بررسی ارتباط سرطان سینه و پلی‫مورفیسم A/T 251 از ژن IL-8 درجمعیت زنان ایرانی با روش Tetra arms-PCR ‬‬‬‬‬‬‬

نوع مقاله: علمی - پژوهشی

نویسندگان

- دانشگاه آزاد اسلامی واحد تهران شمال، دانشکده علوم زیستی، گروه ژنتیک، تهران، ایران

چکیده

هدف: در این مطالعه به ارتباط سرطان سینه و پلی‫مورفیسم A/T 251 از ژن اینترلوکین 8، به‏عنوان مارکر ژنتیکی در جمعیت زنان ایرانی با روش Tetra arms-PCR پرداخته شده است.
مواد و روش‏ها: در این مطالعه شاهد-موردی، 50 زن مبتلا به سرطان سینه و 50 زن سالم به‏عنوان گروه کنترل انتخاب شدند. بعد از استخراج DNA، تعیین ژنوتیپ‏های پلی‫مورفیسم 251 T/A از ژن IL-8 به‏روش Tetra arms-PCR انجام شد.
نتایج: فراوانی ژنوتیپ‏های AA، AT و TT در گروه کنترل به‏ترتیب صفر درصد، 88 درصد و 12 درصد و در گروه بیمار به‏ترتیب 12 درصد، 54 درصد و 34 درصد بود. نتایج تفاوت معنی‏داری بین ژنوتیپ‏های AA، AT و TT در گروه کنترل و بیمار نشان نداد (05/0<p).
نتیجه گیری: در تحقیق حاضر بین فراوانی آلل‏های A و  Tدر گروه بیمار و کنترل، تفاوت معنی‌داری وجود نداشت، بنابراین می‏تواند بیانگر این باشد که بین پلی‫مورفیسم 251 T/A از ژن IL-8 و سرطان سینه در جمعیت زنان ایرانی مورد مطالعه، ارتباطی وجود ندارد.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

سرطان سینه در زنان یک مشکل اصلی بهداشت عمومی در سراسر جهان است. این بیماری دومین سرطان شایع در انسان (زن و مرد) و اولین سرطان شایع در زنان ایران و جهان است. سرطان پستان 23 درصد از تمام موارد سرطان جدید و 14 درصد  از تمام موارد مرگ ناشی از سرطان را در سال 2012 به‏خود اختصاص داده است (1). فاکتورهای  خطر سرطان سینه عبارتند از: سابقه فامیلی سرطان سینه، وضعیت ژنتیکی، سابقه شخصی سرطان سینه، شکل‫گیری سلول‏های غیر عادی در لوبول‏ها یا غدد تولید کننده شیر در بافت سینه، حجم سینه، میزان هورمون‏های اندوژن، سیکل‏های قائدگی، حاملگی، شیر دادن به نوزاد، تراکم استخوان، فاکتورهای وابسته به شیوه زندگی‏ مانند استفاده از هورمون پس از یائسگی، چاقی و اضافه وزن، فعالیت بدنی، رژیم غذایی، مصرف الکل و تنباکو، مصرف قرص‏های ضد بارداری و سایر فاکتورهای خطرمانند تشعشعات، استفاده از دارو‏های خاص، آلودگی‏های محیطی و شغلی و فاکتورهای ژنتیکی مرتبط با سرطان سینه (2 و 3). سرطان سینه یک بیماری به‏شدت ناهمگن است که در اثر تاثیر متقابل عامل های خطر وراثتی و محیطی ایجاد می‏شود و به تجمع پیشرونده تغییرات ژنتیک و اپی‏ژنتیک در سلول‏های سرطان سینه منجر می‏شود. اگرچه شواهد اپیدمیولوژیک بر وجود عامل‏های خطر ویژه (مانند سن، چاقی و مصرف الکل) تاکید دارد، وجود سابقه خانوادگی سرطان سینه، قوی‏ترین عامل خطر برای این بیماری به شمار می‏آید (4). اخیرا نقش سایتوکان‏ها در سرطان مطرح شده است. سایتوکاین‏ها گلیکوپروتئین‏هایی هستند که توسط سیستم ایمنی ذاتی و اکتسابی  و سایر سلول‏ها ترشح شده و بسیاری از اعمال این سلول‏ها و سلول‏های دیگر را میانجی‏گری می‏کنند (5). اخیرا گزارش شده است که در محل تومور میزان ترشح درونی بعضی سایتوکاین‏ها در تعامل با سلول‏های توموری کاهش می‏یابد و منجر به تضعیف سیستم ایمنی می‏شود و این مسئله منجر به گسترش تومور، متاستاز و بدخیم شدن تومور می‫شود (5). اهمیت مسیرهای سیگنالی گیرنده‏های اینترلوکین 8 و خود این کموکاین در ترویج پیشرفت سرطان‏های بدخیم مشخص شده است (6 و 7). بسیاری از مطالعات نشان داده‏اند که ژن اینترلوکین 8(IL-8) gene) Interlukin-8) بیان بالایی در سلول‏های توموری دارند که اغلب در پاسخ به شیمی درمانی و یا فشارهای محیطی مانند هیپوکسی القا می‏شوند.

