشی ازسرطان پس ازسرطان ریه می‌باشد (1).

تشخیص این بیماری دیرهنگام است، زیرا مراحل اولیه‌ی بیماری ازنظر بالینی خاموش می‌باشد. بالاترین میزان بروز در آسیای شرقی (کره، مغولستان، ژاپن و چین) با نرخ بروز سالانه بین 40 تا60 در هر 100، 1000 از ساکنان می‌باشد (2). در ایران برخلاف کشورهای غربی و ژاپن میزان بروز سرطان معده در طی دو دهه گذشته رو به افزایش بوده است (3). تحقیقات رایج نشان می‌دهد که عفونت هلیکوباکتر پیلوری، مصرف زیاد نمک و مصرف سیگار، فاکتورهای محیطی اصلی برای شیوع سرطان معده درایران هستند (4). علاوه بر این می‌دانیم که تومورها ازلحاظ سلولی و مولکولی ناهمگن هستند و شامل زیر مجموعه‌ی سلول‌های سرطانی تمایز نیافته با ویژگی‌های مشابه سلول‌های بنیادی هستند. گذار اپی‫تلیال به مزانشیم (EMT) برنامه‌ای تعریف‌ شده است که برای مورفوژنز بافت درطول تکامل جنین نیاز است. تنظیمات این فرآیند طی پیشرفت تومور به هم می‌ریزد و القای آن منجر به کسب ویژگی‌های تهاجم و متاستاز می‌شود (5). مطالعات مشخص کرده‌اند که سلول‌های بنیادی سرطانی (cancer stem cell) طی این فرآیند از سلول‌های غیر بنیادی طبیعی و یا سرطانی به‏وجود می‌آیند و ویژگی‌هایی مشابه سلول‌های بنیادی را دارند (6). این سلول‌ها در گسترش و پیشرفت تومور و همچنین تهاجم و متاستاز آن از طریق ایجاد مقاومت دارویی دخالت دارند (7).

نخستین شواهد مربوط به حضور سلول‌های بنیادی سرطانی و نقش آن‌ها در بروز سرطان در سال 1994 طی مطالعه‌ای بر روی لوسمی حاد میلوئید انسانی به‏دست آمد. طی این مطالعه lapidot و همکاران (8) موفق به شناسایی و جداسازی جمعیتی از سلول‌های AML با نشانگرهای سطحی CD34+/CD38 از یک فرد مبتلا به لوسمی شدند. این نشانگرهای سطحی در شناسایی سلول‌های بنیادی سرطانی حائز اهمیت هستند. توانایی خودنوزایی و تمایز سلول‌های بنیادی سرطانی تحت تاثیر عوامل مختلفی ازجمله مسیر سیگنالی Wnt می‌باشد (9). این مسیر همچنین نقش مهمی در تکوین بافت‌ها طی دوران جنینی و پس از تولد و همچنین هموستازی بافت ایفا می‌کند (10). مسیر سیگنالی توسط خانواده  Wnt  از طریق گلیکولیپوپروتئین‏های ترشح ‌شده یکی از مکانیسم‌های اساسی می‏باشدکه سلول را به سمت تکثیر سلولی، قطبیت و تعیین سرنوشت سلول درطول رشد جنین و هومئوستازی بافت هدایت می‌کند. درنتیجه، جهش درمسیر Wnt اغلب بانقص مادرزادی، سرطان و سایر بیماری‌های انسانی در ارتباطاست. این مسیر سیگنالی حاوی پروتئین‌هایی است که باعث انتقال سیگنال و پیام از طریق گیرنده‌های سلولی به سلول می‌شوند. مسیر Wnt استاندارد، مسیر قطبش سلولی مسطح غیرکانونی و مسیر Wnt /کلسیم غیر استاندارد است (11-13).

