همسانه‌سازی و مطالعه ویژگی¬های بیوانفورماتیکی ژن عامل آنزیم تروپینون ردوکتاز 2 (TR II)از گیاه بنگدانه (Hyoscyamus niger)

نوع مقاله: علمی - پژوهشی

-

چکیده

هدف:هدف از این پژوهش استخراج و همسانه‌سازی ژن تروپینون ردوکتاز 2 (tr-II) در جهت آنتی‌سنس در ناقل دوتایی pBI121 جهت تهیه گیاهان تراریخت با توانایی کاهش آنزیم TR-II و تولید بیشتر آلکالوئیدهای هیوسیامین و اسکوپولامین در پروژه‌های آینده بود.
مواد و روش‌ها: RNA کل از ریشه‌های کشت شده گیاه بنگدانه بومی ایران استخراج و ژن هدف پس از ساخت cDNAو همسانه‌سازی در جهت آنتی‌سنس  در ناقل دوتایی pBI121، به اگروباکتریوم تومیفسینس سویه GV3101 منتقل شد. درستی همسانه‌سازی به سه روش هضم آنزیمی، PCR و توالی‌یابی نوکلئوتیدی مطالعه گردید. سپس خصوصیات بیوانفورماتیکی ژن مورد بررسی قرار گرفت.
نتایج: واکنش PCR، هضم آنزیمی و توالی‌یابی نوکلئوتیدی درستی همسانه‌سازی ژن هدف را با سودمندی  بالا تایید کرد. توالی نوکلئوتیدی نشان داد که ژن هدف بطول bp 783 بوده و باستثنای یک نوکلئوتید، مشابه با نمونه ثبت شده در بانک جهانی NBCI است و یک پروتئین با 260 اسیدآمینه را رمز می‌کند. وزن مولکولی و نقطه ایزوالکتریک پیش بینی شده پروتئین به ترتیب برابر 4/28437 دالتون و 46/5 بود. بررسی ساختارهای دو بعدی و سه بعدی نشان داد که پروتئین کاملا مشابه با آنچه که قبلا در پایگاه PDB ثبت شده بود، نبود. هم‌چنین، نتایج بررسی‌های فیلوژنتیکی نشان داد که این ژن به گروه I تروپینون ردوکتازها تعلق دارد.
نتیجه‌گیری: با توجه به همسانه سازی موفقیت‌آمیز و مشابهت بالای توالی نوکلئوتیدی و پپتیدی ژنtr-IIبا نمونه‌های ثبت شده جهانی، انتظار می‎رود مراحل بیان ژن در نیل به هدف اصلی نیز با موفقیت همراه باشد.
 

کلیدواژه‌ها


مقدمه

تروپان آلکالوئیدهای هیوسیامین و اسکوپولامین، ترکیبات هتروسیکلیک آمینی هستند که به عنوان متابولیت‌های ثانویه در تعدادی از گیاهان تیره سولاناسه، از جمله جنس‎های Hyosyamus, Atropa, Scopolia, Mandragora و Duboisia هستند (1و2). این آلکالوئیدهاروی سیستم پاراسمپاتیک عمل کرده و در داروسازی به عنوان رفع­کننده اسپاسم، تسکین دهنده درد و برای اتساع زیاد مردمک چشم بکار برده می‌شود (1، 2، 3، 4، 5 و6). این ترکیبات و سایر  تروپان آلکالوئید­ها به­طور عمده در ریشه‌های گیاهان خانواده سولاناسه از جمله شابیزک، تاتوره، بنگدانه و اسکوپولیا سنتز و از طریق آوندهای چوبی به دیگر اندام‌های گیاهی انتقال یافته و در بافت‎‎‎های مخزن در سلول‌های اپی‏درم ذخیره می‌شوند (7، 8 و 9). در مسیر بیوسنتز تروپان آلکالوئیدهای یاد شده، آنزیم‌های بسیاری دخیل هستند (10 و 11)، ولی در پایین دست تروپینون که یک ترکیب حدواسط کلیدی این مسیر بیوسنتزی محسوب می‌شود، دو تروپینون ردوکتاز 1 و 2 (TR-I و TR-II) در قرار گرفتن آن در دو مسیر متفاوت نقش مهمی دارند. تفاوت فاحش این دو آنزیم در وابستگی آن‏ها به سوبسترای تروپینون می‎باشد. هر دو آنزیم متعلق به گروه B اکسیدوردوکتازها می‏باشند که نقش آن‏ها در انتقال pro-s هیدروژن NAD(P)H به سوبسترای آن‏هامی‎باشد (1) و میل ترکیبی متفاوتی نسبت به تروپینون از خود نشان می‎دهند (TR-II میل ترکیبی بیشتری نسبت به TR-I دارد). تروپینون ردوکتازهای 1 و 2 وابسته به NADPH تشکیل دهنده یک نقطه انشعاب در بیوسنتز تروپان آلکالوئیدها هستند: آنزیم TR-I تروپینون را از طریق NADPH، گروه3- کربونیل تروپینون را به یک گروه α– هیدروکسیل، به تروپین کاتالیز می‎کند که در پایان مسیر به آلکالوئید­های تروپانی هیوسیامین و اسکوپولامین ختم می‎شود، در حالی که آنزیم TR-II آن را با استفاده از NADPH احیا و پزودوتروپین به همراه یک گروه β- هیدروکسیلی و در نهایت آلکالوئید غیر تروپانی کالستیژن را تولید می‎کند (12و 13).