افزایش بیشتر بیان ژنIL-8  در سلول‏های توموری اهمیت بالایی در بقای این نوع تومورها از طریق نقش گیرنده‏های  ژن‏های CXCR2,CXCR1 (Subfamily of chemokines receptors 1, 2  genes)در سلول‏های سرطانی، سلول‏های اندوتلیال و نوتروفیل‏ها و تومورهای مرتبط با ماکروفاژها دارند (8). اهمیت اینترلوکین 8 در ارتباط با مدولاسیون بین انواع مختلف سلول‏های موجود در تومور و میکرو محیط‏ها است (6). در رابطه با اثر اینترلوکین 8 و سرطان سینه مطالعات نشان داده اند که بین پتانسیل متاستیک سلول‏های سرطان سینه و میزان بیان ژن IL-8 ارتباط معنی‏داری وجود دارد. بر اساس این مطالعات، مشخص شده است که خطوط سلولی با متاستاز بالا بیان ژنIL-8بیشتری نسبت به سلول‏هایی با متاستاز پایین دارند. این امر می‏تواند ناشی از تغییرات اپی ژنتیک مانند الگوی متیلاسیون نابه‏جا در ژن IL-8 باشد که ممکن است مسئول این میزان تفاوت در سلول‏های متاستاتیک با سایر سلول‏ها باشد (9).  مطالعات اخیر نشان داده است که بین پلی‫مورفیسم در ژن‏های IL-8و CXCR2با افزایش ریسک ابتلا به سرطان سینه در جمعیت‏های مختلف از جمله در جمعیت زنان چینی ارتباط وجود دارد (10 و 11 و 12 و 13). بر حسب مطالعات بالینی، سطح سرمی این اینترلوکین در سرم بیماران مبتلا به سرطان سینه نسبت به افراد سالم بیشتر بوده است. به‏خصوص بیمارانی که در مرحله پیشرفت بیماری بودند. به‏نظر می‏رسد، پلی‫مورفیسم‏های تک نوکلئوتیدی در ژن‏های سایتوکاینی مهم بوده و در میزان بیان این ژن‏ها و فعالیت سلول‏ها اثر می‏گذارند. پلی‫مورفیسمی که در منطقه 251 پروموتور ژن IL-8قرار گرفته است نقش مهمی در تولید اینترلوکین 8 یا بیان پروتئین آن، هم در محیط درون ارگانیسم زنده و هم در محیط آزمایشگاهی دارد. در مطالعات گذشته مشخص شده است که پلی‫مورفیسم 251 A/T از ژن IL-8 در جمعیت‏های گوناگون با خطر ابتلا به تومور سرطان‏های مختلف در ارتباط است (10 و 11 و 14 و 15 و 16 و 17). به‏منظور بررسی اختصاصی‏تر ارتباط این پلی‫مورفیسم با سرطان سینه در جمعیت زنان ایرانی و با توجه به اهمیت شیوع سرطان سینه و راه‏های تشخیص و پیش اگهی آن، در این تحقیق به‏بررسی ارتباط بین پلی‫مورفیسم  A/T 251از ژن IL-8 (به‏عنوان یک مارکر ژنتیکی) با سرطان سینه، و به‏جای روش PCR-RFLP (PCR-Restriction Fragment length Polymorphism) که روش رایج و هزینه‏بر در تشخیص پلی‫مورفیسم‏ها می‫باشد از تکنیک اقتصادی‏ترPCR  Tetra arms ، پرداخته شده است.

 

مواد و روش‌ها

نوع مطالعه و جامعه آماری: در این مطالعه به‏صورت موردی- شاهدی از دو گروه بیمار و کنترل، با اخذ رضایت نامه کتبی نمونه‏گیری انجام شد. تعداد 50 خانم مبتلا به سرطان سینه که به‏وسیله معاینه پزشک متخصص زنان و زایمان و انجام سونوگرافی و ماموگرافی بیمار تشخیص داده شدند، انتخاب شدند و گروه کنترل 50 نفر از زنان سالم با سن مشابه افراد گروه بیمار بودند. حجم نمونه بر اساس فرمول محاسبه حجم نمونه فرمول کوکران محاسبه شد.در این محاسبه با سطح خطای ۵ درصد، 50 نمونه بیمار و 50 نمونه گروه کنترل، تخمین زده شد.

 

روش نمونه‏گیری: میزان 5 سی سی از خون افراد گروه بیمار و افراد کنترل سالم در لوله‏های Venoject آماده با حجم 5 میلی‫لیتر (کمپانی graner/UK)، که حاوی مقدارمشخص 1 میلی‫لیتر از ضدانعقاد سیترات سدیم (به‏دلیل ترکیب با کلسیم خون و داشتن اثر ضد انعقادی بر خون و همچنین کم‫ترین اثر روی فاکتورهای بیوشیمیایی خون استفاده شد) و با درپوش‏های بود، جمع‏آوری شد. پس از انجام نمونه‏گیری و تا زمان رسیدن به آزمایشگاه نمونه‏های گرفته شده در جعبه حاوی یخ‏های پک شده نگه‫داری شدند.

استخراج DNA از نمونه‏های خون: پس از انتقال خون حاوی سیترات سدیم به آزمایشگاه‫، ژنوم هر یک از نمونه‏ها با استفاده از روش استخراج DNA با استفاده از کیت Cinnapure جداسازی شد. قابل ذکر است که پس از استخراج DNA نمونه‏های مذکور در دمای 40- تا 70-  درجه سانتی‫گراد نگه‫داری شدند .

کیفیت و کمیت سنجی DNA استخراج شده

الکتروفورز بر روی آگارز 2 درصد: برای اطمینان از کیفیت سنجی DNA خالص شده، 3 میکرولیتر از DNA بر روی ژل آگارز 2 درصد الکتروفورز شد. (به‏دلیل اینکه باند محصول استخراج DNA با توجه به طول ژنوم در زمان کافی با ولتاژ مناسب در روی ژل مشخص گردد از ژل 2 درصد استفاده شد).

تعیین غلظت DNA استخراج شده با استفاده از دستگاه نانودراپ: پس از استخراج DNA به‏منظور ارزیابی کمیت و کیفیت DNA و آگاهی از غلظت و درجه خلوص آن، از دستگاه نانو دراپ استفاده شد. 1 میکرولیتر از DNA استخراج شده در دستگاه قرار داده شد و جذب نوری آن در طول موج‏های مختلف خوانده شد.