درغیاب پروتئین Wnt، پروتئین سیتوپلاسمی بتاکاتنین به‌طور مداوم توسط کمپلکس  Axinتخریب می‌شود. کمپلکسAxin  از داربست پروتئین Axin، محصول ژن سرکوب‌ کننده‌ی تومور آدنوماتوزپولیپوسیزکلای (APC)، کازئین‏ کیناز یک آلفا (CK1α) وگلیکوژن‏ سنتاز کیناز 3 (GSK3) تشکیل‌شده است.  CK1αو GSK3 به‏ترتیب منطقه‌ی انتهای آمینی بتا کاتنین را فسفریله می‌کنند. درنتیجه، بتاکاتنین توسط  b-Trcpو واحدE3 یوبیکوئیتینین ‏لیگاز شناخته ‌شده و پس ‌از آن بتا کاتنین یوبیکوئیتینه شده و توسط پروتئازوم تجزیه می‌شود. این حذف مداوم بتا کاتنین، از رسیدن بتا کاتنین به هسته جلوگیری می‌کند و در نتیجه ژن‌های هدف Wnt توسط پروتئین‌های خانواده‌ی فاکتور سلول T متصل شونده به DNA/فاکتور تقویت‌کننده لنفویید (TCF/LEF) سرکوب می‌شوند. مسیر Wnt/b-catenin زمانی فعال می‌شود که لیگاند  Wntبه‏گیرنده‌ی 7 بارگذرنده از غشای Frizzled (Fz, Fzd) متصل شود و کمک گیرنده‌ی آن، گیرنده لیپوپروتئین با چگالی کم مرتبط با پروتئین 6 (LRP6)، یا نزدیک  LRP5است. شکل‌گیری کمپلکس Wnt-Fz-LRP6، همراه با آمدن پروتئین داربست Dishevelled (Dvl)، منجر به فسفوریلاسیونLRP6 و فعال‌سازی و وارد شدن کمپلکس  Axin به‏گیرنده می‌شود. این وقایع منجر به مهار فسفوریلاسیونβ-catenin  به‌وسیله Axin می‌شود و به‌این‌ترتیب باعث تثبیت β–catenin شده که درنتیجه تجمع و سفر آن به هسته برای تشکیل کمپلکس باTCF /LEF و فعال شدن ژن‌های هدفWnt، بیان ژن هدف اتفاق می‌افتد (شکل1B-) (14).

 

 

 

شکل 1:دید کلی از مسیر سیگنالی Wnt/b-Catenin

 

 

از زمان کشف اولیه، مسیر سیگنالی Wnt با سرطان ارتباط داشته است. هنگامی‌که Wnt1 کشف شد، ابتدا به‌عنوان یک پروتوآنکوژن در مدل موشی برای سرطان پستان شناخته شد. این واقعیت‏که  Wnt1همولوگWg می‌باشد، نشان می‌دهد که در توسعه و تکامل جنین دخالت دارد و اغلب باعث تقسیم سلولی و مهاجر تسریع می‌شود. غلبه بر این فرایندها می‌تواند منجر به‏رشد تومور از طریق تکثیر سلولی شود (15). بتا-کاتنین (β-catenin) نام یک پروتئین است که در انسان توسط ژن CTNNB1 کد می‌شود. بتا-کاتنین پروتئین چند کاره‌ای است که علاوه بر شرکت در اتصالات سلولی یکی از اجزا مسیر انتقال پیام Wnt است. غلظت سیتوپلاسمی این پروتئین در سلول‌های نرمال کاملا تحت کنترل می‌باشد. افزایش فعالیت بتا-کاتنین در بسیاری از تومورهای انسانی از جمله کارسینوم هپاتوسلولار (کبد)، سرطان پستان، سرطان روده بزرگ، سرطان ریه، سرطان تخمدان و سرطان مخاط رحم گزارش‌شده است (16). پروتئین برهم‌کنش دهنده با بتاکاتنینیک (CTNNBIP1) یک پروتئین برهم‌کنش کننده با بتا کاتنین است که توسط ژن مربوطه‌ی خود کد می‌شود و به‌طور منفی مسیر سیگنالینگ Wnt/β-catenin را کنترل می‌کند. این پروتئین فعالیت خود را با مهار تعامل بین پروتئین β-catenin و اعضای خانواده   TCFانجام می‌دهد. در واقع این پروتئین نقش مهارکننده‌ی بتاکاتنین را ایفا می‌کند (‫شکل2) (17).