هاشیموتو و همکاران (14) دو آنزیم تروپینون ردوکتاز1 و 2 را از گیاه بنگدانه (Hyoscyamus niger) جدا سازی، خالص‎سازی و شناسایی کردند. آن‏ها نشان دادند که این دو آنزیم مشخصات کینتیکی مشابه و بیوشیمیایی متفاوتی دارند. برای درک بهتر ساختار و تکامل روابط این ردوکتازها، ناکاجیما و همکاران (15) cDNA ژن عامل آنزیم تروپینون ردوکتاز2 مربوط به گیاه بنگدانه را سنتز و توالی یابی کردند و اعلام نمودند که اینژنbp1029 طول داشته و ازbp783 آن نسخه برداریمی‎شود و پپتیدی به­طول 260 اسید آمینه را رمز می­کند.توالی آمینواسیدی آنزیم TR-II نشان داده است که این آنزیم متعلق به خانواده دهیدروژناز/ ردوکتاز رشته کوتاه(Short –chain Dehydrogenases/Reductases, SDR) می‎باشد. آنزیم‎های خانواده SDR، برای واکنش‎های آنزیمی خود نیاز به فلزات و یا پیوندهای سیستئینی ندارند. همچنین این آنزیم‎ها د یک رشته Try-x-x-x-Lys دارند. عمل‏کرد باقیمانده‏های حفاظت شده (تیرویزین، لیزین و همچنین سرین) از ساختار سه بعدی آنزیمهای SDR برای اولین بار در دهه 90 پیشنهاد شده است. تیروزین به عنوان یک کاتالیست اسید و باز عمومی عمل می‎کند که در آن لیزین و سرین این عمل را به ترتیب از طریق اثرات الکترواستاتیکی و پیوند هیدروژنی با تیروزین تسهیل می‎کنند (1).

