بررسی تاثیر نانوذرات روی و کبالت بر بیان ژن‌های STR، DAT و D4H درسوسپانسیون سلولی گیاه پروانش (Catharanthus roseus)

نوع مقاله: علمی - پژوهشی

نویسندگان

1 کارشناس ارشد بیوتکنولوژی کشاورزی، دانشگاه بین‌المللی امام خمینی (ره) قزوین، قزوین، ایران

2 دانشگاه بین المللی امام خمینی(ره) قزوین، گروه بیوتکنولوژی کشاورزی، قزوین، ایران

3 دانشگاه بین‌المللی امام خمینی (ره) قزوین، گروه اصلاح نباتات، قزوین، ایران

چکیده

هدف: هدف از این پژوهش بررسی اثر دو نانو ذره به عنوان الیسیتور بر بیان سه ژن کلیدی این مسیر بود.
مواد و روش­ها:. به این منظور از غلظت­های 5/0، 75/0 و 1 میلی­گرم در لیتر نانو­اکسیدکبالت و نانواکسید روی استفاده و در زمان­های 8، 24و 48 ساعت پس از تیمار، نمونه­برداری انجام شد.
نتایج: بررسی بیان ژن­ها به روش SQ-RT-PCR انجام شد. به طورکلی، هر دو الیسیتور مورد استفاده بر بیان ژن­ها تاثیر داشتند. تاثیر نانواکسید روی بر بیان ژن­ها بیشتر از نانواکسید کبالت بود. در مورد ژن STR و D4H بیشترین افزایش بیان مربوط به غلظت 5/0 میلی­گرم در لیتر و برای ژن DAT غلظت 1 میلی­گرم در لیتر نانواکسید روی در بازه زمانی 8 ساعت بود. نانواکسید کبالت در اکثر غلظت­ها و بازه­های زمانی مورد استفاده باعث کاهش بیان ژن­های مورد بررسی شد.
نتیجه گیری: هر دو نانو ذره نانو اکسید کبالت و روی توانستند بر بیان ژنهای کلیدی مسیر وین بلاستین و وین کریستین تاثیر بگذارند.

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

پروانش با نام علمی Catharanthus roseus از خانواده خرزهره (Apocynaceae) می­باشد. این گیاه یکی از مهم‏ترین گیاهان دارویی است که در سطح جهان به‏دلیل وجود خاصیت ضدسرطانی شناخته شده است (1). پروانش گیاهی است درختچه­ای، چندساله که البته در مناطق سرد به‏صورت یک­ساله کشت می­شود. منشاء این گیاه مناطق حاره و گرمسیر مانند جنوب هند، اندونزی و ماداگاسکار گزارش شده است و در دشت­ها و تپه­هایی که 500 متر از سطح دریا ارتفاع دارند می­روید. همچنین رویش این گیاه در قاره­های آفریقا، آمریکا، آسیا، استرالیا و بعضی از جزایر اقیانوس آرام نیز گزارش شده­است (2). به‏علت وجود آلکالوئیدهای ارزشمند در پیکر رویشی و ریشه پروانش، در اکثر فارماکوپه­ها به‏عنوان یک گیاه دارویی بسیار مهم معرفی و خواص آن نیز بیان شده است. این گیاه به‏علت دارا بودن آلکالوئیدهای مهم نظیر وین­بلاستین و وین­کریستین که هر دو اثر آنتی­نئوپلازی (ضد تومور) دارند، در صنایع داروسازی اهمیت بسیاری دارد. این مواد در شیمی­درمانی برخی سرطان­ها نیز کاربرد دارند (3، 4). تاکنون 130 نوع آلکالوئید از این گیاه استخراج شده است که مقدار آن را در پیکر رویشی 2/0 تا 1 درصد گزارش کرده­اند. آلکالوئیدهای پروانش همگی از گروه تریپتوفان می­باشند. آلکالوئیدهای وین­بلاستین و وین­کریستین در برگ­ها ساخته و ذخیره می­شوند. مقدار این آلکالوئیدها در این گیاه بسیار کم است. به‏عنوان مثال، می­توان از وین­کریستین در برگ­ها نام برد که مقدار آن به 003/0 درصد می­رسد و یک تن از برگ­­های خشک پروانش، فقط حاوی 3 گرم از این آلکالوئیدها می‏باشد (5). وین­بلاستین و وین­کریستین به‏صورت تجاری از مقدار زیادی گیاه پروانش استخراج می­شوند (6). یکی از روش‏هایی که امروزه بیش از هر موضوع دیگر در زمینه بررسی متابولیت­های گیاهی مورد توجه قرار دارد، روش کشت اندام، بافت و سلول گیاهی است. محققین با استفاده از این روش سعی می­کنند تا شواهد بیشتری در رابطه با چگونگی بیوسنتز متابولیت­ها و نیز مکانیسم تنظیمی آن به‏دست آورند و با این روش­ها توانسته­اند تولید متابولیت­های ثانویه با ارزش را درگیاهان افزایش دهند (7). برخی از این ترکیبات مانند: دیجی توکسین، شیکونین، عطر جاسمین و داروهای ضد سرطان مانند: وین بلاستین، وین کریستین و تاکسول از ارزش اقتصادی بالایی برخوردارند و قیمت آن‏ها از چند دلار تا چند هزار دلار به‏ازای هر کیلو تغییر می کند. تولید انبوه و سریع این مواد پیچیده در مقیاس زیاد از طریق روش‏های شیمیایی عمدتا مشکل و یا غیرممکن می‏باشد و از سویی محدودیت‏های مختلف مانع تامین این مواد از طبیعت است. استفاده از راه‏کارهای فناوری زیستی از جمله کشت سوسپانسیون سلولی، کشت اندام (کشت ریشه های موئین و ساقه) راه حلی مناسب برای تولید سریع و انبوه متابولیت‏های ثانویه می باشد (8). سوسپانسیون سلولی در گیاه پروانش برای تولید آجمالیسین، کاتارانتیین، سرپنتین و بسیاری از تولیدات دارویی مهم دیگراستفاده شده است (9). الیسیتورهای مختلف قارچی به‏منظور بهبود بخشیدن به تولید ایندول آلکالوئیدها در سوسپانسیون سلولی پروانش آزمایش شدند. نتایج نشان داد که میسلیوم­های قارچی مختلف تجمع انواع مختلفی از ایندول آلکالوئیدها (آجمالیسین، سرپنتین و کاتارانتین) را تحریک می­کند که 2 الی 5 برابر بیشتر از شاهد است. افزودن الیسیتور در دوزهایی بین 5 تا 30 میلی‏گرم بر لیتر کربوهیدرات، نتایج مشابهی در تجمع مقدار و تنوع ایندول آلکالوئیدها نشان داد (10). در ده سال اخیر، اطلاعات قابل ملاحظه­ای از رشد و تولید متابولیت­های ثانویه به‏وسیله کشت سلول و بافت پروانش به‏دست آمده است (11). بررسی اثر کادمیوم در تولید آجمالیسین در کشت سوسپانسیون سلولی پروانش نشان داد که کادمیوم، سطح رونویسی TDC، غلظت تریپتامین سلولی و تولید آجمالیسین را در سلول افزایش می­دهد (12). آنزیم استریکتوسیدین سینتاز (Strictosidine synthase، STR) در مسیر بیوسنتز ترپنوئید ایندول آلکالوئیدها باعث تبدیل تریپتامین و سکولوگانین به استریکتوسیدین می­شود که پیش­ماده تولید تمامی ترپنوئید ایندول آلکالوئیدهاست. همه آلکالوئیدها در یک قسمت از مسیر بیوشیمیایی تا تولید ماده استریکتوسیدین مشترک هستند و از این نقطه، مسیر در گونه­های مختلف گیاهی تولید­کننده مواد آلکالوئیدی منشعب می­شود (13). D4H (Desacetoxyvindoline-4 hydroxylase) جزو آنزیم­های نهایی در مسیر بیوسنتز ایندول آلکالوئیدهاست. در این مسیر D4H باعث تبدیل دی­استوکسی ویندولین به دی­استیل ویندولین می­شود که از پیش­ماده­های ضروری برای تولید ویندولین است (14). ژن DAT (Deacetyl vindoline-4-O-acetyl transferase) آنزیم استیل کوا را کد می­کند. این ژن در آخرین مرحله از مسیر تولید ایندول آلکالوئیدها منجر به تولید ویندولین می­شود (15) با توجه به یافته­های علمی صورت گرفته تاکنون گزارشی مبنی بر استفاده از نانوذرات به‏منظور بررسی تأثیر آن­ها بر بیان ژن­های گیاه پروانش صورت نگرفته است. بنابراین افزایش بیان ژن­های STR، DAT و D4H درگیاه پروانش تحت تأثیر الیسیتورهای نانوکبالت و نانوروی هدف این پژوهش قرارگرفت.