 

 

 

 

شکل 2: موقعیت ژنومی ژن CTNNBIP1

 

تاموکسیفن، اولین داروی آنتی استروژنی است که برای درمان سرطان پستان وابسته به هورمون به‌کار رفته است (18). تاموکسیفن یک داروی غیراستروئیدی از خانواده‌ی میانجی‫گرهای گیرنده‌ی استروژن انتخابی  (SERM) است. این دارو هر دو خواص آگونیستی و آنتاگونیستی ER را در سلول‌ها و بافت‌های مختلف دارد و تولید استروژن را کاهش می‌دهد. این دارو از اتصال استروژن به گیرنده‌اش جلوگیری کرده و در نتیجه، تاموکسیفن مانع از بیان ژن‌های تنظیم‌کننده‌ی استروژن ازجمله فاکتورهای رشد و عوامل ایجادکننده‌ی رگ‏زایی ترشح‌ شده توسط تومور می‌شود، درنتیجه رشد و تکثیر سلول‌های سرطانی پستانی مهار می‌شود (19). یافتن ژن‌هایی که به‌طور متمایز در شرایط و تحت تاثیر داروهای مختلف بیان می‌شوند بخش جدایی‌ناپذیر از درک مبانی مولکولی سرطان است (20). این مطالعه با هدف جداسازی سلول‌های بنیادی سرطانی از رده‌ی سلولی MKN-45 مربوط به سرطان معده و سپس بررسی اثر داروی تاموکسیفن بر روی بیان ژن  CTNNBIP1انجام ‌شده است.

 

مواد و روش‌ها

کشت سلول: برای این مطالعه، رده­ی سلول‌های سرطان معدهMKN-45  از انستیتو پاستور تهران خریداری شد. برای کشت این رده­ی سلولی از محیط کشتDMEM/F12  حاوی 10 درصد سرم جنین گاوی، یک درصد استرپتومایسین سولفات (سیگما،USA ) و یک درصد پنی­سیلین (سیگما، USA) و همچنین یک درصد ال­گلوتامین (سیگما،USA ) استفاده شد (شکل3).


 

 


شکل3: مورفولوژی رده­ی سلولی MKN-45(این سلول‏ها اپیتلیالی هستند و از نوع سلول‏های چسبنده می‏باشند، از لحاظ ظاهری به‏صورت دوکی شکل هستند و از آدنوکارسینومای معده گرفته شده‏اند، بزرگنمایی 40x).


 

جداسازی سلول‌های بنیادی سرطانی از رده سلولیMKN-45: از رده سلولی  MKN-45تعداد 104×3 سلول در فلاسک  T25که قبلا کف آن با لایه‌ ی نازکی از آگارز یک درصد Fermentas, Canada)) استریل پوشیده شده بود و در شرایط غیرچسبنده و سه‌‏بعدی کشت داده شد. برای نگه‫داری از سلول‌ها محیط

 

کشت DMEM/F12 حاوی 10 درصد  FBS (Gibco،USA ) استفاده شد. تا زمانی که اجسام کروی

تشکیل شدند، سه مرتبه در هفته، هر بار یک میلی‌لیتر محیط کشت کامل به سلول‌ها اضافه شد (شکل 4).


 

شکل4: کلنی سلول‌های بنیادی سرطانی مشتق شده از رده‌ی سلولی MKN-45.  پس کشت سلول‏های رده‏ی سلولی MKN-45  در شرایط غیرچسبنده در روزهای اول مقدار آپوپتوز بیشتر بود،  بعد از مدتی سلول‌ها شروع به تکثیر کردند و کلنی تشکیل دادند. این کلنی‌ها کم‌کم به‏هم پیوستند. پس از گذشت 14 روز این سلول‌ها که سلول‌های سرطانی بنیادی محسوب می‏شدند به‌منظور مطالعات بیشتر جداسازی شدند (بزرگنمایی 40x).

 


بررسی بقای سلولی: ارزیابی میزان بقای سلول‌های بنیادی سرطانی تیمار شده با استفاده از رنگ‌آمیزی تریپان بلو به‏دست آمد(Sigma-Aldrich, USA) . حدود 50000 سلول بنیادی سرطانی مشتق شده از رده‌ی سلولی  MKN-45در هر خانه از پلیت 6 خانه‌ای پوشیده شده با آگارز همراه 2 میلی‌لیتر محیط کشت DMEM/F12 و 10 درصد FBS و غلظت‌های مختلف داروی تاموکسیفن شامل 100، 200، 400، 600، 800 میکرو مولارکشت داده شد. سپس بعد از 48 پس از تریپسینه، سوسپانسیون حاصل را با دور g200 به‏مدت 5 دقیقه سانتریفیوژ و در 1 میلی­لیتر محیط کشت به‌طور کامل آسپیره شد. 20 میکرو‫لیتر از سوسپانسیون سلول با 20 میکرو لیتر تریپان بلو ترکیب شد. پس از 2 تا 5 دقیقه 10 میکرو لیتر از ترکیب فوق بر روی لام نئوبار قرار داده شد. شمارش سلولی در چهار مربع لام با میکروسکوپ نوری با بزرگنمایی x40 انجام شد.

