بررسی غلاف میلین و پروتئین‌های مرتبط با آن (MAG، MOG، MBP و PLP) طی تخریب میلین القا شده توسط کوپریزون در سیستم عصبی مرکزی موش‌های نر نژاد C57BL/6

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشگاه زابل، دانشکده علوم، گروه زیست‌شناسی، زابل، سیستان و بلوچستان، ایران

2 دانشگاه اراک، دانشکده علوم، گروه زیست‌شناسی، اراک، ایران، کدپستی 8349-8-38156

چکیده

هدف: هدف تحقیق، بررسی دقیق اثرات وابسته به‏زمان کوپریزون بر پروتئین­های MAG، MOG، MBP و PLP و روند تخریب میلین می‏باشد.
 مواد و روش‌ها: مدل تخریب میلین با مصرف پنج هفته غذای حاوی 2/0 درصد کوپریزون ایجاد شد. ناحیه کورپوس کالوزوم مغز موش‌ها در هفته‏های 3، 4 و 5 مورد ارزیابی بافتی و مولکولی قرار گرفت و در انتهای هفته پنجم مطالعات رفتاری توسط تست میدان باز انجام شد.
نتایج: نتایج نشان داد بیان پروتئین­های غلاف میلین در مقایسه با گروه کنترل به‏صورت وابسته به‏زمان کاهش یافته است. علی­رغم کاهش کلی این پروتئین­ها در هفته سوم، در این هفته تنها پروتئین PLP کاهش معنی‏داری با گروه کنترل نشان داد (01/0P<). همچنین سایر پروتئین­ها از هفته چهارم به بعد کاهش بیان معنی‏داری را نشان دادند. مطالعات میکروسکوپ الکترونی تغییرات معنی‏دار در کاهش قطر میلین در مقایسه با گروه کنترل را تنها پس از 4 هفته نشان داد  (01/0P<). مطالعات رفتاری نیز نشان داد کوپریزون قادر به ایجاد اختلالات رفتاری معنی‏داری در حیوانات مورد مطالعه در مقایسه با گروه کنترل بود و این تغییرات از هفته سوم به بعد قابل مشاهده بودند.
نتیجه­گیری: این تحقیق برای اولین بار به بررسی هم‏زمان پروتئین‏های اصلی میلین پرداخته و نتایج نشان می‌دهد بهترین زمان جهت بررسی­های دقیق مولکولی، بافتی و رفتاری هفته­های چهارم و پنجم می­باشند.

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

مالتیپل اسکلروزیس (Multiple sclerosis= MS) بیماری است که در آن غلاف میلین تشکیل دهنده اکسون در نورون‏های سیستم عصبی مرکزی تخریب می‏شود. این بیماری منجر به اختلال در توانایی و صحت ارتباط سلول­های عصبی مغز و نخاع با یکدیگر می­شود. در ام اس سیستم ایمنی بدن غلاف میلین را غیر خودی فرض نموده، علیه پروتئین­های اصلی میلین واکنش نشان داده و باعث تخریب آن‏ها می­شود، ترمیم غلاف میلین توسط الیگودندروسیت­ها به کندی صورت گرفته و در نتیجه نورون­ها قادر به ارسال موثر سیگنال عصبی نخواهند بود (1 و 2). شیوع این بیماری در شمال اروپا 60 تا 200 نفر در هر یکصد هزار نفر و در شمال آمریکا 6 تا 20 نفر در هر یکصد هزار نفر می­باشد (3). در حال حاضر در ایران از هر یکصد هزار نفر حدود 50 نفر به بیماری ام اس مبتلا هستند. شیوع این بیماری در استان‌های تهران، فارس و اصفهان بیشتر از سایر استان‌های کشور بوده و متاسفانه این میزان با سرعت زیادی رو به افزایش است (2). بیشترین علل بروز بیماری ام اس ناشی از عوامل ژنتیکی و محیطی است. مطالعات نشان می‏دهد برخی از تغییرات ژنتیکی ریسک ابتلا و پیشرفت بیماری را افزایش می­دهند (4 و 5). به‏دلایل نامشخصی سلول­های ایمنی در بیماران ام اس می­توانند به‏علت اختلال در عملکرد سدخونی مغزی به مغز و نخاع هجوم آورده و باعث تخریب میلین شوند. علاوه بر تخریب ماده سفید (میلین)، کورتکس و هسته­های عمقی ماده خاکستری مغز و اکسون­ها نیز در نتیجه انتشار آسیب تحت تاثیر قرار می‌گیرند(6-9). آسیب غلاف میلین منجربه اختلال در هدایت پیغام‌های عصبی و اختلال عملکرد بیمار شده و منجر به بروز حملات (عود) می‌شود. گاه مغز می­تواند از طریق فرآیند بازآرایی نورونی (Neuroplasticity) برخی از ضایعات ایجاد شده را جبران کند. از سوی دیگر فرآیند بازسازی مجدد میلین (Remyelination) نیز می تواند نقش مهمی در ترمیم ضایعات ایجاد شده بازی کند. یکی از متداول­ترین راه­های القای تخریب میلین در حیوانات آزمایشگاهی استفاده از کوپریزون می­باشد و اولین بار توسط فردی به‏نام Blakemore مطرح شد (10).بعدها مطالعات بیشتری درباره تاثیرات کوپریزون بر تخریب میلین(Demyelination) در ناحیه رابط بین دو نیمکره یا همان کورپوس­کالوزوم مغز انجام شد(11). تغذیه موش‌های آزمایشگاهی با کوپریزون باعث ایجاد دمیلینیشن برگشت­پذیر و از بین رفتن الیگودندروسیت‌های بالغ مخصوصاً در ناحیه کورپوس‌کالوزوم می­‏شود. جالب آن­که سایر سلول­ها در سیستم اعصاب مرکزی تحت تاثیر آن قرار نمی­گیرند (12).اولیگودندروسیت‌ها مسئول تولید میلین در سیستم عصبی مرکزی هستند و دلیل این‏که چرا فقط الیگودندروسیت­ها نسبت به کوپریزون آسیب­پذیرند هنوز مشخص نیست. در حین تغذیه با کوپریزون، دمیلینیشن رخ داده، پس از قطع کوپریزون رمیلینیشن خودبه­خودی در مغز شروع می‏شود (13).مهم‏ترین پروتئین­های سازنده میلین شامل، گلیکوپروتئین همراه میلین (Myelin-Associated Glycoprotein=MAG)، گلیکوپروتئین الیگودندروسیتی میلین(Myelin Oligodendrocyte Glycoprotein=MOG)، پروتئین اصلی میلین (Myelin Basic Protein=MBP)و پروتئین پروتئولیپیدی ‌میلین(Myelin proteolipid protein=PLP) می­باشند. از آن‏جایی‏که اولین تغییرات در بیان این پروتئین­ها نشان‏دهنده فعالیت الیگودندروسیت­ها و تغییر در ساختار غلاف میلین است اثرات حفاظتی ترکیبات مختلف با اندازه­گیری نقش آن‏ها در افزایش بیان پروتئین­های ذکر شده ارتباط مستقیم دارد (14). هدف از این تحقیق مشخص نمودن زمان مناسب برای بررسی آسیب‏های ناشی از کوپریزون می‏باشد تا درک بهتری از روند آسیب‏ها ایجاد شده و مقایسه ترکیبات حفاظت کننده در زمان مناسب انجام پذیرد.