مواد و روش­ها

گیاه پروانش از گلخانه دانشگاه بین المللی امام خمینی (ره) قزوین تهیه شد. از برگ­های نزدیک گل و برگ­های جوان به‏منظور تهیه کالوس نمونه­برداری شد. برگ­ها به روش احمدی و همکاران (16) ضدعفونی گردید. از محیط کشت موراشیک و اسکوگ (MS) در سال 1962 به‏عنوان محیط کشت پایه جهت کشت برگ­ها، القا کالوس و ایجاد سوسپانسیون سلولی استفاده شد. در این آزمایش از دو هورمون 2,4-D (mg/L 1) و BAP (mg/L 5/0) استفاده شد. برای تهیه سوسپانسیون سلولی، حدود 2 گرم از کالوس­ها به ارلن­های 500 میلی­لیتری دارای 100 میلی­لیتر محیط کشت منتقل شدند و در دمای 2 ± 25 درجه سانتی­گراد روی شیکر انکوباتور، با شدت 120 دور در دقیقه و در تاریکی قرار گرفتند. تیمار هورمونی مشابه با تیمار کالوس­زایی بود.

رسم منحنی رشد و اعمال الیسیتور: برای تعیین پیک رشد سلول­ها به‏منظور اعمال الیسیتور نمونه­برداری از سلول­ها هر 3 روز یک­ بار و در بازه­های زمانی 0، 3، 6، 9، 12، 15، 18، 21 و 24 روز انجام گرفت و میزان وزن تر و وزن خشک سلول­ها اندازه­گیری و یادداشت شد. برای اعمال الیسیتورهای روی وکبالت، از محلول مادری که دارای غلظت 1000 میلی­گرم در لیتر بود، استوک تهیه شد. پس از این که کشت­های سوسپانسیون سلولی به بیشترین میزان رشد خود رسیدند، نانوذره­های روی و کبالت در غلظت­های 5/0، 75/0 و 1 میلی­گرم در لیتر به محیط­ها اضافه شد. جهت بررسی بیان ژن، محتوای هر ارلن در تیمارهای زمانی 8، 24و 48 ساعت پس از تیمار از صافی عبور داده شد و پس از خارج شدن آب اضافی نمونه­ها، وزن آن­ها یادداشت گردید و سپس نمونه­ها به‏منظور تثبیت به‏طور جداگانه در فویل آلومینیومی پیچیده شدند و در ازت مایع قرار گرفتند و تا زمان استخراج RNA در دمای 80- درجه سانتی­گراد نگه‏داری شدند.