تیمار سلول‌های بنیادی سرطانی جداشده از رده­سلولی  MKN-45با داروی تاموکسیفن: تعداد 400000 سلول بنیادی سرطانی جدا شده از رده سلولی   MKN-45به‌صورت جداگانه در فلاسک T25 که قبلا با لایه نازکی از آگارز استریل یک درصد پوشیده شده بود کشت داده شد. 5 میلی‌لیتر محیط کشت همراه با 10 درصد سرم به سلول‌ها اضافه شد. در مرحله بعد سلول‌ها را با غلظت 100 میکرومولار تاموکسیفن تیمار داده شد. سپس سلول‌ها به‏مدت 48 ساعت در انکوباتور (دمای 37 درجه سانتی‌گراد، رطوبت 95 درصد و غلظت  CO2برابر 5 درصد) نگه‫داری شدند و برای آنالیزهای بعدی مورد استفاده قرار گرفتند.

استخراج RNA و سنتز cDNA: در این مطالعه برای استخراجRNA کل از ترایزول (NEB, England) استفاده شد و استخراج از نمونه‏های تیمار و کنترل (بدون اثر دارو) بر اساس دستوالعمل انجام شد، مواد مورد استفاده برای استخراج RNA از طریق این روش به‏ترتیب عبارتند از ترایزول، کروفرم، ایزوپروپانول، اتانول 100 درصد. درستی و توزیع اندازه RNA کل استخراج شده با آگارز 5/1 درصد،  توسط الکتروفورز ژل TAE و رنگ‫آمیزی با اتیدیوم برماید (EtBr) بررسی شد. در صورت صحت استخراج باندهای مربوط به RNAهای ریبوزومی 28S و 18S قابل تشخیص هستند. از RNA کل با استفاده از کیت QuantiTect® Reverse Transcription نماینده‌ی کمپانی آلمانی کیاژن cDNA براساس دستورالعمل ارائه‌شده سنتز شد. طبق دستورالعمل کیت، مخلوطی از بافر Prime Script، آنزیم رونویسی کننده معکوس، پرایمرOligo-dT، پرایمرRandom hexamer، مهار کننده ریبونوکلئاز به‏آن اضافه شد و با آب RNase Free به‏حجم مورد نظر رسانده شد، در نهایت به‏مدت 15 دقیقه در دمای 37 درجه سانتی‌گراد و 5 دقیقه در دمای 80 درجه سانتی‌گراد قرار داده شد. محلول cDNA حاصل، ماه‌ها در 20- درجه سانتی‌گراد قابل نگه‌داری است. در مرحله‏ی بعد پس از تکثیر ژن CTNNBIP1 به‏وسیله یک واکنش‫ PCR به‏منظور بررسی صحت و عملکرد کارایی پرایمرها ژن مورد نظر ژل الکتروفورز گردید.  بدین منظور از ژل 3 درصد آگارز (که قابلیت جداسازی قطعات 1/0 تا 1 کیلو باز را دارد) استفاده شد.

تکنیک Real Time PCR: پرایمرهای ژن‌های CTNNBIP1 و  GAPDHاز مطالعات قبلی به‫دست آمد (جدول 1) (21).

 

 

 

Products size (bp)

 

 

Annealing

(°C)

 

Primers Size (bp)

 

Sequences

 

Primers

 

Genes Name

 

162

 

54

25

5'- ACTCTGGTAAAGTGGATATTGTTGC -3

Sence

 

GAPDH

21

5'- GGAAGATGGTGATGGGATTTC -3'

Antisence

 

100

 

58

20

5'- AGACTTGACAACGGTGACAG -3'

Sence

 

CTNNBIP1

23

5'- AATTAACTTCAGGCAAACAGGTG -3'

Antisence

جدول1: پرایمر های استفاده شده برای تست Real-time RT-PCR

 

 