 

مواد و روش­ها

ایجاد مدل کوپریزون: در این پژوهش کلیه نکات اخلاقی با توجه به موازین کمیته اخلاق دانشگاه علوم پزشکی تهران و منطبق با منشور اخلاقی این دانشگاه و در جهت به حداقل رساندن آزار به حیوانات صورت گرفت. برای ایجاد مدل کوپریزون موش­های C57BL/6 بالغ نر 8 تا 9 هفته در محدوده وزنی 20 تا 25 گرم از مرکز انستیتو پاستور ایران تهیه شد. حیوانات در خانه حیوانات با دمای 2 ± 23 درجه سانتی‏گراد و دوره تاریکی ـ روشنایی 12 ساعته به‏صورت 6 تایی در قفس نگه‏داری ‏ شدند. سپس غذای حاوی کوپریزون 2/0 درصد به‏مدت 5 هفته به حیوانات داده شد. به‏دلیل ماهیت پودری غذا برای جلوگیری از آلودگی محیط آزمایشگاه، قفس­ها در فضای جداگانه­ و در زیر هود نگه­داری شدند. گروه کنترل شامل موش­های سالم بود که 5 هفته غذای پودر شده فاقد کوپریزون را دریافت کردند و گروه آزمایشیشامل موش‌های سالمی بود که به‏مدت 5 هفته با غذای حاوی کوپریزون تغذیه شدند. کلیه آزمایش‏ها بر روی هر دو گروه کنترل و آزمایشی صورت گرفت.

آماده سازی نمونه­ها: در پایان هفته­های 3، 4 و 5، از هر گروه تعداد 6 موش به‏صورت تصادفی انتخاب شدند. پس از بی‏هوشی عمیق توسط کتامین و زایلوزین قفسه سینه باز و سپس 15 میلی­لیتر محلول PBS درون بطن چپ پرفیوژ شد تا تمامی خون موجود در عروق از دهلیز راست قلب حیوان خارج شد. جهت آزمایش‏های بافتی جهت فیکس کردن 15 میلی­لیتر محلول پارافرم آلدئید 4 درصد درون بطن چپ پرفیوژ شد، پوست سر برداشته و محل اتصال استخوان بینی به جمجمه شکسته شد. سپس مغز از درون جمجمه خارج درون محلول گلوتارآلدئید 10 درصد به آزمایشگاه میکروسکوپ الکترونی منتقل شد.

 جهت آزمایشات مولکولی پس از پرفیوژ با PBS بخش کورپوس کالوزوم مغز جدا، در میکروتیوپ RNase free قرار گرفته و تا انجام آزمایش در فریزر 80- درجه سانتی‌گراد نگه‏داری شد.

استخراج RNA: در این مرحله طبق پروتکل کیت استخراج RNA (Accuzol, Bioneer) استخراج RNA از بافت مغز انجام شد. جهت به‏دست آوردن غلطت RNA مقدار 5 میکرولیتر از محلول RNA در 95 میکرولیتر آب مقطر حل شد و سپس OD (Optical Density) آن در طول موج 260 و 280 نانومتر توسط دستگاه نانو دراپ (DeNovix) خوانده و نسبت RNA/DNA بیشتر از 6/1 قابل قبول در نظر گرفته شد و جهت سنتز cDNA مورد استفاده قرار گرفت.