استخراج RNA و ساخت cDNA: استخراج RNA با استفاده از کیت RNX-PLUS ساخت شرکت سینا­کلون (تهران، ایران) طبق دستور شرکت سازنده انجام شد. غلظت RNA استخراج شده با استفاده از اسپکتروفتومتر تخمین زده شد و کیفیت آن با استفاده از الکتروفورز ژل آگارز (5/1 درصد) بررسی شد. برای حذف آلودگی ژنومی از آنزیمΙ DNase ساخت شرکت سینا کلون استفاده شد. cDNA با استفاده از RNAکل، مخلوط dNTP و Oligo-dT Primer (شرکت سینا­کلون) ساخته شد. جهت اطمینان از درستی سنتز cDNA­ ها واکنش PCR با استفاده از آغازگر S rRNA18 انجام شد. سپس تمامی نمونه­ها روی ژل آگارز 5/1 درصد (w/v) الکتروفورز (شرکت پایا پژوهش، مشهد) شدند. کیفیت و درستی سنتز cDNA پس از عکس­برداری از ژل توسط دستگاه مستند ساز ژل (Gel Documentation System, UVP, USA) تأیید شد.

واکنش زنجیره­ای پلیمراز: توالی آغازگر ژن­های STR، D4H بر اساس تحقیق صورت گرفته توسط Wei (4) ساخته شدند. توالی آغازگر برای ژن DAT با استفاده از نرم­افزار Oligo5 طراحی شد و از لحاظ عدم اتصال غیراختصاصی و تشکیل دایمر با استفاده ازPrimer blast مورد بررسی و تأیید قرار گرفت (جدول 1).

برای بررسی بیان ژن از روش SQ-RT-PCR استفاده شد. به‏همین منظور ابتدا شرایط انجام واکنش PCR برای ژن خانه­دار (SrRNA 18) بهینه شد. سپس واکنش PCR برای سایر ژن­ها در شرایط تعیین شده صورت گرفت. شرایط انجام PCR (Techne, Germany) برای ژن خانه­دار از طریق تغییر دمای اتصال، زمان هر چرخه و نیز تعداد چرخه­های واکنش بهینه شد. واکنش PCR با استفاده از PCR Master Kit محصول شرکت سیناکلون (تهران، ایران) و آغازگرهای اختصاصی صورت گرفت. برای بررسی محصولات واکنش SQ-RT-PCR از ژل آگارز 5/1 درصد استفاده شد. مقدار 5 میکرولیتر از محصولات PCR روی ژل، بارگذاری و الکتروفورز شد. سپس عکس­برداری از ژل انجام و شدت نسبی باندها با استفاده از نرم­افزار ImageJ سنجیده شد. آنالیز داده­های حاصل با استفاده از نرم­افزارSPSS در قالب آزمایش فاکتوریل بر پایه طرح کامل تصادفی و با استفاده از آزمون دانکن بررسی شد.

 

 

جدول 1: لیست آغازگرهای مورد استفاده جهت بررسی بیان ژن

نام ژن و آغازگر

توالی آغازگر

طول قطعه (جفت باز)

STRآغازگر رفت

5'-tgacagtcccgaaggtgtgg-3'

122

STRآغازگربرگشت

5'- cgccgggaacatgtagctct-3'

 

D4Hآغازگر رفت

5'- taccctgcatgccctcaacc-3'

121

D4Hآغازگربرگشت

5'- ttgaaggccgccaatttgat -3'

 

DATآغازگر رفت

5'- agaaaccaacggatacgcac-3'

96

DATآغازگر برگشت

5'- tcaaaccctcttctccaacc -3'

 

SrRNA18آغازگر رفت

5'- gcaacaaaccccgacttctg -3'

102

SrRNA18 آغازگربرگشت

5'- tgcgatccgtcgagttatca -3'

 

 

 

نتایج

تجزیه واریانس بیان ژن STR

مقایسه میانگین داده­های مربوط به بیان ژن STR با استفاده از نانو­اکسید روی نشان داد که اثر زمان، غلظت و همچنین اثر متقابل زمان و غلظت در سطح 1 درصد معنی­دار شد. در مورد نانواکسید کبالت اثر زمان­ معنی­دار نبود و اثر غلظت در سطح 5 درصد و اثر متقابل زمان و غلظت در سطح 1 درصد معنی­دار شد (جدول 2 و 3).

 

جدول 2: مقایسه میانگین بیان ژن STR تحت تیمارهای مختلف نانواکسید روی در زمان­های مختلف

منبع تغییرات

(S. O. V)

درجه آزادی (df)

مجموع مربعات (SS)

میانگین مربعات (MS)

F

زمان

2

462/2033

731/1016

**094/26

غلظت

2

671/1500

336/750

**257/19

زمان × غلظت

4

551/2416

138/604

**505/15

خطا

18

349/701

964/38

 

کل

26

034/6652

 

 

**: معنی­دار بودن در سطح احتمال 1 درصد

 

 

 

جدول 3: مقایسه میانگین بیان ژن STR تحت تیمارهای مختلف نانواکسید کبالت در زمان­های مختلف

منبع تغییرات

(S. O. V)

درجه آزادی (df)

مجموع مربعات (SS)

میانگین مربعات (MS)

F

زمان

2

521/52

261/26

ns153/4

غلظت

2

043/12

022/6

*952/0

زمان × غلظت

4

005/275

751/68

**872/10

خطا

18

827/113

324/6

 

کل

26

396/453

 

 