 رشتهcDNA  حاصل از نسخه‌برداری معکوس تحت تاثیر آنزیم Taq DNA polymerase، پرایمرهای اختصاصی ژن‌های مورد نظر و نوکلئوتیدهاتحت شرایط زمانی و دمایی مشخص به‌منظور تائید بیان ژن‌های موردمطالعه، تکثیر شدند. به‌منظور بررسی کمی بیان رونوشت‌های ژن، واکنش Quantitative Real-Time PCR با شرایط یکسان برای آن در دستگاهReal-Time  ترمال سایکلرRotor-gene  (Corbett, Australia) 3000 و توسط کیت  SYBR Green PCR Quanti Fast خریداری ‌شده از شرکت زیست باران، نماینده کمپانی Qiagen (Germany) طبق دستورالعمل کیت انجام شد. مطالعه Real-time PCR برای بررسی بیان ژن  CTNNBIP در سلول‌های کنترل (بدون اثر دارو) و تیمار صورت گرفت. دو روش که عمدتا برای آنالیز داده‌های حاصل از آزمایش‫های Real-time PCR مورد استفاده قرار می‏گیرد، تعیین مقدار مطلق و تعیین مقدار نسبی است. در این تحقیق از روش تعیین مقدار نسبی که سیگنال  PCRرونوشت هدف را در یک گروه تیمار به نمونه دیگر به‌عنوان کنترل تیمار نشده ارتباط می­دهد استفاده شد. از روش 2-ΔΔCt، برای آنالیز تغییرات نسبی در بیان ژن‌های حاصل از آزمایشات  Real-Time PCR استفاده شد.

 

نتایج

تاثیر داروی تاموکسیفن بر روی بقای سلول‏های بنیادی سرطانی مشتق شده از رده‌ی سلولی MKN-45

تاثیر داروی تاموکسیفن بر روی حیات سلولی در غلظت‌های (800،600،400،200،100) μm نشان داد که درصد زنده ماندن سلول‌ها بستگی به غلظت داروی تاموکسیفن دارد. مقدار  IC50برای سلول‏های بنیادی سرطانی مشتق شده از رده‌ی سلولی MKN-45 680 میکرو مولار در تست 48 ساعته بود (نمودار 1).

 

 

نمودار1: نمودار  IC50برای غلظت‌های مختلف داروی تاموکسیفن در تیمار 48 ساعته با استفاده ازروش تریپان بلو (IC50 680 میکرومولار به‏دست آمد).

 

پس از آنالیز آماری به‫وسیله ی آزمون  T-test(نرم افزار spss) معنی‏داری نتایج به دست آمده تایید شد و غلظت 100 میکرومولار به‌عنوان غلظت مناسب برای تیمار نهایی در 48 ساعت انتخاب شد. تصویر حاصل از ژل الکتروفورز نمونه ی RNA کل استخراج شده نشان دهنده‏ی صحت و کیفیت RNA استخراج شده بود (شکل 5).

 

                    نمونه‏ی تیمار              نمونه‏ی کنترل

 

همچنین تصویر حاصل از ژل الکتروفورز محصول تکثیر شده‏ی ژن بیان کننده ی صحت و کیفیت پرایمرهای ژن مورد نظر بود (شکل 6).

 

 

شکل 6: ژل الکتروفورز محصول تکثیر شده‏ی ژن با استفاده از تکنیک PCR (به‌وسیله‌ی الکتروفورز در ژل آگارز باند مربوط به ژن CTNNBIP1با طول 100 جفت باز درکنار DNA Ladder 50 جفت بازی مشاهده شد، همچنین کیفیت و صحت عملکرد پرایمرها نیز تایید شد.

سطح بیان ژنCTNNBIP1  در مسیر سیگنالی Wnt در سلول‏های بنیادی سرطانی مشتق شده از رده‌ی سلولی MKN-45  تحت تیمار با غلظت100میکرومولار داروی تاموکسیفن به‏مدت 48 ساعت تغییر کرد. نتایج حاصل ازReal-time-PCR طبق محاسبات ذیل نشان داد که داروی تاموکسیفن بیان ژن CTNNBIP1 را در سلول‏های بنیادی سرطانی مشتق شده از رده‌ی سلولیMKN-45 به‏میزان 4/1برابر افزایش می‌دهد (نمودار2).

 

شکل 5: نمونه‏ای از RNAهای استخراج شده نمونه‏ی کنترل و تیمار (باندهای مربوط به RNAهای ریبوزومی 28S و 18S)

 

 

نمودار2: نمودارتکثیر و مقایسه ی کمی اثر تاموکسیفن بر بیان ژن )   CTNNBIP1بیان رونوشت ژن CTNNBIP1 تحت تیمار با غلظت 100 میکرومولار داروی تاموکسیفن نسبت به نمونه‏ی کنترل افزایش یافته است، این آنالیز به‏صورت سه بار تکرار انجام شد).