هر چند در پایین دست آنزیم تروپینون ردوکتاز1 در مسیر تبدیل تروپین به اسکوپولامین آنزیم­های مهم دیگری از جمله هیوسیامین 6β- هیدروکسیلاز (Hyoscyamine 6β- hydroxylase, H6H) وجود دارند که تولید اسکوپولامین را کاتالیز می­نمایند (16 و 17)، ولی آنزیم تروپینون ردوکتاز2 رقیب اصلی آنزیم تروپینون ردوکتاز 1 در انشعاب مسیر به ­سمت آلکالوئیدهای تروپانی هیوسیامین و اسکوپولامین و یا آلکالوئید غیرتروپانی کالیستژین می­باشد.تحقیقات نشان داده است که کالیستژین نسبت به آتروپین و اسکوپولامین در سولاناسه به میزان بیشتری وجود دارد (18) و در زمان کوتاهی پس از تیمار پیش­ماده تروپینون در بافت‌های مختلف سولاناسه، پزودوتروپین سریعتر از تروپین تجمع می‌یابد (19).کای و همکاران (20) نشان دادند که در گیاه Anisodus acutangulus  میزان بیان آنزیم TR-II به­ مراتب بیشتر از TR-I و بیان هر دو در تیمار با اسید جاسمونیک و هم­چنین در ریشه­های مویین افزایش می‎یابد ولی با افزایش TR-II بیش از TR-I می‎باشد. بنابراین تصور می­شود کاهش آنزیم تروپینون ردوکتاز2 می‌تواند در افزایش بیان ژن تروپینون ردوکتاز1 و در نتیجه افزایش میزان تروپان آلکالوئیدهای هیوسیامین واسکوپولامین نقش قابل توجهی داشته باشد (21). بدلیل اهمیت ذکر شده، در این مطالعه ژن تروپینون ردوکتاز2 (tr-II) از یک گونه گیاه بنگدانه بومی ایران جداسازی و به ‌منظور کاهش بیان آن در جهت آنتی سنس همسانه‌سازی شد. همچنین برای آگاهی از ساختار شیمیایی و بیوشیمیایی ژن و پروتئین گیاه بومی و مقایسه آن با چند گیاه هم ­نام و مشابه خصوصیات شیمیایی، ساختار دوم و سوم و همچنین تکامل ژنتیکی آن مورد بررسی قرار گرفت.

 

مواد و روش‌ها

مواد گیاهی و جداسازی  RNAکل: بذرهای گیاه بنگدانه (Hyoscyamus niger)، جمع­آوری شده از اطراف شاهی جان پیرکوه، شهرستان سیاهکل استان گیلان، با کدگیاهی21161 از سازمان تحقیقات جنگل‌ها و مراتع تهیه و جهت تسریع در جوانه‌زنی با اسید جیبرلیک ppm 200 به مدت 48 ساعت تیمار (22) و پس از ضدعفونی بر روی محیط کشت جامد B5 بدون هورمون به مدت 4 روز کشت شدند. ریشه‌های به طول تقریبی 2 سانتی متر از بذر جدا و برای رشد و افزایش بیشتر به مدت 4 هفته در محیط کشت مایع B5 به همراه 1 میکرومولار هورمون IBA واکشت و بر روی شیکر با سرعت 100 دور در دقیقه و در تاریکی نگه‌داری شدند (23 و 24). RNA کل از بافت ریشه به روش لیتیوم کلراید (25 و 26) با کمی تغییرات استخراج شد. کیفیت و کمیت RNA استخراجی  به ترتیب با استفاده از الکتروفورز روی ژل آگارز 2/1 درصد حاوی فرم آلدئید و اسپکتروفتومتر (labomed-UVD3200انگلستان) مورد بررسی قرار گرفت.

سنتز رشته اول cDNA: برای سنتز cDNA ژن عامل آنزیم تروپینون ردوکتاز 2، از آغازگر عمومی Oligo (dT)18 و آنزیم نسخه بردار معکوس RevertAidTM M-MuiV (شرکت فرمنتاز) استفاده و طبق دستورالعمل شرکت سازنده انجام گرفت.

طراحی آغازگرها و واکنش RT-PCR: با استفاده از توالی قطعه ژن مورد نظر از گیاه بنگ‌دانه (Hyoscyamus niger) با توالی ژن HYSTR2A با شماره دسترسی L20485 که توسط ناکاجیما و همکاران (15) در بانک اطلاعاتی NCBI ثبت شده است، یک جفت آغازگر اختصاصی ژن عامل آنزیم تروپینون ردوکتاز2 حامل 11 جفت باز اختصاصی به همراه ترادف نوکلئوتیدی آنزیم برشی Xba I (با ترادف بازی آغازگر رفت5'-ATATCTAGAACCATGGCTGGCAG-3'و آغازگر برگشت3(5'-GGCGTCTAGATTAAAAACCACCAT- در پایانه 5' طراحی گردید. آغازگرها توسط شرکت metabion آلمان سنتز شدند.  برای انجام واکنش زنجیره ای پلی مراز (PCR) از 5/2 میکرولیتر بافر10x PCR ، 1 میکروگرم cDNA، 75/1 میکرولیتر MgCl2 50 میلی مولار، 5/0میکرولیترdNTP 10میلی مولار، 1 میکرولیتر آغازگر رفت (pmol20)،1 میکرولیتر آغازگر برگشت ( pmol20)، 1 واحد آنزیمDNATaq پلیمراز در حجم کلی واکنش (25 میکرولیتری) استفاده گردید. برنامه چرخه‌ای PCR با آغازگرهای رفت و برگشت در 35 دور انجام گرفت. درستی بیان ژن تروپینون ردوکتاز II (tr-II ) توسط الکتروفورز ژل آگارز 2/1 درصد صورت گرفت. محصول PCR با استفاده از کیت استخراج DNA (شرکت سیناژن، تهران- ایران) خالص سازی شد.