**: معنی­دار بودن در سطح احتمال 1 درصد *: معنی­دار بودن در سطح احتمال 5 درصد   ns: معنی­دار نبودن

 

بررسی بیان ژن STR

مقایسه میانگین داده­های مربوط به بیان ژن STR در زمان­ها و غلظت­های مختلف نانواکسید روی اختلاف معنی­دار در سطح 1 درصد نشان داد. در بازه زمانی 8 ساعت همه تیمارهای غلظتی نانواکسید روی (5/0، 75/. و 1 میلی­گرم در لیتر) باعث افزایش بیان ژن STR شدند. بیشترین بیان مربوط به غلظت 5/0 میلی­گرم در لیتر و پس از آن غلظت­های 1 و 75/0 میلی­گرم در لیتر بود. در زمان 24 ساعت پس از اعمال تیمارها، غلظت­های 5/0 و 1 میلی­گرم در لیتر نانواکسید روی باعث افزایش در بیان ژن شدند ولی غلظت 75/0 میلی­گرم در لیتر باعث کاهش بیان ژن شد در بازه زمانی 48 ساعت، نانواکسید روی در همه غلظت­ها باعث افزایش در بیان ژن شد. بیشترین افزایش بیان به‏ترتیب مربوط به غلظت 5/0، 1 و 75/0 میلی­گرم در لیتر بود. نانواکسید کبالت در بازه های زمانی و غلظت­های مختلف اثر چشم‏گیری از خود نشان نداد. تنها در غلظت­های 5/0 میلی­گرم در لیتر و 8 ساعت و غلظت 75/0 میلی­گرم در لیتر و 24 ساعت باعث افزایش جزئی در بیان ژن شد.

میزان بیان ژن STR و مقایسه میانگین تیمارهای مختلف از نظر شدت نسبی باند برای این ژن در تمام زمان­ها تحت تأثیر نانواکسید روی و کبالت در شکل 1 آمده است.

 

 

شکل 1: مقایسه میانگین تیمارهای مختلف از نظر شدت نسبی باند برای ژن STR در تمام زمان­ها، بعد از اعمال الیسیتورها

* حروف متفاوت نشانگر تفاوت معنی­دار در آزمون دانکن است.

 

تجزیه واریانس بیان ژن DAT          

مقایسه میانگین داده­های مربوط به بیان ژن DAT با استفاده از نانو­اکسید روی نشان داد که اثر زمان و همچنین اثر متقابل زمان و غلظت معنی­دار شد ولی اثر غلظت معنی­دار نشد. در مورد نانواکسید کبالت اثر زمان­، غلظت و اثر متقابل زمان و غلظت در سطح 1 درصد معنی­دار شد (جدول4 و 5).

 

جدول 4: مقایسه میانگین بیان ژن DAT تحت تیمارهای مختلف نانواکسید روی در زمان­های مختلف

منبع تغییرات

(S. O. V)

درجه آزادی (df)

مجموع مربعات (SS)

میانگین مربعات (MS)

F

زمان

2

835/832

417/416

**799/16

غلظت

2

736/160

368/80

ns242/3

زمان × غلظت

4

206/331

802/82

*340/3

خطا

18

195/446

789/24

 

کل

26

972/1770

 

 

**: معنی­دار بودن در سطح احتمال 1 درصد  *: معنی­دار بودن در سطح احتمال 5 درصد   ns: معنی­دار نبودن

 

 

 

 

 

جدول 5: مقایسه میانگین بیان ژن DAT تحت تیمارهای مختلف نانواکسید کبالت در زمان­های مختلف

منبع تغییرات

(S. O. V)

درجه آزادی (df)

مجموع مربعات (SS)

میانگین مربعات (MS)

F

زمان

2

789/1

894/0

**730/6

غلظت

2

204/10

102/5

**393/38

زمان × غلظت

4

047/44

012/11

**859/82

خطا

18

392/2

133/0

 

کل

26

432/58

 

 

**: معنی­دار بودن در سطح احتمال 1 درصد

 

 

بررسی بیان ژن DAT

در زمان 8 ساعت بعد از اعمال تیمار، نانواکسید روی در همه غلظت­ها باعث افزایش بیان ژن شد. بیشترین افزایش بیان به‏ترتیب مربوط به غلظت­های 1، 5/0 و غلظت75/0 میلی­گرم در لیتر بود. در بازه زمانی 24 ساعت، هر سه غلظت مورد استفاده نانواکسید روی بیان ژن DAT را افزایش دادند. بیشترین بیان مربوط به غلظت 5/0 و پس از آن به‏ترتیب مربوط به غلظت­های 1 و 75/0 میلی­گرم در لیتر بود. در زمان 48 ساعت پس از اعمال تیمارها، همه تیمارها­ی نانواکسید روی بیان ژن DAT را افزایش دادند. غلظت 5/0 میلی­گرم در لیتر بیشترین تأثیر را بر بیان این ژن داشت. نانواکسید کبالت بیان ژن DAT را نسبت به شاهد کاهش داد تنها در غلظت 75/0 میلی­گرم در لیتر پس از 8 ساعت و غلظت 1 میلی­گرم در لیتر پس از 24 ساعت بیان ژن را تا حد کمی افزایش داد ولی غلظت­ها و بازه ­های زمانی دیگر بر بیان ژن DAT تأثیر منفی داشتند (شکل 2).

 

 

شکل 2: مقایسه میانگین تیمارهای مختلف از نظر شدت نسبی باند برای ژن DAT در تمام زمان­ها، بعد از اعمال الیسیتورها

* حروف متفاوت نشانگر تفاوت معنی­دار در آزمون دانکن است.