سنتز cDNA: برای رفع آلودگی قبلی با DNA، به 2 میکرولیتر از نمونه RNA، 10 میکرولیتر آب DEPC، 1 میکرولیتر بافر X 10 موجود در کیت و یک واحد آنزیم DNaseI اضافه و برای همگن شدن به‏مدت یک دقیقه سانتریفوژ شد. کلیه مراحل کار بر روی یخ صورت گرفت. سپس جهت انجام واکنش، میکروتیوپ حاوی این ترکیبات به مدت 30 دقیقه در دستگاه ترمومیکسر (Eppendorf) با دمای 37 درجه سانتی گراد قرار داده شد. در ادامه یک میکرولیتر از EDTA موجود در کیت به محتویات میکروتیوپ اضافه و به‏مدت 10 دقیقه در دستگاه ترمومیکسر با دمای 37 درجه سانتی گراد قرار داده شد. سپس حجم نمونه با اضافه کردن 5 میکرولیتر آب دوبار تقطیر به 20 میکرولیتر رسانده شد و سنتز cDNA طبق دستورالعمل کیت (Thermo Scientific) انجام شد.

PCRReal-time:به­طور خلاصه مخلوط واکنش‏گر شامل Green Star Master Mix Solution (5/12 میکرولیتر)، پرایمرهای فوروارد و ریورس با غلظت mM 10 (هر کدام 5/0 میکرولیتر)، cDNA (3 میکرولیتر) و 5/3 میکرولیتر آب دوبار تقطیر (حجم نهایی 20 میکرولیتر) بود. این آزمایش به کمک دستگاه Real time PCR (Corbet 6000) انجام شد. از ژن GAPDH به‏عنوان  Housekeeping استفاده شد. توالی پرایمرها استفاده‌شده در این مرحله در جدول1 مشخص شده است.

 

 

 

جدول1: توالی پرایمرهای مورد استفاده برای Real time PCR به‏همراه منابع

نام مولکول

توالی پرایمر (/5 به /3)

منبع

MAG

F:CTGCCGCTGTTTTGGATAATGA

R:CATCGGGGAAGTCGAAACGG

(15)

MBP

F:ACACGAGAACTACCCATTATGGC

R:CCAGCTAAATCTGCTGAGGGA

(16)

MOG

F: CAAGAAGAGGCAGCAATGGAG

R: CAGGAGGATCGTAGGCACAAG

(17)

PLP

F:CCAGAATGTATGGTGTTCTCCC

R:GGCCCATGAGTTTAAGGACG

(18)

GAPDH

F:GTGGAAGGGCTCATGACCACAGTCCATGCC

R:TCTTACTCCTTGGAGGCCATGTAGGCCATG

(15)

 

میکروسکپ الکترونی: برای بررسی اثرات کوپریزون بر میزان از دست رفتن میلین، ناحیه مدیال کورپوس­کالوزوم موش­ها در هفته­های مختلف جداسازی و به‏کمک میکروسکوپ الکترونی TEM (Philips) مورد بررسی قرار گرفت و میزان تخریب میلین اندازه­گیری شد. ابتدا بافت­ها با محلول گلوتارآلدئید و پارافرم­آلدئید (1:1) 2 درصد فیکس شدند، سپس 3 بار با محلول بافر فسفات 1/0 مولار شستشو شدند. بافت­ها به‏مدت 2 ساعت در محلول اوسمیوم 2/0 مولار قرار داده شده و سپس مراحل آبگیری به‏صورت دو مرحله­ای به کمک الکل­ ( غلظت­های 50، 70، 80، 90، 95 و 100 درصد) و هر بار 5 دقیقه انجام شد. سپس بلوک­های بافتی در رزین تهیه و به‏مدت 3 روز در انکوباتور 60 درجه سانتی‏گراد قرار گرفتند. برش­های نازک به ضخامت 50 نانومتر به‏وسیله اولترامیکروتوم و با استفاده از تیغه الماس تهیه و بر روی گریدهای مسی قرار داده شدند. نمونه­ها توسط اورانیل و سرب رنگ­آمیزی شده و اسلایدهای تهیه شده به‏وسیله میکروسکوپ الکترونی ترانسمیشن با بزرگنمایی20000 بررسی شد(19).

بررسی اثرات کوپریزون بر رفتار حیوانات مورد مطالعه: در این مرحله رفتار حیوانات مورد مطالعه بر اساس تست استاندارد میدان باز (Open Field)، در هفته­های مختلف و مورد ارزیابی قرار گرفت. دستگاه میدان باز از جعبه چوبی سفیدی با اندازه 72 در 72 سانتی‏متر با دیواری با ارتفاع 36 سانتی‏متر تشکیل شده بود. خطوط کف جعبه به شانزده مربع 18 در 18 سانتی‏متر تقسیم و یک مربع مرکزی در وسط میدان کشیده شده بود. اتاق آزمون 6/4 در 8/1متر و توسط یک لامپ قرمز 60 وات برای ایجاد نور پس زمینه روشن شده بود. این فضا پس از قرار دادن هر موش و اتمام تست به وسیله الکل اتیلن 70 درصد تمیز می‏شد (20).

آنالیز آماری

جهت انجام محاسبات آماری، از نرم افزار SPSS version 18.0  استفاده و داده­ها به‏صورت میانگین-انحراف معیار یا  mean±SD  بیان شد. آزمون­های آماری مورد استفاده، آنالیز واریانس یک‏طرفه one-way-ANOVA بود. در هر دو آنالیز 05/0p< به‏عنوان معیار معنی­دار بودن اختلاف در نظر گرفته شد.