واکنشTetra Arms PCR: برای انجام واکنش Tetra Arms PCR از پرایمرهای اختصاصی شامل 1 جفت پرایمر خارجی و 2 پرایمر داخلی برای هر یک از الل‏های غالب و مغلوب پلی‫مورفیسم A/T 251 ژن IL-8، که در جدول 1 آورده شده است، استفاده شد. همچنین مواد مورد نیاز برای واکنش PCR و برنامه دستگاه به‏ترتیب در جدول‏های 2 و 3 آورده شده است.

 

 

جدول 1: توالی و مشخصات آغازگرهای  مورد استفاده برای انجام واکنش  PCRTetra arms(18)

 

طول محصول PCR (bp)

توالی پرایمر

             نام ژن

 

169

TGTAATCCCAGCAGTTTGGGAGGT

 

Forward inner primer (T allele)

 

228

CTCATCTTTTCATTATGTCAGAG

Reverse inner primer (A allele)

 

349

CATGATAGCATCTGTAATTAACTG

Forward outer primer (5’–3’)

 

349

CACAATTTGGTGAATTATCAAA

Reverse outer primer (5’–3’)

 

جدول 2: مواد مورد نیاز جهت انجام PCR  (حجم 20 میکرولیتر)

محتویات واکنش

 

حجم (میکرولیتر)

غلظت

Master Mix PCR 1X

10

5/1 میلی‫مول/ MgCl2

Forward Primer

1

10 پیکو‫مول

Reverse Primer

1

10 پیکو‫مول

Sterile water

5

-

DNA

3

200 نانو‫گرم

 

 

 

 

 

 

جدول 3: برنامه دمایی دستگاه PCR

مراحل

زمان

دما ( درجه سانتی گراد)

 

واسرشتگی اولیه

10 دقیقه

95

واسرشتگی

30 ثانیه

95

اتصال

40 ثانیه

57

گسترش

60 ثانیه

72

گسترش نهایی

10 دقیقه

72

 

 

 

 

 

 

  • تعداد چرخه ها 35 سیکل بود.

 

ارزیابی محصول PCR: برای ارزیابی محصول PCR‌‌، مقدار 5 میکرولیتر از محصول PCR، همزمان با شناساگر زیستی (bp 50) برروی ژل آگاروز 2 درصد (با توجه به‏طول باند محصولات PCR و رویت مناسب باندها روی ژل) الکتروفورز شد. برای رنگ‫آمیزی، به‏جای استفاده از رنگ اتیدیوم بروماید و جلوگیری از اثرات سمی و زیان آور آن،  از رنگ DNA safe شرکت سینا کلون استفاده شد (1 میکرولیتر به‏ازای هر 5 میکرولیتر نمونه). سپس جهت مشاهده باندها ژل در دستگاه UV-Doc قرار داده شد و عکس‫برداری شد.  قابل ذکر است باندهای مربوط به تکثیر Outer، bp 349 و دو آلل T و A به‏ترتیب با bp 169 و bp 228 مورد نظر بودند. همچنین برای هر سری از نمونه‏ها یک کنترل مثبت که از قبل با انجام سکانس تایید شده بود و از یک نمونه کنترل منفی، همراه یک مارکر bp 50 استفاده شد .

تایید صحت نتایج ژنوتایپینگ: برای صحت عملکرد روش و به‏منظور تعیین سکانس و تایید محصول PCR چندین نمونه از هموزیگوت‏های غالب و هموزیگوت‏های مغلوب و هتروزیگوت‏ها انتخاب شدند و به‏وسیله کیت سینا کلون خالص‏سازی شدند. سپس با ارسال به شرکت تکاپوزیست تعیین توالی شدند و در نهایت بلاست انجام گرفت.

 

آنالیز آماری

به‏منظور آنالیز آماری داده‏ها از نسخه 20 نرم آفزار SPSS و آزمون های ضریب همبستگی، T- test مستقل، آنوا و مجذور کای استفاده شد.  p valueکمتر از 05/0 در نتایج، معنی‏دار در نظر گرفته شد.

 

نتایج

نمونه گیری و اطلاعات بیماران

برای انجام این پژوهش حدود 50 نمونه خون بیمار و 50 نمونه خون افراد سالم جمع‏آوری شد و استخراج  DNA از نمونه‏ها انجام شد. رده سنی افراد بین 30 تا 60 سال بود. میانگین سنی برای گروه بیمار 16/44 و برای گروه نرمال  23/40 محاسبه شد که در دو گروه تقریبا یکسان بود. طبق نتایج حاصل 44 درصد افراد در مرحله دو بیماری و تنها 10 درصد آن‫ها در مرحله حاد بیماری (مرحله چهار) قرار داشتند (نمودار 1).

 

نمودار 1:مرحله بیماری بر حسب درصد برای 50 بیمار مبتلا به سرطان سینه

نتایج استخراج DNA

نتایج جذب نوری DNA توسط دستگاه نانودراپ

نتایج جذب نوری DNAهای استخراج شده، توسط دستگاه نانودراپ خوانده شد. نمونه‏هایی که نسبت جذب نوری 260 به 280 نانومتر بین 1.8 تا 2 را داشتند، برای ادامه کار مناسب تشخیص داده شدند.

نتایج الکتروفورز DNA استخراجی بر ژل آگارز

به‏منظور اطمینان از صحت DNA استخراج شده و کیفیت آن پس از استخراج DNA حاصل بر ژل 2 درصد آگارز الکتروفورز شد (شکل 1).