 

 

تجزیه واریانس بیان ژن D4H

مقایسه میانگین داده­های مربوط به بیان ژن D4H با استفاده از نانو­اکسید روی نشان داد که اثر زمان، غلظت و همچنین اثر متقابل زمان و غلظت معنی­دار شد. در مورد نانواکسید کبالت اثر زمان­ معنی­دار نبود و اثر غلظت و اثر متقابل زمان و غلظت در سطح 1 درصد معنی­دار شد (جدول6 و 7).

 

جدول 6: مقایسه میانگین بیان ژن D4H تحت تیمارهای مختلف نانواکسید روی در زمان­های مختلف

منبع تغییرات

(S. O. V)

درجه آزادی (df)

مجموع مربعات (SS)

میانگین مربعات (MS)

F

زمان

2

870/625

935/312

**376/13

غلظت

2

725/14/1494

362/747

**944/31

زمان × غلظت

4

010/318

503/79

*398/3

خطا

18

126/421

396/23

 

کل

26

731/2859

 

 

**: معنی­دار بودن در سطح احتمال 1 درصد     *: معنی­دار بودن در سطح احتمال 5 درصد  

 

جدول 7: مقایسه میانگین بیان ژن D4H تحت تیمارهای مختلف نانواکسید کبالت در زمان­های مختلف

منبع تغییرات

(S. O. V)

درجه آزادی (df)

مجموع مربعات (SS)

میانگین مربعات (MS)

F

زمان

2

942/3

971/1

ns201/1

غلظت

2

907/68

454/34

**994/20

زمان × غلظت

4

181/108

045/27

**480/16

خطا

18

540/29

641/1

 

کل

26

571/210

 

 

**: معنی­دار بودن در سطح احتمال 1 درصد   ns: معنی­دار نبودن

 

 

بررسی بیان ژن D4H

در مورد نانواکسید روی در زمان 8 ساعت پس از اعمال تیمار، هر سه غلظت 5/0، 75/0 و 1 میلی­گرم در لیتر بیان ژن D4H را افزایش دادند. بیشترین افزایش مربوط به غلظت 5/0 میلی­گرم در لیتر بود در بازه زمانی 24 ساعت، نانواکسید روی در غلظت 75/0 باعث کاهش بیان ژن D4H شد و در دو غلظت دیگر بیان ژن را افزایش داد. در بازه زمانی 48 ساعت، نانواکسید روی در هر سه غلظت، بیان ژن D4H را افزایش داد و بیشترین بیان مربوط به غلظت 5/0 میلی­گرم در لیتر بود. نانواکسید کبالت بیان ژن را در تمام غلظت ها و بازه­های زمانی یا اثری بر بیان ژن نشد یا اثر کاهشی داشت (شکل 3).

 

 

شکل 3: مقایسه میانگین تیمارهای مختلف از نظر شدت نسبی باند برای ژن D4H در تمام زمان­ها، بعد از اعمال الیسیتورها

* حروف متفاوت نشانگر تفاوت معنی­دار در آزمون دانکن است.

 

 