همسانه سازی و توالی یابی DNA: محصول PCR و فاژمید (SK-) pBluescript II با استفاده از آنزیم Xba I  هضم و قطعه مورد نظر با استفاده از آنزیمDNA  لیگازT4 و مطابق روش توصیه شده توسط شرکت سازنده به فاژمید متصل گردید. پس از تهیه سلول‎های مستعد باکتری E. coli سویه DH5α در OD600=0.4 به روش قلیایی کلرید کلسیم (17)،فاژمید نوترکیب با استفاده از شوک حرارتی (27) به باکتری انتقال داده شد. سلول‌های باکتری تراریخت با استفاده از آزمون پلاک‌های سفید و آبی انتخاب (27) پس از کشت باکتری تراریخت، فاژمیدهای نوترکیب به روش قلیایی با SDS (28) با کمی تغییرات استخراج شدند. از تکنیک هضم آنزیمی و PCR با آغازگرهای اختصاصی برای بررسی کلونی‌های نوترکیب استفاده شد. جهت انجام هضم آنزیمی، 1 میکروگرم از محلول DNA پلاسمیدی به طور جداگانه با استفاده از 3 آنزیم محدود کننده XbaHind III و Sac Iهضم (29) و محصول واکنش بوسیله الکتروفورز در یک ژل آگارز 5/1 درصد مورد بررسی قرار گرفت. پس از اینکه کلونی‌های نوترکیب با استفاده از PCR و هضم آنزیمی مورد تائید قرار گرفتند، صحت توالی همسانه‌سازی شده از طریق توالی‌یابی DNA  با استفاده از آغازگرهای راه انداز باکتریوفاژ T7 در دو جهت رفت و برگشت توسط شرکت Seqlab آلمان انجام شد. 

ساخت سازواره نوترکیب pBI121 و انتقال به آگروباکتری تراریخت GV3101: با توجه به هدف پژوهش، ژن عامل آنزیم تروپینون ردوکتاز II با حذف ژن بتاگلوکورونیداز (GUS) در جهت آنتی سنس در‌ درون پلاسمید بیان دو تاییpBI121 همسانه­سازی گردید. بدین منظور فاژمید نوترکیب (pBluescript sk-) حاوی ژن هدف و پلاسمید pBI121وحشی با دو آنزیم برشی BamH I و Sac I هضم دوتایی شدند. برای انجام واکنش اتصال از کیتRapid DNA ligation kit (با شماره کاتالوگ K1421‌، محصول شرکت فرمنتاز) استفاده و مطابق توصیه شرکت سازنده آزمایش انجام گردید. از سازواره نوترکیب ساخته شده برای ساخت آگروباکتری تراریخت استفاده شد. بدین منظور ابتدا سلول‌های مستعد آگروباکتریوم­به­روش وایز، لیو و بینز (30) تهیه و سپس  پلاسمید نوترکیب حاوی ژن مورد نظر به روش شوک حرارتی (30)  به درون سلول‌های مستعد آگروباکتریوم منتقل گردید. پلاسمید نوترکیب با استفاده از محلول قلیایی و با استفاده از SDS استخراج و مورد مطالعه قرار گرفت (31).