 

شکل 1: DNA استخراج شده بر ژل 2% آگارز، خانه 1: مارکر مولکولی bp 100 ، خانه 2 و 3: دو نمونه DNA .

نتایج ژنوتیپ با روش Tetra-Arms PCR

ژنوتایپ پلی‫مورفیسم 251T/A از ژن IL-8، 50 بیمار مبتلا به سرطان سینه و 50 نمونه سالم توسط تکنیک   Tetra Primer Arms PCR انجام و سپس ژنوتایپ افراد بر اساس الکتروفورز محصول PCR بر روی ژل آگارز مشخص شد. افراد هتروزیگوت با قطعات به طول  bp169 و  bp228 به‏همراه باند کنترل  bp439 مشخص شدند. در صورتی که افراد هموزیگوت موتان با الل A قطعه bp 228 و افراد هموزیگوت وحشی با الل T قطعه bp 169 ، را روی ژل الکتروفورز 2 درصد نشان دادند (شکل 2).

 

 

 

تعیین توالی یابی به جهت تایید محصول حاصل از Tetra-Arms PCR

در مطالعه حاضر به‏منظور تایید محصول PCR از هر یک از حالت‏های هموزیگوت غالب و مغلوب و هتروزیگوت به‏همراه پرایمرها، جهت سکانس به شرکت تکاپو زیست ارسال شد.  سپس نتایج توسط نرم افزار Mega آنالیز و

 

شکل 2: محصول Tetra Primer Arms PCR پلی‫مورفیسم 251 T/A از ژن IL-8،  برروی  ژل 2 درصدآگارز. خانه 1:  مارکر مولکولی bp 100، خانه2: نمونه کنترل مثبت و خانه 3: نمونه کنترل منفی، خانه های 4، 9، 14 و 15: نمونه‫های افراد هتروزیگوت (AT) (  bp 349، bp 228،  bp 169)، خانه‫های 5، 6 و 7: نمونه های افراد هموزیگوت (AA) (  bp 349، bp 228)، خانه‫های 8، 10، 11، 12 و 13: نمونه‫های افراد هموزیگوت (TT) (bp 349،  bp 169).

15     14    13    12   11    10      9     8       7     6      5      4       3       2     1

بلاست شد تا حالت‏های هموزیگوت غالب و مغلوب و هتروزیگوت تایید شوند. در شکل 3 و 4 و 5 نتایج سکانس سه نمونه از بیماران آورده شده است. شکل 3 (هتروزیگوتAT )، شکل4 (هموزیگوت غالب TT) و شکل 5 (هموزیگوت مغلوب AA) می‏باشد که با بلاست مورد تایید قرار گرفت.

 

 

AATGTTTATGCCATTAAAGAAATCATCCATGATCTTGTTCTAACACCTGCCACTCTAGTACTATATCTGTCACATGGTACTATGATAAAGTTATCTAGAAATAAAAAAGCATACATTTGATAATTCACCAAATTGTGA

 

Homo sapiens gene for LUCT/interleukin-8, complete cds

Sequence ID: D14283.1   Length: 3296   Number of Matches: 1

Range 1: 1022 to 1155

Score

Expect

Identities

Gaps

Strand

235 bits(127)

9e-60

132/134(99%)

2/134(1%)

Plus/Plus

Query  6     TTATGCCATT-AAAG-AAATCATCCATGATCTTGTTCTAACACCTGCCACTCTAGTACTA  63

             |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||

Sbjct  1022  TTATGCCATTAAAAGAAAATCATCCATGATCTTGTTCTAACACCTGCCACTCTAGTACTA  1081

 

Query  64    TATCTGTCACATGGTACTATGATAAAGTTATCTAGAAATAAAAAAGCATACATTTGATAA  123

             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct  1082  TATCTGTCACATGGTACTATGATAAAGTTATCTAGAAATAAAAAAGCATACATTTGATAA  1141

 

Query  124   TTCACCAAATTGTG  137

             ||||||||||||||

Sbjct  1142  TTCACCAAATTGTG  1155

 

شکل 3: نمونه فرد هتروزیگوت AT

 

TATGTTATGCCATTAAAGAAATCATCCATGATCTTGTTCTAACACCTGCCACTCTAGTACTATATCTGTCACATGGTACTATGATAAAGTTATCTAGAAATAAAAAAGCATACATTTGATAATTCACCAAATTGTGA

 

Homo sapiens gene for LUCT/interleukin-8, complete cds

Sequence ID: D14283.1   Length: 3296   Number of Matches: 1

Range 1: 1022 to 1155

 

Score

Expect

Identities

Gaps

Strand

235 bits(127)

9e-60

132/134(99%)

2/134(1%)

Plus/Plus

Query  6     TTATGCCATT-AAAG-AAATCATCCATGATCTTGTTCTAACACCTGCCACTCTAGTACTA  63

             |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||

Sbjct  1022  TTATGCCATTAAAAGAAAATCATCCATGATCTTGTTCTAACACCTGCCACTCTAGTACTA  1081

 

Query  64    TATCTGTCACATGGTACTATGATAAAGTTATCTAGAAATAAAAAAGCATACATTTGATAA  123

             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct  1082  TATCTGTCACATGGTACTATGATAAAGTTATCTAGAAATAAAAAAGCATACATTTGATAA  1141

 

Query  124   TTCACCAAATTGTG  137

             ||||||||||||||

Sbjct  1142  TTCACCAAATTGTG  1155

شکل 4: نمونه فرد هموزیگوت غالبTT

 

 


 

AATGTTTATGCCATTAAAGAAATCATCCATGATCTTGTTCTAACACCTGCCACTCTAGTACTATATCTGTCACATGGTACTATGATAAAGTTATCTAGAAATAAAAAAGCATACATTTGATAATTCACCAAATTGTGA