بحث

در این مطالعه مشخص شد که هر سه ژن STR، DAT وD4H تحت تأثیر نانوذرات قرار می­گیرند. Liu و همکاران (1) در مطالعه­ای به بررسی اثرات UV روی تولید آلکالوئیدها و همچنین تأثیرآن روی بیان ژن­های درگیر در مسیر تولید ترپنوئید ایندول آلکالوئیدها در برگ پروانش پرداختند. در مطالعه آن­ها برای بررسی بیان ژن­ها از SQ-RT-PCR استفاده شد. تفاوت معنی‏داری در بیان ژن­های TDC، STR، D4H و DAT بین نمونه­های تیمار و شاهد مشاهده شد. بیان ژن STR در زمان 72 ساعت پس از تیمار افزایش و بیان این ژن در زمان­های 6، 12و 24 ساعت پس از تیمار کاهش یافت. بیان ژن­های DAT و D4H در زمان 12 و 72 ساعت پس از تیمار افزایش و در سایر زمان­ها کاهش یافت. نتایج این پژوهش نیز مشخص کرد که نانواکسید روی، بیان ژن STR را در همه غلظت­ها افزایش داد. تنها استثنا در این مورد غلظت 75/0 میلی گرم در لیتر پس از 24 ساعت بود که باعث کاهش بیان شد. نانواکسید کبالت اثر متفاوتی از خود نشان داد. به‏طوری­که باعث کاهش معنی­دار در بیان ژن شد. درست در نقطه مقابل نانو اکسید روی، نانو اکسید کبالت در غلظت 75/0 میلی گرم در لیتر پس از 24 ساعت باعث افزایش بیان ژن STR شد اما این کاهش بیان معنی­دار نبود. در مورد ژن DAT، هر دو نانو ذره اکسید روی و کبالت رفتارهای مشابه مورد ژن STR از خود نشان دادند. یعنی نانو اکسید روی توانست بیان ژن STR را افزایش دهد اما در مورد نانواکسید کبالت باعث کاهش بیان ژن DAT شد. نانو اکسید روی توانست بیان ژن STR را در چند غلظت تا شدت نسبی 60 بالا ببرد اما این افزایش برای ژن DAT ، تا شدت نسبی حدود 40 بود. یعنی اثر نانواکسید روی بر ژن STR بیشتر از اثر آن بر ژن DAT بود. اما به‏هر صورت نانو اکسید کبالت در هر دو مورد بیان ژن­های STR و DAT را کاهش داد. مشابه با ژن DAT، نانو ذره اکسید روی در همه غلظت­ها بیان ژن D4H را افزایش داد. اما تنها در زمان 24 ساعت و غلظت 75/0 باعث کاهش بیان این ژن شد. مانند دو ژن دیگر نانواکسید کبالت بیان ژن D4H را نیز کاهش داد. نتایج شعبانی و همکاران (17) مشخص کرد که بیان ژن DAT در اثر تیمار با اتیلن در 6 ساعت پس از تیمار 2/5 برابر شاهد بود. پس از 12 ساعت میزان بیان این ژن به نصف شاهد رسید. در 24 ساعت بعد از تیمار، میزان بیان در مقایسه با شاهد افزایش 4/1 برابری را نشان داد. در 48 ساعت میزان بیان این ژن افزایش 05/1 را نسبت به شاهد نشان داد. در زمان 72 ساعت سطح بیان این ژن کاهش و به 8/0 شاهد خود رسید. این یافته­ها با نتایج این پژوهش در زمان­های 8، 24 و 48 ساعت توسط نانواکسید روی برای ژن DAT مشابه بود که بیان این ژن افزایش یافت. بیشترین میزان بیان ژن DAT مطابق نتایج شعبانی و همکاران (17) در زمان 6 ساعت پس از تیمار بود که این نتیجه با نتایج این پژوهش مطابقت داشت که بیشترین میزان بیان این ژن در زمان 8 ساعت پس از تیمار یعنی ساعت­های اولیه پس از تیمار بود. در تحقیق دیگری بررسی بیان ژن DAT در ریشه­های موئین پروانش نشان داد که لاین­های مختلف ریشه موئین در مقایسه با کشت­های ریشه موئین شاهد، سطح بیان بیشتری از ژن DAT را دارند (18). بررسی اثرات متیل جاسمونیک اسید (MeJA) بر متابولیسم ترپنوئید ایندول آلکالوئیدها (TIAs) و بیان ژن در گیاه‏چه­های پروانش نشان داد که ترپنوئید ایندول آلکالوئیدها تغییرات معنی­داری در مقدار و زمان القا نشان می­هند. بیشترین میزان بیان ژن D4H در زمان 5/0 ساعت بعد از تیمار و غلظت 2 میلی­مولاربود که نزدیک دو برابر شاهد بود. افزایش معنی­دار در بیان ژن STR در زمان 3 ساعت بعد از تیمار بود که این افزایش در زمان­های 6، 12 و 24 ساعت نیز ادامه داشت. بعد از 24 ساعت بیان این ژن کاهش داشت (4). در این مطالعه نیز مشخص شد که ژن STR در زمان 48 ساعت توسط نانو اکسید روی افزایش بیان داشت که با نتایج Wei (4) مغایرت داشت. در تحقیق دیگری Zhang و همکاران (19) تأثیر نانو­ذرات نقره را بر افزایش تولید متابولیت­های ثانویه در گیاه Artemisia annua بررسی کردند. نانوذرات نقره به‏عنوان الیسیتور به محیط کشت ریشه­های موئین این گیاه افزوده شد. در این مطالعه محتوای آرتمیزینین از mg/g 67/1 وزن خشک به mg/g 86/2 تغییر یافت. آن­ها به این نتیجه رسیدند که از نانوذرات نقره می­توان به‏عنوان یک الیسیتور موثر برای تولید متابولیت­های ثانویه در گیاهان استفاده کرد. با توجه به این یافته­ها و نتایج قبلی به‏نظر می­رسد که افزایش در بیان این ژن­ها تحت تأثیر الیسیتورهای مورد استفاده، ناشی از این امر باشد که گیاه برای مقابله با تنش از راه‏کار افزایش تولید متابولیت ثانویه استفاده می­کند. متابولیت­های ثانویه دارای عملکردهای اکولوژیکی مهم در گیاه هستند. محققین با استفاده از افزایش تولید متابولیت ثانویه سعی می­کنند تا شواهد بیشتری در رابطه با چگونگی بیوسنتز متابولیت­ها و نیز مکانیسم تنظیمی آن به‏دست آورند. مطالعات Dutta و همکاران (14) در بررسی هم­بستگی بین بیان ژن­های مسیر ترپنوئید ایندول آلکالوئید (TIAs ) و تولید و تجمع آلکالوئیدها نشان داد که هم‏بستگی مثبتی بین فراوانی رونویسی و تجمع آلکالوئیدهای مربوطه در ژنوتیپ­های مختلف وجود دارد. به‏دلیل محدودیت­های بیولوژیکی و تکنولوژی، کشت سلولی گیاه پروانش هنوز نمی­تواند به‏صورت تجاری برای تولید آلکالوئید­های مهم دارویی مثل وین­بلاستین، کاتارانتین، آجمالیسین و سرپنتین به‏کار گرفته شود. مقدار کم این ترکیبات در کشت سلولی یکی از محدودیت‏های اصلی است. بنابراین بسیاری از روش­ها برای بهبود تولید ایندول آلکالوئید­ها در کشت سلولی پروانش استفاده می­شود (10). مطالعه حاضر در جهت افزایش بیان ژن­های STR، DAT و D4H نیز در راستای تحقق این اهداف است. هر سه این ژن­ها در پاسخ به تنش­ها افزایش بیان نشان می‏دهند و در بالا بردن زیست ساخت آلکالوئیدهایی مانند ویندولین نقش دارند. به‏عنوان نمونه Mao Jun و Fang (20) توانستند با انتقال ژن Bax واکنش فوق حساسیت در گیاه پروانش ایجاد کنند و در نتیجه باعث افزایش بیان ژن STR شوند. در مطالعه دیگری (21) دو ژن D4H و DAT در گیاه پروانش تحت تنش خشکی افزایش یافتند. همچنین افزایش بیان این دو ژن با بالا رفتن ویندولین در گیاه پروانش همراه بود (22). وجود الیسیتور در محیط می‏تواند به‏عنوان یک عامل تنشی برای گیاه عمل کرده و سبب افزایش فعالیت سیستم دفاعی گیاه در غلظت‏های مختلف الیسیتور و در نتیجه باعث تحریک بیان برخی ژن­ها و تولید متابولیت­های ثانویه گیاه شود.