نتایج

اثرات کوپریزون بر بیان گلیکوپروتئین وابسته به میلین (MAG)

نتایج حاصل از بررسیاثرات کوپریزون بر بیان گلیکوپروتئین وابسته به میلین در هفته­های مختلف در نمودار1 مشخص شده است. تغییر معنی­داری در بیان MAG در سه هفته اول تغذیه با کوپریزون دیده نشد. همان‏طور که مشاهده می­شود تفاوت معنی­داری در بیان MAG بین گروه آزمایشی با گروه کنترل در هفته چهارم و پنجم وجود دارد. بیشرین کاهش بیان در هفته چهارم دیده‌شده و در هفته‌پنجم نیز به همان میزان باقی‌مانده است.

اثرات کوپریزون بر بیان گلیکوپروتئین الیگودندروسیتی میلین (MOG)

نتایج حاصل از بررسیاثرات کوپریزون بر بیان گلیکوپروتئین الیگودندروسیتی میلیندر هفته­های مختلف در نمودار 1 مشخص شده است. سه هفته تغذیه با کوپریزون قادر به تغییر معنادار بیان MOGنشد. نتایج نشان می­دهد که تفاوت معنی­داری در بیان MOG بین گروه آزمایشی با گروه کنترل در هفته چهارم و پنجم وجود دارد. بیشرین کاهش بیان  به‏ترتیب در هفته پنجم و هفته چهارم دیده شد.

اثرات‌کوپریزون بر بیان پروتئولیپید پروتئین (PLP)

نتایج حاصل از بررسیاثرات کوپریزون بر بیان پروتئولیپید پروتئیندر هفته­های مختلف در نمودار 1 مشخص شده است. نتایج نشان می­دهد که تفاوت معنی­داری بین گروه آزمایشی با گروه کنترل در هفته­های سوم، چهارم و پنجم وجود دارد. سه هفته تغذیه با کوپریزون باعث تغییر معنی‏دار بیان PLPشد. بیشرین کاهش بیان PLP مربوط به هفته­های چهارم و پنجم بود.

اثرات کوپریزون‌بر بیان پروتئین‌اصلی میلین(MBP)

نتایج‌حاصل از بررسیاثرات کوپریزون بر بیان پروتئین اصلی میلیندر هفته­های مختلف در نمودار1 مشخص شده است. همان‏طور که مشاهده می­شود تفاوت معنی‌داری بین گروه آزمایشی با گروه کنترل در هفته­های سوم، چهارم و پنجم وجود دارد. سه هفته تغذیه با کوپریزون باعث تغییر معنادار بیان MBPشد. بیشرین کاهش بیان MBP مربوط به هفته­های چهارم و پنجم بود.

 

 

نمودار 1: بررسی اثر کوپریزون در هفته های 3 و 4 و 5 بر بیان MAG ، MOG، PLP و MBP. با افزایش زمان، کوپریزون باعث کاهش بیان MAG ، MOG، PLP و MBP در ناحیه کورپوس کالوزوم موش­ها نسبت به گروه کنترل شد. علامت (*) نماد تفاوت با گروه کنترل است (001/0p< *** ، 01/0p<  ** ، 05/0p< *);(3n=).

 

اثرات کوپریزون بر میزان تخریب میلین

تصاویر به‏دست آمده با میکروسکپ الکترونی برای ارزیابی میزان تخریب میلین در ناحیه مدیال کورپوس­کالوزوم در اثر مصرف کوپریزون مورد استفاده قرار گرفت (شکل 1) و نتایج در نمودار 2 نشان داده شد. همان‏طور که مشاهده می­شود تفاوت معنی‏داری بین گروه کنترل با گروه آزمایشی در هفته­های سوم، چهارم و پنجم وجود دارد. در سه هفته اول تغذیه با کوپریزون تغییر معنی‏داری در تخریب میلیندیده نشد. بیشرین کاهش میلین در هفته پنجم مشاهده شد.

 

 

شکل1: تصاویر میکروسکپ الکترونی مدیال کورپوس­کالوزوم حیوانات مورد مطالعه (نوار مقیاس یک میکرومتر). با افزایش زمان، کوپریزون باعث افزایش تخریب غلاف میلین در ناحیه کورپوزکالوزوم موش­ها نسبت به گروه کنترل شد.

 

نمودار 2: آنالیز کمی اثر کوپریزون در هفته­های 3 و 4 و 5 بر میزان تخریب میلین. با افزایش زمان، کوپریزون باعث افزایش تخریب میلین در ناحیه کورپوزکالوزوم موش­ها نسبت به گروه کنترل شد. علامت (*) نماد تفاوت با گروه کنترل است. (001/0p< *** ، 01/0p<  ** ، 05/0p<*);(3n=).

 

اثرات کوپریزون بر رفتار حیوانات در تست‌میدان باز

نتایج حاصل از بررسی اثرات کوپریزون بر رفتار حیوانات در تست اوپن فیلددر هفته­های مختلف مورد مطالعه قرار گرفت (نمودار 3). نتایج نشان داد که میزان کل حرکت (نمودار 3، الف)، مدت حرکت در ناحیه مرکزی (نمودار 3، ب)، سرعت حرکت (نمودار 3، ج) و نسبت حرکت در ناحیه مرکزی به کل حرکت (نمودار 3، د) پس از تغذیه با کوپریزون در هفته­های مختلف به‏طور معنی­داری تغییر یافته است. همان‏طور که مشاهده می­شود تفاوت معنی‌داری بین گروه کنترل با گروه آزمایشی در هفته‌های سوم، چهارم و پنجم وجود دارد. تغذیه حیوانات با کوپریزون قادر به تغییر معنی‏دار رفتار آن‏ها شد. بیشرین تغییرات رفتاری در هفته سوم دیده شد.