Homo sapiens gene for LUCT/interleukin-8, complete cds

Sequence ID: D14283.1   Length: 3296   Number of Matches: 1

Range 1: 1022 to 1155

 

Score

Expect

Identities

Gaps

Strand

235 bits(127)

9e-60

132/134(99%)

2/134(1%)

Plus/Plus

Query  6     TTATGCCATT-AAAG-AAATCATCCATGATCTTGTTCTAACACCTGCCACTCTAGTACTA  63

             |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||

Sbjct  1022  TTATGCCATTAAAAGAAAATCATCCATGATCTTGTTCTAACACCTGCCACTCTAGTACTA  1081

 

Query  64    TATCTGTCACATGGTACTATGATAAAGTTATCTAGAAATAAAAAAGCATACATTTGATAA  123

             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct  1082  TATCTGTCACATGGTACTATGATAAAGTTATCTAGAAATAAAAAAGCATACATTTGATAA  1141

 

Query  124   TTCACCAAATTGTG  137

             ||||||||||||||

Sbjct  1142  TTCACCAAATTGTG  1155

 

 

شکل 5: نمونه فرد هموزیگوت مغلوب  AA


نتایج آماری

تعداد گروه بیماران و افراد سالم و فراوانی الل‏ها در این دو گروه در جدول 4 آورده شده است. نتایج نشان داد فراوانی الل  Aو الل T در گروه بیمار به‏ترتیب 39 و 61 درصد و در گروه کنترل به‏ترتیب 44 و 56 درصد بود و از نظر آماری تفاوت معنی‏داری بین فراوانی الل‏های A و T در گروه بیمار و کنترل مشاهده نشد (05/0<p).


 

                                جدول 4:  مقایسه ژنوتایپ و فراوانی الل های پلی‫مورفیسم 251 T/A از ژن  IL-8درگروه بیمار و کنترل

ژنوتایپ

گروه سالم

تعداد=50

گروه بیمار

تعداد=50

الل

فراوانی الل ها در گروه سالم

فراوانی الل ها در گروه بیمار

P-value

 

بین الل T و A

TT

6 (12%)

17 (34%)

T

28

56%

30

61%

        

TA

44 (88%)

27 (54%)

 

 

 

68/0

AA

0 (0%)

6 (12%)

A

22

44%

20

39%

 

 

 

 

 

 


 

 

بحث

سرطان سینه شایع ترین سرطان در زنان است. علیرغم پیشرفت‏های چشمگیر در درمان، حدود 25 درصد بیماران مبتلا به سرطان سینه سالانه جان خود را به‏علت این بیماری از دست می‏دهند (19). چنان‏که این سرطان عامل 4/21 درصد از کل بدخیمی‏ها و شایع‏ترین سرطان در زنان ایرانی است و فاکتورهای محیطی متعدد، تغییرات سوماتیک مانند موتاسیون در آنکوژن‏ها، ژن‏های سرکوب کننده تومور و پلی مورفیسم‏های ژنتیکی از عوامل به‏وجود آورنده آن هستند (20 و 21). نتایج بسیاری از مطالعات حاکی از آن است که پلی‫مورفیسم‏های تک نوکلئوتیدی با ایجاد تغییراتی که در توالی DNA ایجاد می‏کنند، می‏تواند استعداد ابتلا به سرطان را افزایش دهند. تعداد محدودی از مطالعات اپیدمیولوژیک به ارزیابی ارتباط بین  پلی‫مورفیسم 251 T/A از ژن  IL-8و ریسک سرطان سینه پرداخته‏اند (10 و 12 و 13). این پلی‫مورفیسم که در منطقه 251 پروموتور ژن  IL-8قرار گرفته است نقش مهمی در تولید اینترلوکین 8 دارد  و مشخص شده است که این پلی‫مورفیسم در جمعیت‏های گوناگون با ایجاد تومور و متاستاز در سرطان‏های مختلف مرتبط است (10 و 11 و 14 و 15 و 16 و 17). بنابراین این مطالعه با هدف

 

 

بررسی پلی‫مورفیسم 251 A/T ژن   IL-8در جامعه زنان ایرانی مبتلا به سرطان سینه انجام شد. همچنین به‏جای روش‏های پر هزینه بر در تشخیص پلی‫مورفیسم‏ها در این تحقیق از تکنیک Tetra arms PCR استفاده شده است.نتایج مطالعه حاضر نشان داد در گروه کنترل توزیع ژنوتیپ پلی‫مورفیسم 251 T/A از ژن  IL-8برای ژنوتیپ های AA، AT و TT به‏ترتیب صفر درصد، 88 درصد و 12 درصد بود. همچنین توزیع ژنوتیپ در گروه بیمار به‏ترتیب 12 درصد، 54 درصد و 34 درصد بود. همچنین بیشتر افراد مورد بررسی، در مرحله 3 و 4 بیماری دارای ژنوتیپ TA و  AAبودند. به‏عبارتی دیگر با حضور ژنوتیپ های هتروزیگوت و هموزیگوت مغلوب این پلی‫مورفیسم در ژن IL-8 می‏توان، عوامل تعیین پیش آگهی سیر بیماری و عاقبت بالینی سرطان سینه را پیش‏گویی نمود.