برای مطالعه درستی همسانه سازی پلاسمید نوترکیب علاوه بر روش PCR، از هضم آنزیمی استفاده شد. برای انجام هضم آنزیمی از روش هضم دوتایی استفاده شد. بدین منظور 1 میکروگرم از محلول DNA پلاسمید نوترکیب با آنزیم BamH Iو Sac I عمل هضم دوتایی انجام و سپس محصولات واکنش به‌وسیله الکتروفورز در یک ژل آگارز 5/1 درصد مورد بررسی قرار گرفتند.

بررسی توالی و پیش بینی ساختارهای دوم و سوم پروتئین: توالی نوکلئوتیدی حاصل از فرآیند توالی یابی با استفاده از برنامه Translate(http://www.expasy.ch/tools/dna.html) ترجمه شده و خصوصیات بیوشیمیایی پروتئین بدست آمده با استفاده از برنامه‎های protparam (32) (http://www.expasy.org/tools/protpar-ref.html)،protscale(http://www.expasy.org/cgi-bin/protscale.pl) و TMHMM(http://www.cbs.dtu.dk/services)مورد بررسی قرار گرفت. ساختار دوم توالی پروتئین با استفاده از برنامه SOPMA(http:/npsa-pbil.ibcp) و ساختار سوم آن با استفاده از برنامه I-TASSER ، SPDV Viwer و PYMOL  تعیین گردید (33، 34 و 35).

بررسی فیلوژنتیکی: برای کسب اطلاع از توالی پروتئین های مشابه، توالی نوکلئوتیدی به دست آمده در بانک اطلاعاتی با استفاده از برنامه BLASTp در سایت (www.uniprot.org/blastp) مورد جستجو قرار گرفت. توالی‎های پروتئینی که بیشترین تشابه را با توالی مورد نظر داشتند (جدول 1)، در ترسیم درخت فیلوژنتیکی با استفاده از نرم افزار MEGA 4 مورد استفاده قرار گرفتند (36 و 37).

 

جدول1: مشخصات توالی­های پروتئینی مورد استفاده در ساخت درخت فیلوژنتیکی به همراه شماره دستیابی موجود در پایگاه اطلاعات توالی NCBI GenBank.

شماره دستیابی

نام ژن

نام علمی

ردیف

P50164

tropinone reductase-II

Hyoscyamus niger

1

GenBank: AAA33281.1

tropinone reductase-I

Datura stramonium

2

GenBank: AAA33282.1

tropinone reductase-II

Datura stramonium

3

UniProtKB/Swiss-Prot: P50165.1

Tropinone reductase homolog; AltName: Full=P29X

Datura stramonium

4

GenBank: CAC19810.1

Tropinone reductase II

Solanum tuberosum

5

GenBank: CAC34420.1

tropinone reductase I

Solanum tuberosum

6

GenBank: AAN15454.1

putative tropinone reductase

Arabidopsis thaliana

7

GenBank: AAM10204.1

putative tropinone reductase

Arabidopsis thalian

8

GenBank: AAO42159.1

putative tropinone reductase

Arabidopsis thaliana

9

GenBank: ABG22470.1

Tropinone reductase, putative, expressed

Oryza sativa Japonica Group

10

GenBank: ABW74581.1

putative tropinone reductase

Boechera divaricarpa

11

XP_002280517.2

PREDICTED: tropinone reductase homolog

Vitis vinifera

NCBI Reference Sequence:

12

NCBI Reference Sequence: XP_002277835.1

PREDICTED: tropinone reductase homolog At1g07440

Vitis vinifera

13

GenBank: ACG34080.1

tropinone reductase

Zea mays

14

GenBank: ACG28624.1

tropinone reductase 2

Zea mays

15

 

نتایج

پس از گذشت 4 هفته، توده‌ای از ریشه‌ها به‌ وزن تقریبی 15 گرم در محیط کشت مایع B5 حاوی 1 میکرومولار هورمون IBA به‌دست آمد (شکل 1). نتایج حاصل از اسپکتروفتومتری و الکتروفورز ژل آگارز 2/1 درصد و فرمالدئید (شکل A2) نشان داد که استخراج RNA با این روش از کمیت (36/3 نانوگرم RNA به ازای 5/2 گرم بافت ریشه) و کیفیت قابل قبولی برخوردار است. در RT-PCR با استفاده از cDNA ساخته شده تنها یک باند قوی و تقریبا به طول  bp783 در دمای اتصال 58 درجه سانتی‌گراد تشکیل شد (شکل B2). بازده تراریختی سلول‎های مستعد باکتری E. coli با استفاده از کلریدکلسیم 100 میلی مولار در OD600 به میزان 4/0 بوده و استخراج فاژمید نوترکیب با استفاده از روش SDS نیز با موفقیت انجام شد.