 

 

نمودار 3:  بررسی اثرات کوپریزون در هفته های 3 و 4 و 5 بر رفتار حیوانات توسط تست اوپن فیلد. علامت (*) نماد تفاوت با گروه کنترل است. (001/0p< *** ، 01/0p< ** ، 05/0p<*);(3n=).

 

بحث

در دهه 1960، کوپریزون به‏عنوان یک نوروتوکسین بر روی موش، رت و خوک شناخته شد. میزان استفاده از 5/0 درصد کوپریزون باعث ایجاد سمیت زیاد، فلج اندام‏ها، تشنج و مرگ میر بالا شد. ادم مغزی، دمیلینیشن، آستروگلیوزیس (Astrogliosis) و هیدروسفالوس (Hydrocephalus) علائم برجسته پاتولوژیک در موش‌های تغذیه شده با کوپریزون بودند. این مشخصات به‏صورت شدیدتر در ماده سفید مخچه و مغز میانی قابل مشاهده بود (21).

اولین بار دانشمندی به‏نام Blakemore اثربخشی تغذیه با کوپریزون را جهت القای مرگ الیگودندروسیت­ها و به‏طور ثانویه دمیلینیشن پایک­های مخچه­ای فوقانی مطرح نمود. طبق تحقیق او، طی 5 هفته تغذیه همراه با کوپریزون، بسیاری از اکسون­ها دمیلینه شده ولی الیگودندروسیت­های میلین­ساز نیز قابل تشخیص هستند (10). رمیلینیشن گسترده نیز فقط در زمان قطع کوپریزون از تغذیه حیوانات اتفاق می­افتد.  Hiremathو همکاران (22) برای اولین بار تاثیر 2/0 درصد وزنی غذای روزانه کوپریزون را بر ماده سفید مخ، به‏خصوص کورپوس‌کالوزوم که میزان دمیلینیشن به وسعت بیشتری و به آسانی قابل تشخیص است، مطرح نمودند. پس از آن، تاثیرات کوپریزون بر دمیلینیشن و رمیلینیشن به‏طور گسترده­ای بر روی کورپوس­کالوزوم مورد بررسی قرار گرفت. در سال­های اخیر نیز مطالعات زیادی در مورد دمیلینیشن و رمیلینیشن ماده خاکستری مخ و مخچه توسط کوپریزون صورت گرفته است (11).

مکانیسم دقیق نحوه ایجاد دمیلینیشن و مرگ الیگودندروسیت­ها توسط کوپریزون و متعاقب آن ایجاد دمیلینیشن هنوز شناخته نشده است. کوپریزون یک شلاتور مس بوده که منجر به کمبود مس در مغز می‌گردد. با این‏حال، مکمل­های مس با غلظت­های بالا نیز نتوانستند مانع از اثرات سمی کوپریزون شوند که نشان‏دهنده این است که کمبود مس مکانیسم اصلی عملکرد کوپریزون نمی­باشد (23).

تغذیه با کوپریزون باعث ایجاد دمیلینیشن برگشت­پذیر و از بین رفتن الیگودندروسیت­های بالغ می­‏شود، حال آن‏که سایر سلول­ها در سیستم اعصاب مرکزی تحت تاثیر آن قرار نمی­گیرند. تجویز دوزهای بالاتر این ماده، باعث تغییر در مورفولوژی میتوکندری گشته که منجر به شکل­گیری میتوکندری بسیار بزرگ در کبد می‏شود (12). به‏همین دلیل، عملکرد آنزیم­های میتوکندری در مغز و کبد مانند منوآمین اکسیداز، سیتوکروم اکسیداز و سوپراکسیددیسموتاز کاهش می­یابد (24). از آن‏جایی­که میتوکندری باعث تولید ATP شده و جهت هومئوستازی یون کلسیم در سلول و فرایند آپوپتوزیس نقش مهمی ایفا می­کند، از این‏رو اختلال عملکرد میتوکندری و متعاقب آن اختلال در متابولیسم انرژی می­تواند دلیلی جهت از بین رفتن الیگودندروسیت­ها باشد. با این‏حال، دلیل این‏که چرا فقط الیگودندروسیت­ها نسبت به کوپریزون آسیب پذیرند هنوز در دست بررسی است. در حین تغذیه با کوپریزون، دمیلینیشن ایجاد شده پس از سه هفته قابل رویت بوده و به بیشترین میزان در انتهای 5 هفته می‌رسد. این در حالی است که پس از قطع کوپریزون رمیلینیشن خودبه­خودی در مغز شروع می­شود. آپوپتوزیس اولیه الیگودندروسیت­ها و فعال شدن میکروگلیا-ماکروفاژها دو مشخصه برجسته در پاتولوژی بافتی مدل حیوانی کوپریزون می­باشند. سایر سازوکارهای دخیل در این مدل شامل مهار تمایز سلول­های پیش­ساز الیگودندروسیت­ها و ترشح سایتوکاین­های پیش التهابی از میکروگلیا-ماکروفاژهای فعال شده است (13).

از مزیت­های مهم مدل کوپریزون، مراحل دمیلینیشن و رمیلینشن واضح و برگشت­پذیر بوده که به‏راحتی قابل تشخیص هستند. مزیت دیگر این مدل در عدم آسیب پذیریBBB  بوده که باعث بررسی مراحل دمیلینیشن و رمیلینیشن در مغز بدون دخالت سیستم ایمنی می­‏شود (25).