 

 

همچنین اطلاعات حاصل از آنالیز داده‏ها با استفاده از آزمون t-test بررسی و مقایسه شدند و معنی‏داری این

نتایج تایید شد (pvalue<0.05) (نمودار 3).

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار3: نمودار ستونی تاثیر داروی تاموکسیفن بر روی سطح بیان ژنCTNNBIP1 (Pvalue<0.05* ، معنی‏داری بیان ژن نمونه‏ی تیمار در برابر نمونه‏ی کنترل توسط آزمون t-test تایید شد).

ΔCt (control) = Ct CTNNBIP1 gene – Ct GAPDH gene

ΔCt (control) = 28.64 – 15.95 = 12.69

ΔCt (treatment) = Ct CTNNBIP1 gene – Ct GAPDH gene

ΔCt (treatment) = 28.49 – 16.28 = 12.21

ΔΔCt = ΔCt (treatment) – ΔCt (control)

ΔΔCt = 12.21 – 12.69 = – 0.48

Relative fold chang = 2-ΔΔCt

Relative fold chang = 20.48  = 1.4

 

بحث

در سال‌های اخیر نیز نقش سلول‌های بنیادی سرطانی در گسترش، تهاجم، متاستاز و عود سرطان مورد بررسی قرار گرفته است (22). همچنین این سلول‌ها در برابر درمان مقاومت ایجاد کرده که می‌تواند از این طریق در متاستاز سلول‌های سرطانی دخیل باشد (23). نخستین شواهد مربوط به‏حضور سلول‌های بنیادی سرطانی و نقش آن‌ها در بروز سرطان در سال 1994 طی مطالعه‌ای بر روی لوسمی حاد میلوئید انسانی به دست آمد. طی این مطالعه   lapidotو همکاران (24) موفق به شناسایی و جداسازی جمعیتی از سلول‌های AML با نشانگرهای سطحی  CD34+/CD38 از یک فرد مبتلا به لوسمی شدند. ازاین‌رو برای درمان سرطان، سلول‌های بنیادی سرطانی باید موردتوجه قرار بگیرند. درک و شناسایی این سلول‌ها ما را در رسیدن به این هدف کمک خواهد کرد. از طرف دیگر توانایی خود نوزایی و تمایز سلول‌های بنیادی سرطانی تحت تاثیر عوامل مختلفی ازجمله مسیر سیگنالی Wnt می‌باشد (25). این مسیر همچنین نقش مهمی در تکوین بافت‌ها طی دوران جنینی و پس از تولد ایفا می‌کند. مطالعات نشان داده است که مسیر کانونی Wnt که وابسته به پروتئین بتاکاتنین است نقش مهمی در کنترل سلول‌های بنیادی سرطانی دارد (26). پروتئین برهم‌کنش کننده با بتا کاتنین (CTNNBIP1) به‌عنوان پروتئین مهارکننده‌ی تعامل بین پروتئین بتا کاتنین و اعضای خانواده‌ی TCF/LEF شناخته‌شده است که به‌عنوان یک تنظیم‌کننده‌ی منفی مسیر سیگنالینگ Wnt/β-catenin نقش خود را ایفا می‌کند. در سلول‌های سرطانی بیان این پروتئین کاهش می‌یابد و بیان پروتئین بتاکاتنین نیز در داخل سلول سرطانی بیشتر از حد معمول می‌باشد (27). از طرف دیگر داروی تاموکسیفن به‌عنوان یک داروی ضد استروئیدی شناخته‌شده است. اگرچه فعالیت ضد استروژنی این دارو هنوز به‌خوبی مشخص نشده است اما مطالعات آزمایشگاهی نشان می‌دهد که فعالیت ضد استروژنی تاموکسیفن به‏دنبال اتصال مستقیم به‏گیرنده‌ی استروژن اتفاق می‌افتد و پس از ایجاد تغییرات ساختاری در این گیرنده رونویسی RNA تغییریافته و در نهایت تکثیر سلولی کاهش می‌یابد (28). هم‌چنین مطالعاتی درباره‌ی حضور گیرنده‌های استروژنی در کارسینومای معده و استفاده از ترکیبات ضد استروژنی تاموکسیفن در درمان این سرطان وجود دارد (29). حضور گیرنده‌های استروژنی در کارسینومای معده اولین بار توسط Tokunaga و همکارانش گزارش شد (30). بنابراین داروهای غیراستروئیدی ضد استروژنی ازجمله تاموکسیفن می‌توانند کاندید خوبی برای درمان و جلوگیری از پیشرفت سرطان معده باشند. با توجه به مطالبی که ذکر شد و هم‌چنین به دلیل اهمیت مطالعه‌ی مکانیسم و عوامل دخیل در ایجاد و پیشرفت سرطان، ما به مطالعه و بررسی نتایج حاصل از تیمار سلول‌های سرطانی بنیادی مشتق شده از رده‌ی سلولیMKN-45  مربوط به سرطان معده بر روی بیان ژنCTNNBIP1  با غلظت مشخصی از داروی تاموکسیفن پرداختیم. پس از جداسازی سلول های بنیادی سرطانی مشتق شده از رده‌ی سلولی MKN-45 مربوط به سرطان معده طی 14 روز، قدرت بقای این سلول‌ها پس از تیمار با داروی تاموکسیفن با استفاده از تست تریپان بلو ارزیابی شد. نتایج حاصل نشان دهنده‏ی اثر مهاری داروی تاموکسیفن بر روی رشد سلول‫های بنیادی سرطانی مشتق شده از رده‏ی سلولی MKN-45بود. پس از ارزیابی قدرت بقای سلول‌های بنیادی سرطانی مذکور و تعیین IC50 برای مشخص کردن غلظت تاثیرگذار بر روی بقای این سلول‌ها، نمونه‌های کنترل و تیمار با غلظت مشخصی از داروی تاموکسیفن به‏مدت 48 ساعت نگهداری شدند. پس از استخراج RNA و ارزیابی کیفیت RNA استخراج ‌شده به‌وسیله‌ی تست PCR درنهایت سنتز cDNA را انجام داده و به بررسی بیان ژن موردنظر یعنی CTNNBIP1 به‌وسیله‌ی آنالیز Real-Time PCR پرداختیم. با توجه به این نتایج ژن CTNNBIP1 در نمونه‌های تیمار شده با داروی تاموکسیفن افزایش بیان به‏میزان 4/1 برابری را نشان داد. با توجه به اینکه پروتئین حاصل از این ژن نقش مهارکننده بر روی پروتئین بتا-کاتنین دارد و همچنین با توجه به نقش تجمع بتا کاتنین و تاثیر آن بر روی پیشرفت سرطان معده که توسط Wilson و همکاران (31) مطالعه و بررسی‌شده است. نقش مهاری پروتئین CTNNBIP1 می‌تواند بسیار موثر باشد و به‌عنوان یکی از اهداف درمانی در درمان سرطان معده در نظر گرفته شود.