 

شکل 1:تشکیل کلون ریشه‌ در محیط کشت مایع B5 همراه با1 میکرومولار IBA.

هضم آنزیمی فاژمید نوترکیب با استفاده از 3 آنزیم برشی Hind III، Xba I  و Sac I، درستی ساخت فاژمید نوترکیب را تائید کرد. نتایج حاصل از PCR فاژمید نوترکیب، قطعه‌ای به‌طول bp783 را ایجاد کرد که مطابق با طول قطعه مورد انتظار بود (شکلC2).

درستی همسانه سازی ژن هدف در جهت آنتی سنس در ناقل دوتایی pBI121 (شکل D2) و انتقال آن به درون اگروباکتریوم GV3101، با استخراج پلاسمید دو تایی نوترکیب و هضم آن با آنزیم‌های برشی BamH I  و Sac I ، با ایجاد دو قطعه با اندازه های تقریبی11200 و 840 جفت بازی به اثبات رسید (شکلC2).

نتایج توالی‌یابی DNA، صحت قطعه همسانه‌سازی شده را تائید نمود. توالی قطعه ژن مورد نظر از گیاه بومی بنگ‌دانه با توالی ژن HYSTR2A با شماره دسترسی L20485 که توسط ناکاجیما و همکاران (15) در بانک اطلاعاتی NCBI ثبت شده است، مورد مقایسه قرار گرفت. هم‏ردیف سازی توالی‌ها با استفاده از برنامه BLAST در بانک اطلاعاتی NCBI نشان داد که این دو توالی 99 درصد با یکدیگر مشابهت دارند. قطعه مورد نظر مشابه نتایج ناکاجیما و همکاران (15) یک پروتئین با 260 اسیدآمینه را کد می‎نماید. بررسی توالی اسیدآمینه ای نشان داد که در آن یک جایگاه فعال آنزیم به عنوان گیرنده پروتون و همچنین یک جایگاه اتصال سوبسترا وجود دارد (شکل 3).


 

شکل2: الکتروفورز محصولات RNA و DNA. A) 1 و 2 دو نمونه RNA استخراج شده از ریشه های گیاه بنگ‌دانه. B) تکثیرcDNA  ژنtr-II با استفاده از آغازگرهای اختصاصی و تکنیک PCR  با دمای اتصال 58 درجه سانتی‌گراد: ستون1 باند قطعه هدف در تیمار هورمونی IBA. C)PCR اختصاصی فاژمید نوترکیب: ستون 1 فاژمید نوترکیب حلقوی (شاهد)، ستون 2 محصول PCR فاژمید نوترکیب با آغازگرهای اختصاصی ژن tr-II. D) محصول هضم آنزیمی پلاسمید نوترکیب pBI121 با آنزیم­های برشی  BamH Iو Sac I: ستون 1 باندهای حاصل پس از هضم پلاسمید دوتایی  pBI121 نوترکیب (حاوی ژن TR-II) و ستون2: باندهای حاصل پس از هضم پلاسمید دوتایی pBI121 غیر نوترکیب.