از معایب اصلی این مدل می­توان به ناشناخته بودن مکانیسم ایجاد دمیلینیشن توسط کوپریزون اشاره کرد که می­تواند باعث سختی در شناسایی عوامل موثر در از بین رفتن الیگودندروسیت­های بالغ و در نتیجه ایجاد دمیلینیشن شود. به‏طور قطع، القای پلاک­های دمیلینه توسط کوپریزون با پلاک­های ایجاد شده در بیماری ام اس تا حدی متفاوت بوده و نمی­توان به‏طور دقیق این بیماری را توسط مدل کوپریزون ایجاد کرد. با این‏حال، این مدل جهت بررسی مراحل رمیلینیشن بسیار مفید می­باشد (25).

پس از ایجاد دمیلینیشن توسط کوپریزون و قطع آن، ساخت مجدد میلین در طول یک هفته اتفاق می­افتد. ابراز مجدد پروتئین­های میلین این امکان را فراهم می­کند که مراحل رمیلینیشن و تاثیرات آن بررسی شود. این در حالی است که با وجود اینکه مدل EAE بهترین مدل جهت بررسی التهاب سیستم عصبی مرکزی است ولی بررسی رمیلینیشن در آن بسیار مشکل بوده زیرا این پدیده هم­زمان با ایجاد دمیلینیشن اتفاق می­افتد در نتیجه امکان تمایز آن‏ها از هم به سختی امکان­پذیر است (25). با توجه به گزارش‏های ضد و نقیض از مکانیسم دقیق عمل کوپریزون در روند ایجاد مدل ام اس هنوز ابهامات زیادی در مورد نقش این ترکیب در تخریب و ترمیم میلین وجود دارد. این تاثیرات دوگانه می­تواند مربوط به شرایطی از قبیل میزان التهاب موجود و یا موقعیت پاتولوژیکی سلول که در آن بسیاری از پارامترهای سلولی دخیل است باشد. به‏طور کلی کوپریزون از طریق مکانیسم­های متعددی می­تواند باعث تغییرات در بیان گروه­های متنوعی از ژن­ها شود و به‏همین دلیل بررسی دقیق تاثیر مهار این فرآیند کاری بسیار دشوار می­نماید.

نتیجه گیری

در این مطالعه برای اولین بار، تاثیر کوپریزون هم‏زمان بر روی بیان 4 پروتئین­های اصلی تشکیل دهنده میلین­ و تغییرات رفتاری در مدل توکسیک بیماری ام اس مورد بررسی قرار گرفت. کوپریزون ماده­ای است که منجر به بروز پاسخ­های متفاوت سلولی و در راس آن‏ها آپوپتوزیس الیگودندروسیت­ها و تخریب میلین می‏شود. بررسی اخیر نشان داد پس از 7 روز تغذیه با کوپریزون، بیان پروتئین‌های میلین که توسط الیگودندروسیت­های بالغ ایجاد می­شود شروع به کاستن کرده و پس از 5 هفته تغذیه با کوپریزون به میزان 50 درصد کاهش می­یابد و بیشترین تغییرات رفتاری نیز در همین مدت مشاهده می­‏شود. بر اساس مطالعات قبلی برروی مدل کوپریزون، آپوپتوزیس الیگودندروسیت­ها پس از چند روز تغذیه با کوپریزون آغاز می­شود در حالی‏که تخریب میلین قابل رویت پس از 5 هفته و هم­زمان با از بین رفتن برخی پروتئین­های میلین قابل تشخیص است (26). در این تحقیق، کوپریزون بیشترین تاثیر را در کاهش PLP و نقص در عملکرد رفتاری در کوتاه­ترین مدت (3 هفته) در ناحیه کارپوس کالوزوم داشت ولی در این مدت تاثیری در کاهش معنادار MOG و MAGنداشت. این نتیجه بیان‏گر آن است که کوپریزون ممکن است از طریق دخالت در مکانیسم­های متفاوتی باعث تغییرات سلولی ‏شود و هم‏زمان یا اندکی پس از مشاهده تغییرات مولکولی، فرآیند نقص در عملکرد رفتاری حیوانات نیز قابل مشاهده می باشد. در مطالعات قبلی محققین اقدام به بررسی ترکیبات دارویی در هفته های مختلف نموده که این عدم تمرکز بر زمان مشخص منجر به گزارش‏های متفاوتی شده است. با توجه به تغییرات وسیع ملاحظه شده پس از پنج هفته مصرف کوپریزون توصیه می‏شود. جهت دقیق بودن نتایج حاصل از مقایسه اثرات ترکیبات حفاظتی مختلف در این مدل، ترجیها اندازه­گیری­ها در انتهای هفته پنجم صورت گیرد تا تغییر شرایط و زمان انجام مطالعات تاثیر کمتری در نتایج داشته باشد. نتایج حاصل از این مطالعه راه را برای انجام مطالعات و برنامه ریزی­های دقیقتر جهت رسیدن به نتایجی قابل استناد فراهم می­سازد.

 

 

تشکر و قدردانی

نویسندگان بر خود واجب می­دانند از مرکز تحقیقات علوم دارویی دانشگاه علوم پزشکی تهران، گروه زیست شناسی دانشگاه زابل و کلیه همکارانی که ما را در این پژوهش یاری نمودند تشکر و قدردانی نمایند.

منابع

1.Sanadgol N, Zahedani S, Sharifzadeh M, Khalseh R, et al. Recent
updates in imperative natural compounds for healthy brain and nerve
function: A systematic review of implications for multiple sclerosis.
Current drug targets. 2017;18 (13):1499-1517.