 با توجه به شیوع سرطان سینه در زنان و تهدید بیماران، شناسایی پلی‫مورفیسم ژن IL-8 هم به‏عنوان یک مارکر ژنتیکی و هم در تشخیص این بیماری و مهار آن، با جلوگیری از پیشرفت سرطان سینه می‏تواند موثر باشد. بر اساس نتایج مطالعات اخیر که در جمعیت زنان چینی انجام شده است مشخص شده است که بین پلی‫مورفیسم  251 A/T ژن IL-8با ابتلا به سرطان سینه ارتباط وجود دارد (12 و 13). مطالعات صورت گرفته در سال‏های اخیر نقش اینترلوکین‏ها را در سرطان سینه ثابت کرده‏اند که سطوح بالای سایتوکاین‏های التهابی در سرم و بافت‏های توموری سرطان سینه مشاهده شده است. بالا بودن برخی از این سایتوکاین‏ها در سرم بیماران مبتلا به سرطان با پیشرفت مرحله بیماری و تهاجم سلول‏های سرطانی و ایجاد متاستاز مرتبط است (9 و 12 و 13و 22). مطالعات نشان داده‏اند که پیشرفت و توسعه چندین گونه از سرطان سینه با وضعیت التهاب و تولید نامنظم و نامناسب کموکاین‏ها به‏ویژه اینترلوکین 8 همراه است که به‏نظر می‏رسد یکی از مراحل حیاتی در ایجاد متاستاز در سلول‏های سرطانی باشد (23). تحقیقات قبلی حاکی از این است که  اینترلوکین 8 نه تنها یک عامل در فعال کردن مسیرهای تکثیری سلول‏های سرطانی است  بلکه مسیرهای آپوپتیک را نیز کنترل می کند. به این علت کاهش بیان ژن IL-8 به وسیله سلول های توموری، می تواند سبب تحریک گیرنده‫های کموکاینی و در نتیجه تخریب عملکرد نوتروفیل‏ها و ماکروفاژها در سرکوب التهابات گردد (24).  همچنین تغییر بیان ژن IL-8 به‏واسطه وجود این پلی‫مورفیسم که در ناحیه پروموتری ژن قرار دارد سبب آنژیوژنز و در نتیجه ایجاد متاستاز و بدخیمی‏های توموری خصوصا در سلول‏های سینه شده که می‏تواند به‏طور مستقیم با ایجاد سرطان سینه مرتبط باشد (13). اینترلوکین 8 یکی از مهم‏ترین سایتوکاین‏های تنظیم کننده است که دارای عملکرد مرکزی در شروع و تنظیم پاسخ‏های ایمنی سلولی است. اینترلوکین 8 در ماکروفاژها و فیبروبلاست‏های مشتق شده از سلول‏های بینابینی بیان می‏شود و به‏عنوان یک میانجی مشتق شده از ماکروفاژ آنژیوژنز شناخته شده است. این سایتوکاین یک فاکتور کموتاکتیک بوده که می‏تواند سلول‏های سفید خون را فعال کند (25). همچنین در طیف مختلفی از بیماری‏ها مانند پسوریازیس، آرتریت روماتوئید، فیبروز ریویو برخی نئوپلاسم‏ها نقش این اینترلوکین ثابت شده است. مطالعات متعددی نشان داده اند که اینترلوکین 8 یک عامل ترویج دهنده آنژیوژنز (رگ‏زایی) است و به‏طور مستقیم و یا غیر مستقیم عامل تکثیر سلول‏های توموری و شکل‏گیری رگ‏های خونی جدید از طریق گیرنده سطحی عروق توموری سلول‏های اندوتلیال هستند و در نتیجه می‏توانند در رشد تومور و متاستاز موثر باشند (12 و 13 و 26). زانگ و همکاران (12) در یک مطالعه پژوهشی مشخص نمودند اینترلوکین 8 به‏عنوان یکی از اعضای خانواده کموکاین ها می‏تواند در تنظیم التهابات و پروسه‏های سیستم ایمنی نقش اساسی داشته باشد. انان با روش PCR-RFLP پلی‫مورفیسم‏هایی از ژن اینترلوکین 8 از جمله پلی‫مورفیسم 251 T/A را بررسی نمودند. نتایج آنان نشان داد بین این پلی‫مورفیسم و ایجاد سرطان سینه در جمعیت زنان چینی ارتباط معنی‏داری وجود دارد. همچنین هی و همکارانش (13) در خصوص پلی‫مورفیسم‏های ژن اینترلوکین 8 و ارتباط آن‏ها با ایجاد سرطان سینه در جمعیت زنان چینی مطالعه‏ایی را انجام دادند. تحقیق انان مشخص نمود که چندین پلی‫مورفیسم از جمله پلی‫مورفیسم 251 T/A از ژن IL-8 در افزایش ریسک ابتلا به سرطان سینه در بین زنان چینی موثر است. اسنوز و همکاران (27) در یک مطالعه مورد–شاهدی به بررسی تنوع ژنتیکی در ژن IL-8 همراه با افزایش خطر و پیش آگهی ضعیف سرطان سینه پرداختند. آن‏ها در این مطالعه 308 بیمار غیر مرتبط با سرطان سینه و 236 فرد سالم را با روشAS  پلیمراز بررسی کردند. نتیجه مطالعه نشان داد که پلی‫مورفیسم در پروموتر ژن IL-8 به‏عنوان فاکتور ریسک یا خطر برای سرطان سینه می‏باشد. انواع مختلف سایتوکاین‏ها نقش‏های گوناگونی را در شروع یا تکثیر سرطان ایفا می‏کنند و می‏توانند از یک‏طرف زمینه را برای بروز و حتی تکثیر و متاستاز سرطان فراهم کنند و از طرف دیگر از طریق آثار ضدالتهابی و ضدتوموری، ازپیشرفت و توسعه سرطان جلوگیری کنند (28). سنوزی و همکاران (8)در یک مطالعه مورد – شاهدی به‏ بررسی اثر ترکیبی پلی‫مورفیسم ژن IL-8و CXCR2 در استعداد ابتلا به سرطان سینه وپرخاشگری (تهاجم) پرداختند در آن مطالعه 409 بیمار تونسی غیر مرتبط با سرطان سینه و 301 فرد سالم را با روش AS پلیمراز مورد بررسی قرار دادند. نتیجه این مطالعه نشان داد که پلی‫مورفیسم در ژن IL-8و CXCR2 با افزایش سرطان سینه، و همچنین پیشرفت بیماری همراه  است. مطالعات متعددی نشان دادند که بین پلی‫مورفیسم ژن IL-8 و بیماری‏های انسانی رابطه وجود دارد و همه آن‏ها بر نقش پلی‫مورفیسم 251 T/A از ژن IL-8 که بر بالادست سایت آغاز رونویسی قرار دارد، متمرکز شده‏اند. همچنین در این مقالات مطرح شده است که وجود این پلی‫مورفیسم علاوه بر اینکه نقش مهمی در پیشرفت بیماری سرطان سینه ایفا می‏کند می‫تواند در پیش آگهی سرطان کولورکتال، سرطان پروستات و معده نیز نقش داشته باشد (29). هوانگ و همکاران (28)، گزارش نمودند پلی‫مورفیسم فوق با ژنوتیپ هتروزیگوت و هموزیگوت مغلوب در افراد مبتلا به سرطان سینه و در مرحله حاد این بیماری ارتباط دارد.