 

نتیجه­گیری

در یک نتیجه‌گیری کلی از این پروژه می‌توان گفت که جداسازی سلول‌های بنیادی سرطان معده از رده‌ی سلولی MKN-45 در شرایط کشت سه‌بعدی و بدون اضافه کردن فاکتور رشد در طی 14 روز انجام شد. نتایج نشان داد که داروی تاموکسیفن که یک داروی غیراستروئیدی از خانواده‌ی میانجی‫گرهای گیرنده‌ی استروژن انتخابی (SERM) است، می‌تواند تکثیر و قدرت تومورهایی را در سلول‌های بنیادی سرطان معده کاهش دهد. همچنین تیمار با این دارو سبب افزایش بیان ژن CTNNBIP1 می‌شود. پروتئین حاصل از این ژن مهارکننده‌ی پروتئین بتا کاتنین می‌باشد. بتا کاتنین از پروتئین‌های اصلی مسیر سیگنالی Wnt است و افزایش بیان ژن CTNNBIP1 در نمونه‌ی تیمار شده با داروی تاموکسیفن نشان‌دهنده‌ی نقش مهاری این دارو در غلظت مشخص بر روی مسیر سیگنالی می‌باشد.

 

تشکر و قدردانی

این پژوهش در آزمایشگاه تحقیقاتی سلولی مولکولی دانشگاه رازی کرمانشاه صورت پذیرفت. از آقایان بهروز مرادی و کیومرث مهدی زاده و خانم دیبا فراهانی که ما را در به‫پایان رساندن این پروژه یاری کردند کمال تشکر و قدردانی به‫عمل می‫آید.