2. Sahraian MA, Khorramnia S, Ebrahim MM, Moinfar Z, et al. Multiple sclerosis in Iran: a demographic study of 8,000 patients and changes over time. European neurology. 2010;64(6): 331-6.

3. Sospedra M, Martin R. Immunology of multiple sclerosis. Annu Rev Immunol. 2005; 23: 683-7.47

4. Ramroodi N, Niazi AA, Sanadgol N, Ganjali Z, et al. Evaluation of reactive Epstein–Barr Virus (EBV) in Iranian patient with different subtypes of multiple sclerosis (MS). The Brazilian Journal of Infectious Diseases. 2013; 17(2): 156-63.

5. Dyment DA, Ebers GC, Sadovnick AD. Genetics of multiple sclerosis. The Lancet Neurology. 2004; 3(2): 104-10.

6. Ramroodi N, Khani M, Ganjali Z, Javan MR, et al. Prophylactic effect of BIO-1211 small-molecule antagonist of VLA-4 in the EAE mouse model of multiple sclerosis. Immunological investigations. 2015; 44(7): 694-712.

7. Ramroodi N, Sanadgol N, Ganjali Z, Niazi AA, et al. Monitoring of active human herpes virus 6 infection in Iranian patients with different subtypes of multiple sclerosis. Journal of pathogens. 2; 2013: 013.

8. Sanadgol N, Nikravesh A, Motalleb G, Roshanzamir F, et al. Evaluation of the association between ICAM-1 gene polymorphisms and sICAM-1 serum levels in multiple sclerosis (MS) patients in Southeast Iran. International Journal of Genetics and Molecular Biology. 2011; 3(6): 81-6.

9. Lassmann H, Brück W, Lucchinetti CF. The immunopathology of multiple sclerosis: an overview. Brain pathology. 2007; 17(2): 210-8.

10. Blakemore W. Observations on oligodendrocyte degeneration, the resolution of status spongiosus and remyelination in cuprizone intoxication in mice. Journal of neurocytology. 1972; 1(4): 413-26.

11. Skripuletz T, Bussmann JH, Gudi V, Koutsoudaki PN, et al. Cerebellar cortical demyelination in the murine cuprizone model. Brain pathology. 2010; 20(2): 301-12.

12. Wakabayashi T, Asano M, Kurono C. Mechanism of the formation of megamitochondria induced by copper‐chelating agents. Pathology International. 1975; 25(1): 15-37.

13. Kipp M, Clarner T, Dang J, Copray S, et al. The cuprizone animal model: new insights into an old story. Acta neuropathologica. 2009; 118(6): 723-36.

14. Steinman L. The re-emergence of antigen-specific tolerance as a potential therapy for MS. Multiple Sclerosis Journal. 2015; 21(10): 1223-38.

15. Oyama F, Kotliarova S, Harada A, Ito M, et al. Gem GTPase and Tau morphological changes induced by gem GTPase in cho cells are antagonized by tau. Journal of Biological Chemistry. 2004; 279(26): 27272-7.

16. Elbaz B, Traka M, Kunjamma RB, Dukala D, et al. Adenomatous polyposis coli regulates radial axonal sorting and myelination in the PNS. Development. 2016; 143(13): 2356-66.

17. Sanadgol N, Golab F, Tashakkor Z, Taki N, et al. Neuroprotective effects of ellagic acid on cuprizone-induced acute demyelination through limitation of microgliosis, adjustment of CXCL12/IL-17/IL-11 axis and restriction of mature oligodendrocytes apoptosis. Pharmaceutical Biology. 2017; 55(1): 1679-87.

18. Lang J, Maeda Y, Bannerman P, Xu J, et al. Adenomatous polyposis coli regulates oligodendroglial development. Journal of Neuroscience. 2013; 33(7): 3113-30.

19. Hussain R, Ghoumari AM, Bielecki B, Steibel J, et al. The neural androgen receptor: a therapeutic target for myelin repair in chronic demyelination. Brain. 2013; 136(1): 132-46.

20. Walker J, Fowler S, Miller D, Sun A, et al. Spatial learning and memory impairment and increased locomotion in a transgenic amyloid precursor protein mouse model of Alzheimer's disease. Behavioural brain research. 2011;222(1): 169-75.

21. Kesterson JW, Carlton WW. Cuprizone toxicosis in mice—attempts to antidote the toxicity. Toxicology and applied pharmacology. 1983; 22(1): 6-13.

22. Hiremath M, Saito Y, Knapp G, Ting J-Y, et al. Microglial/macrophage accumulation during cuprizone-induced demyelination in C57BL/6 mice. Journal of neuroimmunology. 1998; 92(1): 38-49.

23. Carlton WW. Studies on the induction of hydrocephalus and spongy degeneration by cuprizone feeding and attempts to antidote the toxicity. Life sciences. 1967; 6(1): 11-9.

24. Zhang Y, Xu H, Jiang W, Xiao L, et al. Quetiapine alleviates the cuprizone-induced white matter pathology in the brain of C57BL/6 mouse. Schizophrenia research. 2008; 106(2): 182-91.

25. Skripuletz T, Gudi V, Hackstette D, Stangel M. De-and remyelination in the CNS white and grey matter induced by cuprizone: the old, the new, and the unexpected. Histol Histopathol. 2011; 26(12): 1585-97.

26. Pacifico F, Leonardi A. NF-κB in solid tumors. Biochemical pharmacology. 2006; 72(9): 1142-52.

1.Sanadgol N, Zahedani S, Sharifzadeh M, Khalseh R, et al. Recent
updates in imperative natural compounds for healthy brain and nerve
function: A systematic review of implications for multiple sclerosis.
Current drug targets. 2017;18 (13):1499-1517.