بنابراین مروری بر مطالعات انجام شده در خصوص پلی‫مورفیسم 251 T/A از ژن  IL-8که می‏تواند درایجاد بسیاری از سرطان‏ها از جمله سرطان سینه در جمعیت زنان آسیایی موثر باشد، لزوم مطالعه حاضر را که بررسی ارتباط پلی‫مورفیسم مذکور با سرطان سینه در جمعیت زنان ایرانی، به‏عنوان جمعیتی از زنان اسیایی، مشخص می‏نماید و همچنین لزوم استفاده از روش Tetra arms PCR در مقایسه با روش PCR-RFLP، که روش دقیق و مقرون به‏صرفه‏تری می‏باشد را توجیه می‏نماید.

 

نتیجه­گیری

سرطان سینه به‏عنوان یکی از فراوان‏ترین سرطان‏ها و علت اصلی مرگ و میر در بین زنان سراسر جهان و زنان ایرانی محسوب می‏گردد. فاکتورهای متعددی از جمله انواع فاکتورهای محیطی، وزن بدن، فاکتورهای مرتبط با سبک زندگی هم‏چون مصرف الکل، عدم فعالیت فیزیکی و مصرف سیگار و نیز مهم‏ترین مورد فاکتورهای ژنتیکی افراد در ایجاد تومورهای سرطان سینه نقش مهمی دارند. نتایج مطالعات نشان می‏دهد سایتوکاین‏های متعددی از جمله IL-8 نقش مهمی در ایجاد التهاب و رگ‏زایی در نسوج و در نتیجه ایجاد و تشدید سرطان‏ها ایفا می‏کند. این مطالعات بر نقش پلی‫مورفیسم‏های ژن IL-8و ارتباط آن با انواع سرطان در جمعیت‏های مختلف پرداخته‏اند. بنابراین این مطالعه با هدف بررسی پلی‫مورفیسم 251 A/T ژن IL-8در جامعه زنان ایرانی مبتلا به سرطان سینه انجام شد و نتایج حاصل از این مطالعه نشان داد

بیشتر افراد مورد بررسی، در مرحله 3 و 4 بیماری، دارای ژنوتیپ‏های هتروزیگوت و هموزیگوت مغلوب این پلی‫مورفیسم در ژن  IL-8بودند و این امر می‏تواند، توجیه کننده این باشد که پلی‫مورفیسم مذکور نقش مهمی در پیش آگهی و حتی تشخیص در بیماری سرطان پستان داراست و توصیه می‏شود در مطالعات بعدی تعداد افراد بیشتری از جمعیت‏های مختلف زنان ایرانی مورد مطالعه قرار گیرند.

 

تشکر و قدردانی

از کلیه مسئولین محترم در دانشکده علوم زیستی دانشگاه آزاد اسلامی واحد تهران شمال و مسئولان محترم آزمایشگاه پاسارگارد به‏خصوص آقای دکتر امینی که در انجام کارهای آزمایشگاهی این تحقیق کمال همکاری را مبذول فرموده‏اند، سپاسگزاری و تشکر می‫شود.

1.Kamdar BB, Tergas AI, Mateen FJ, Bhayani NH, et al. Night-shift work and risk of breast cancer: a systematic review and meta-analysis. Breast cancer research and treatment.2013; 138(1): 291-301.

2. Sharma GN, Dave R, Sanadya J, Sharma P, et al. Various types and management of breast cancer: An overview. Journal of advanced pharmaceutical technology and research. 2010; 1(2): 109-26.

3. Perou CM, Borresen-Dale AL. Systems biology and genomics of breast cancer. Cold Spring Harbor perspectives in biology. 2011; 3(2): a003293.

4. Antoniou AC, Easton DF. Models of genetic susceptibility to breast cancer. Oncogene. 2006; 25(43): 5898-5905. Oncogene. 2006; 25(43): 5898-5905.Oncogene. 2006; 25(43): 5898-5905.

Oncogene. 2006; 25(43): 5898-5905.