در این پژوهش نیز نانو اکسید روی باعث افزایش بیان ژن­های STR، DAT و D4H شد که می‏توان بنا بر اطلاعات ذکر شده انتظار بالا رفتن میزان متابولیت­های ثانویه­ای مانند وین بلاستین و وین کریستین را نیز داشت.

تشکر و قدردانی

این پژوهش با کمک مالی گروه بیوتکنولوژی دانشگاه بین المللی امام خمینی (ره) انجام شد که بدین وسیله قدر دانی می‏شود.

منابع

  1. Liu Y, Zhao D, Zu YT, Jiang, Y, et al. Effects of low light on terpenoid indole alkaloid accumulation and related biosynthetic pathway gene expression in leaves of Catharanthus roseus seedlings. Botanical Studies. 2010; 52: 191-196.
  2. Mujib A, Ilah A, Aslam J, Fatima S, et al. Catharanthus roseus alkaloids: application of biotechnology for improving yield. Plant Growth Regulation. 2012; 68 (2): 111-127.
  3. Omid Beigi R. Production and Processing of Medicinal Plants. Astan Ghods Razavi Publications. 2005;3(15): 81-93.
  4. Wei S. Methyl jasmonic acid induced expression pattern of terpenoid indole alkaloid pathway genes in Catharanthus roseus seedlings. Plant Growth Regulation. 2010; 61 (3): 243-251.
  5.  Liu DH, Ren WW, Cui LJ, Zhang LD, et al. Enhanced accumulation of catharanthine and vindoline in Catharanthus roseus hairy roots by overexpression of transcriptional factor ORCA2. African Journal of Biotechnology. 2011; 10 (17): 3260-3268.
  6. Vanisree M, Lee CY, LO SF, Nalawade SM, et al. Studies on the production of some important secondary metabolites from medicinal plants by plant tissue cultures. Botanical Bulletin of Academia Sinica. 2004; 45(1): 1-22.
  7. Esmaeil Zadeh- Behabadi S, Sharifi M. Increasing plant secondary metabolites using bioelicitors. Cell and Tissue. 2013; 4 (2) 119-128.
  8. Omidi M, Farzin N. Biotechnologic strategies for enhancing medicinal plants efficiency. 2009; Regional Conference on Drug and Food.
  9. Ramani S, Jayabaskaran C. Enhanced catharanthine and vindoline production in production in suspension cultures of Catharanthus roseus by ultraviolet-B light. Journal of Molecular Signaling. 2008; 3: 90. Doi: 10.1186/1750-2187-3-9.
  10. Zhao J, Zhu WH, Hu Q, HE XW. Enhanced indole alkaloid production in suspension compact callus clusters of Catharanthus roseus: impacts of plant growth regulators and sucrose. Plant Growth Regulation. 2001; 33(1): 33-41.
  11. Moreneo PR, Poulsen C, Van Der Heiden R, Verpoorte R. Effects of elicitation on different metabolic pathways in Catharanthus roseus (L.) G. Don cell suspension cultures. Enzyme and Microbial Technology. 1996; 18(2): 99-107.
  12. Zheng Z, Wu M. Cadmium treatment enhances the production of alkaloid secondary metabolites in Catharanthus roseus. Plant Science. 2004; 166(2): 507-514.
  13. Facchini P J. Alkaloid biosynthesis in plants: biochemistry, cell biology, molecular regulation, and metabolic engineering applications. Annual Review of Plant Biology. 2001; 52(1): 29-66.
  14. Dutta A, Batra J, Pandey-Rai S, Singh HD, et al. Expression of terpenoid indole alkaloid biosynthetic pathway genes corresponds to accumulation of related alkaloids in Catharanthus roseus (L.). Planta. 2005; 220(3): 376-383.
  15. Makhzoum A, Pett-Paly G, Pierre BS, Bernards MA. Functional analysis of the DAT gene promoter using transient Catharanthus roseus and stable Nicotiana tabacum transformation systems. Plant Cell Reports. 2011; 30(7): 1173-1182.
  16. Ahmadi J, Mohammadi R, Garoosi G, Hosseini R. Callogenesis and cell suspension optimisation in periwinkle (Catharantus roseus). Agricultural Biotechnology. 2012; 4(1): 1-18.
  17. Shabani M, Farsi M, Mir-Samsi_Kakhki A. Investigation on the effect of ethylene on the expression of DAT, G10H, T16H and AVLBS in periwinkle (Catharanthus roseus). Modern Genetics. 2013; 9(2): 151-160.
  18. Magnotta M, Murata J, Chen J, De Luca V. Expression of deacetylvindoline-4-O-acetyltransferase in Catharanthus roseus hairy roots. Phytochemistry. 2007; 68(14): 1922-1931.
  19.  Zhang B, Zheng LP, Li WY, Wang JW. Stimulation of artemisinin production in Artemisia annua hairy roots by Ag-SiO2 core-shell nanoparticles.Current Nanoscience. 2013; 9(3): 363-370.
  20. Jun X, Fang D. Enhancing terpenoid indole alkaloid production by inducible expression of mamalian Bax in Catharanthus roseus cells. Science in China. 2007; 50(2): 234-241.
  21.  Mokhtari A, Ahmadi J, Mafakheri S. The expression profile of D4H and DAT genes in Catharanthus roseus in response to drought, salinity and alycylic acid. Iranian Journal of Genetics and Plant Breeding. 2013; 2(2): 38-46.