2. Sahraian MA, Khorramnia S, Ebrahim MM, Moinfar Z, et al. Multiple sclerosis in Iran: a demographic study of 8,000 patients and changes over time. European neurology. 2010;64(6): 331-6.

3. Sospedra M, Martin R. Immunology of multiple sclerosis. Annu Rev Immunol. 2005; 23: 683-7.47

4. Ramroodi N, Niazi AA, Sanadgol N, Ganjali Z, et al. Evaluation of reactive Epstein–Barr Virus (EBV) in Iranian patient with different subtypes of multiple sclerosis (MS). The Brazilian Journal of Infectious Diseases. 2013; 17(2): 156-63.

5. Dyment DA, Ebers GC, Sadovnick AD. Genetics of multiple sclerosis. The Lancet Neurology. 2004; 3(2): 104-10.

6. Ramroodi N, Khani M, Ganjali Z, Javan MR, et al. Prophylactic effect of BIO-1211 small-molecule antagonist of VLA-4 in the EAE mouse model of multiple sclerosis. Immunological investigations. 2015; 44(7): 694-712.

7. Ramroodi N, Sanadgol N, Ganjali Z, Niazi AA, et al. Monitoring of active human herpes virus 6 infection in Iranian patients with different subtypes of multiple sclerosis. Journal of pathogens. 2; 2013: 013.

8. Sanadgol N, Nikravesh A, Motalleb G, Roshanzamir F, et al. Evaluation of the association between ICAM-1 gene polymorphisms and sICAM-1 serum levels in multiple sclerosis (MS) patients in Southeast Iran. International Journal of Genetics and Molecular Biology. 2011; 3(6): 81-6.

9. Lassmann H, Brück W, Lucchinetti CF. The immunopathology of multiple sclerosis: an overview. Brain pathology. 2007; 17(2): 210-8.

10. Blakemore W. Observations on oligodendrocyte degeneration, the resolution of status spongiosus and remyelination in cuprizone intoxication in mice. Journal of neurocytology. 1972; 1(4): 413-26.

11. Skripuletz T, Bussmann JH, Gudi V, Koutsoudaki PN, et al. Cerebellar cortical demyelination in the murine cuprizone model. Brain pathology. 2010; 20(2): 301-12.

12. Wakabayashi T, Asano M, Kurono C. Mechanism of the formation of megamitochondria induced by copper‐chelating agents. Pathology International. 1975; 25(1): 15-37.

13. Kipp M, Clarner T, Dang J, Copray S, et al. The cuprizone animal model: new insights into an old story. Acta neuropathologica. 2009; 118(6): 723-36.

14. Steinman L. The re-emergence of antigen-specific tolerance as a potential therapy for MS. Multiple Sclerosis Journal. 2015; 21(10): 1223-38.

15. Oyama F, Kotliarova S, Harada A, Ito M, et al. Gem GTPase and Tau morphological changes induced by gem GTPase in cho cells are antagonized by tau. Journal of Biological Chemistry. 2004; 279(26): 27272-7.

16. Elbaz B, Traka M, Kunjamma RB, Dukala D, et al. Adenomatous polyposis coli regulates radial axonal sorting and myelination in the PNS. Development. 2016; 143(13): 2356-66.

17. Sanadgol N, Golab F, Tashakkor Z, Taki N, et al. Neuroprotective effects of ellagic acid on cuprizone-induced acute demyelination through limitation of microgliosis, adjustment of CXCL12/IL-17/IL-11 axis and restriction of mature oligodendrocytes apoptosis. Pharmaceutical Biology. 2017; 55(1): 1679-87.

18. Lang J, Maeda Y, Bannerman P, Xu J, et al. Adenomatous polyposis coli regulates oligodendroglial development. Journal of Neuroscience. 2013; 33(7): 3113-30.

19. Hussain R, Ghoumari AM, Bielecki B, Steibel J, et al. The neural androgen receptor: a therapeutic target for myelin repair in chronic demyelination. Brain. 2013; 136(1): 132-46.

20. Walker J, Fowler S, Miller D, Sun A, et al. Spatial learning and memory impairment and increased locomotion in a transgenic amyloid precursor protein mouse model of Alzheimer's disease. Behavioural brain research. 2011;222(1): 169-75.

21. Kesterson JW, Carlton WW. Cuprizone toxicosis in mice—attempts to antidote the toxicity. Toxicology and applied pharmacology. 1983; 22(1): 6-13.

22. Hiremath M, Saito Y, Knapp G, Ting J-Y, et al. Microglial/macrophage accumulation during cuprizone-induced demyelination in C57BL/6 mice. Journal of neuroimmunology. 1998; 92(1): 38-49.

23. Carlton WW. Studies on the induction of hydrocephalus and spongy degeneration by cuprizone feeding and attempts to antidote the toxicity. Life sciences. 1967; 6(1): 11-9.

24. Zhang Y, Xu H, Jiang W, Xiao L, et al. Quetiapine alleviates the cuprizone-induced white matter pathology in the brain of C57BL/6 mouse. Schizophrenia research. 2008; 106(2): 182-91.

25. Skripuletz T, Gudi V, Hackstette D, Stangel M. De-and remyelination in the CNS white and grey matter induced by cuprizone: the old, the new, and the unexpected. Histol Histopathol. 2011; 26(12): 1585-97.

26. Pacifico F, Leonardi A. NF-κB in solid tumors. Biochemical pharmacology. 2006; 72(9): 1142-52.