5. Vacchelli E, Aranda F, Bloy N, Buqu A, et al. Trial watch: immunostimulatory

 

cytokines in cancer therapy. Oncoimmunology. 2014; 3(6): 290-94.‏

6. Singh JK, Simões BM, Howell SJ, Farnie G, et al. Recent advances reveal IL-8 signaling as a potential key to targeting breast cancer stem cells. Breast Cancer Research. 2013; 15(4); 210.‏

7. Chia CY, Kumari U, Casey P. Breast cancer cell invasion mediated by Gα12 signaling involves expression of interleukins-6 and−8, and matrix metalloproteinase-2. Journal of molecular signaling. 2014; 9(1): 6.‏

8. Snoussi K, Mahfoudh W, Bouaouina N, Fekih M , et al. Combined effects of IL-8 and CXCR2 gene polymorphisms on breast cancer susceptibility and aggressiveness .Biomedicine Cancer. 2010; (10): 283.

9. Lin1 Y. Identification of interleukin-8 as estrogen receptor-regulated factor involved in breast cancer invasion and angiogenesis by protein arrays. Publication of the international union  Against Cancer (uicc). International Journal of Cancer. 2004; (109): 507–515 .

10. Huang Q, Wang C, Qiu LJ, Shao F, et al. IL-8-251A>T polymorphism is associated with breast cancer risk:a meta-analysis. Journal of Cancer Research Clinical Oncology. 2011; 137(3): 1147–1150.

11. Taheri M, Hashemi M, Eskandari-Nasab E, Fazaeli A, et al. Association of  607 C/A Polymorphism of IL-18 Gene (rs1946518) with Breast Cancer Risk in Zahedan, Southeast Iran. Prague Medical Report. 2012; 113(3): 217-222.

12.  Zhang J, Han X, Sun Sh. IL-8 -251A/T and +781C/T polymorphisms were associated with risk of breast cancer in a Chinese population. International Journal of  Clinical  Express Pathology. 2017; 10(7): 7443-7450.

13. He Y, SunSh, Liu Y,Tian K. Association of IL-8 genetic polymorphisms and breast cancer risk in a Chinese population. Biomedical Research. 2017; 28 (18): 7892-7898.

14. Xiuyu C, Weihan H, BeiZh, Ni D, et al. Genotyping of IL-8-251 T > A yields prognostic information in patients with gastric carcinoma. Biomarkers.2013; 18(7): 559-564.

15. Chen Y, Yang Y, Liu S, Zhu S, et al. Association between interleukin 8− 251 A/T and+ 781 C/T polymorphisms and osteosarcoma risk in Chinese population: a case–control study. Tumor Biology. 2016; 37(5): 6191-6196.‏

16. Wang Z, Gao ZM, Huang HB, Sun LS, et al. Association of IL-8 gene promoter -251 A/T and IL-18 gene promoter-137 G/C polymorphisms with head and neck cancer risk: a comprehensive meta-analysis. Dovepress. 2018; 10: 2589-2604.

17.  Jessica C, Alwadris TT, Prasetyo SR, Puspitawati R, et al. Association of interleukin 8 -251 A/T gene polymorphism with periodontitis in Indonesia. Journal of Physics. 2018; 1025: 1-5.

18. Matheson MC, Ellis JA, Raven J, Walters EH, et al. Association of IL8, CXCR2 and TNF-alpha polymorphisms and airway disease. Journal of HumanGenethology. 2006; 51(3): 196-203.

19. Richie RC, Swanson JO. Breast Cancer: A Review of the Literature. Journal of  Insurance Medicine. 2003; 35(2): 85-101.

20. Harirchi I, Karbakhsh M, Kashefi A, Momtahen A J. Breast cancer in Iran: results of a multi-center study. Asian pacific journal of cancer prevention. 2004; 5(1): 24-27.

21. Mousavi SM, Montazeri A, Mohagheghi MA, Jarrahi AM, et al. Breast cancer in Iran: an epidemiological review. Breast Journal. 2007; 13(4): 383-91.

22. De Andres PJ, Illera JC, Caceres S, Diez L, et al. Increased levels of interleukins 8 and 10 as findings of canine inflammatory mammary cancer. Veterinary Immunology and Immunopathology. 2013; 152(3-4): 245-51.

23. Vogel CF, Li W, Wu D, Miller JK, et al. Interaction of aryl hydrocarbon receptor and NF-κB subunit RelB in breast cancer is associated with interleukin-8 overexpression. Archives of  Biochemistry and  Biophysics. 2014; 512(1): 78-86.

24. Agha-Alinejad H, Haftchenari SH, MatinHomaei H. Effect of a Period of Endurance Training on Serum Il-8 Concentration and Tumor Volume in Breast Cancer Bearing Mice. Iranian Journal of Endocrinology and Metabolism. 2014; 16(1): 26-32.

25. Strieter RM, Kunkel SL, Elner VM, Martonyi CL, et al. Interleukin-8.A corneal factor that induces neovascularization. American Journal of Pathology.1992; 141(6): 1279-1284.

26. Wu S, Lu S, Tao H, Zhang L, et al .Correlation of Polymorphism of IL-8 and MMP-7 with Occurrenceand Lymph Node Metastasis of Early Stage Cervical Cancer. Journal of Huazhong University of Science Technology. 2011; 31(1): 114-119.

27. Snoussi K, Mahfoudh W, Bouaouina N, Ahmed SB, et al.  Genetic Variation in IL-8 Associated with Increased Risk and Poor Prognosis of Breast Carcinoma. American Society for Histocompatibility and Immunogenetics. Human Immunology. 2006; 9(67): 13-21. 

28. Huang J, Li X, Hilf R, Bambara RA, et al. Molecular basis of therapeutic strategies for breast cancer. Current Drug Targets-Immune, Endocrine and Metabolic Disorders. 2005; 5(4): 379-396.

29. Vairaktaris E, Serefoglou Z, Yapijakis C. High gene expression of matrix metalloproteinase-7 is associated with early stages of oral cancer. Anticancer Research. 2007; 27(4B): 2493-2498.