Wang X, Pan Y, Chang B, Ho Y, et al. Ethylene induced vinblastine accumulation is related to activated expression of downstream TIA pathway genes in Catharanthus roseus. BioMed Research International. vol. 2016, Article ID 3708187, 8 pages, 2016. doi:10.1155/2016/3708187.

  1. Liu Y, Zhao D, Zu YT, Jiang, Y, et al. Effects of low light on terpenoid indole alkaloid accumulation and related biosynthetic pathway gene expression in leaves of Catharanthus roseus seedlings. Botanical Studies. 2010; 52: 191-196.
  2. Mujib A, Ilah A, Aslam J, Fatima S, et al. Catharanthus roseus alkaloids: application of biotechnology for improving yield. Plant Growth Regulation. 2012; 68 (2): 111-127.
  3. Omid Beigi R. Production and Processing of Medicinal Plants. Astan Ghods Razavi Publications. 2005;3(15): 81-93.
  4. Wei S. Methyl jasmonic acid induced expression pattern of terpenoid indole alkaloid pathway genes in Catharanthus roseus seedlings. Plant Growth Regulation. 2010; 61 (3): 243-251.
  5. Liu DH, Ren WW, Cui LJ, Zhang LD, et al. Enhanced accumulation of catharanthine and vindoline in Catharanthus roseus hairy roots by overexpression of transcriptional factor ORCA2. African Journal of Biotechnology. 2011; 10 (17): 3260-3268.
  6. Vanisree M, Lee CY, LO SF, Nalawade SM, et al. Studies on the production of some important secondary metabolites from medicinal plants by plant tissue cultures. Botanical Bulletin of Academia Sinica. 2004; 45(1): 1-22.
  7. Esmaeil Zadeh- Behabadi S, Sharifi M. Increasing plant secondary metabolites using bioelicitors. Cell and Tissue. 2013; 4 (2) 119-128.
  8. Omidi M, Farzin N. Biotechnologic strategies for enhancing medicinal plants efficiency. 2009; Regional Conference on Drug and Food.
  9. Ramani S, Jayabaskaran C. Enhanced catharanthine and vindoline production in production in suspension cultures of Catharanthus roseus by ultraviolet-B light. Journal of Molecular Signaling. 2008; 3: 90. Doi: 10.1186/1750-2187-3-9.
  10. Zhao J, Zhu WH, Hu Q, HE XW. Enhanced indole alkaloid production in suspension compact callus clusters of Catharanthus roseus: impacts of plant growth regulators and sucrose. Plant Growth Regulation. 2001; 33(1): 33-41.
  11. Moreneo PR, Poulsen C, Van Der Heiden R, Verpoorte R. Effects of elicitation on different metabolic pathways in Catharanthus roseus (L.) G. Don cell suspension cultures. Enzyme and Microbial Technology. 1996; 18(2): 99-107.
  12. Zheng Z, Wu M. Cadmium treatment enhances the production of alkaloid secondary metabolites in Catharanthus roseus. Plant Science. 2004; 166(2): 507-514.
  13. Facchini P J. Alkaloid biosynthesis in plants: biochemistry, cell biology, molecular regulation, and metabolic engineering applications. Annual Review of Plant Biology. 2001; 52(1): 29-66.
  14. Dutta A, Batra J, Pandey-Rai S, Singh HD, et al. Expression of terpenoid indole alkaloid biosynthetic pathway genes corresponds to accumulation of related alkaloids in Catharanthus roseus (L.). Planta. 2005; 220(3): 376-383.
  15. Makhzoum A, Pett-Paly G, Pierre BS, Bernards MA. Functional analysis of the DAT gene promoter using transient Catharanthus roseus and stable Nicotiana tabacum transformation systems. Plant Cell Reports. 2011; 30(7): 1173-1182.
  16. Ahmadi J, Mohammadi R, Garoosi G, Hosseini R. Callogenesis and cell suspension optimisation in periwinkle (Catharantus roseus). Agricultural Biotechnology. 2012; 4(1): 1-18.
  17. Shabani M, Farsi M, Mir-Samsi_Kakhki A. Investigation on the effect of ethylene on the expression of DAT, G10H, T16H and AVLBS in periwinkle (Catharanthus roseus). Modern Genetics. 2013; 9(2): 151-160.
  18. Magnotta M, Murata J, Chen J, De Luca V. Expression of deacetylvindoline-4-O-acetyltransferase in Catharanthus roseus hairy roots. Phytochemistry. 2007; 68(14): 1922-1931.
  19. Zhang B, Zheng LP, Li WY, Wang JW. Stimulation of artemisinin production in Artemisia annua hairy roots by Ag-SiO2 core-shell nanoparticles.Current Nanoscience. 2013; 9(3): 363-370.
  20. Jun X, Fang D. Enhancing terpenoid indole alkaloid production by inducible expression of mamalian Bax in Catharanthus roseus cells. Science in China. 2007; 50(2): 234-241.
  21. Mokhtari A, Ahmadi J, Mafakheri S. The expression profile of D4H and DAT genes in Catharanthus roseus in response to drought, salinity and alycylic acid. Iranian Journal of Genetics and Plant Breeding. 2013; 2(2): 38-46.
Wang X, Pan Y, Chang B, Ho Y, et al. Ethylene induced vinblastine accumulation is related to activated expression of downstream TIA pathway genes in Catharanthus roseus. BioMed Research International. vol. 2016, Article ID 3708187, 8 pages, 2016. doi:10.1155/2016/3708187.