 

1    atggctggcaggtggaatcttgaaggctgcactgcccttgttactggtggctcgcgaggc

  1    M  A  G  R  W  N  L  E  G  C  T  A  L  V  T  G  G  S  R  G

 


 61   atagggtatgggatcgtagaggaattagcaaatcttggagcatcagtttatacatgttca

  21   I  G  Y  G  I  V  E  E  L  A  N  L  G  A  S  V  Y  T  C  S

 

 121  cgtaatcaaaaggagcttgatgagtgtttaactcaatggagaagtaaaggttttaatgtt

  41   R  N  Q  K  E  L  D  E  C  L  T  Q  W  R  S  K  G  F  N  V

 

 181  gaagcttctgtttgtgatttatcatcaagatctgaacgagaagagtttatgaagactgta

  61   E  A  S  V  C  D  L  S  S  R  S  E  R  E  E  F  M  K  T  V

 

 241  tctaatcatttccatggaaaactcaatattttggtaaataatgctggtattgtcatatac

  81   S  N  H  F  H  G  K  L  N  I  L  V  N  N  A  G  I  V  I  Y

 

 301  aaggaagctaaagattacactatggaagattactctcatattatgagcataaactttgag

  101  K  E  A  K  D  Y  T  M  E  D  Y  S  H  I  M  S  I  N  F  E

 

 361  gctgcttatcacttatctgtacttgcacatccctttttgaaggcatcagaaaggggaaat

  121  A  A  Y  H  L  S  V  L  A  H  P  F  L  K  A  S  E  R  G  N

 

 421  gttgtatttatttcctccatttctggggcttctgcactaccatatgaggctgtttatgga

  141  V  V  F  I  S  S  I  S  G  A  S  A  L  P  Y  E  A  V  Y  G

 

 481  gcaaccaaaggagcaatggaccaactgacaagatgcttggcgtttgagtgggcaaaggac

  161  A  T  K  G  A  M  D  Q  L  T  R  C  L  A  F  E  W  A  K  D

 

 541  aatattcgtgtcaatggtgttggacctggggttattgcaacttctatggtcgaaatgact

  181  N  I  R  V  N  G  V  G  P  G  V  I  A  T  S  M  V  E  M  T

 

 601  attcaagatccagaacaaaaagaaaacttggataagctgattgatagatgtgctctccgg

  201  I  Q  D  P  E  Q  K  E  N  L  D  K  L  I  D  R  C  A  L  R

 

 661  cgaatgggagagcccaaagaacttgcagcagtggttgcattcctctgtttccctgctgct

  221  R  M  G  E  P  K  E  L  A  A  V  V  A  F  L  C  F  P  A  A

 

 721  tcatatgtcactggccaaattatctatgttgatggtggatttatggctaatggtggtttt

  241  S  Y  V  T  G  Q  I  I  Y  V  D  G  G  F  M  A  N  G  G  F

 

 781  taa(Stop codon)

شکل 3: توالی نوکلئوتیدی و پروتئینی ژن TR-II. توالی­های آبی رنگ: بخش ژنی توالی­های آغازگرهای رفت و برگشت؛ توالی پپتید راهنما بصورت زیرخط، آمینواسیدهای تیروزین و لیزین به عنوان باقیماندههای حفاظت شده در آنزیمهای متعلق به خانواده SDR  به ترتیب با علامت مربع و دایره و اسید آمینه­های موجود در جایگاه­های اتصال و فعال به ترتیب با مثلث­ها سیاه و زرد رنگ نشان داده شده­اند.

 

 

بررسی خصوصیات بیوشیمیایی پروتئین بدست آمده با استفاده از برنامه ProtParam نشان داد که وزن مولکولی محاسبه شده و نقطه ایزوالکتریک پیش بینی شده توالی پروتئینی ژن هدف با فرمول مولکولی  C1255H1963N341O381S16به ترتیب برابر 4/28437 دالتون و 46/5 می‎باشد. شاخص ناپایداری پروتئین‎ها بیان‏گر میزان پایداری آن‏ها در لوله آزمایش می‎باشد و پروتئین‏هایی با شاخص کمتر از 40 جز پروتئین‏های پایدار تقسیم بندی می‏شوند. شاخص ناپایداری پروتئین مورد نظر در حدود 93/32 محاسبه گردید، با توجه به وجود یک اسیدآمینه حفظ شده متیونین در انتهای آمینوی پروتئین، نیمه عمر آن در محیط درون شیشه در حدود 30 ساعت محاسبه می‎گردد. عامل مهم در برآورد مقاومت پروتئین‏ها در برابر حرارت، شاخص آلیفاتیک است. این شاخص در پروتئین تروپینون ردوکتاز II، 81/84  می باشد. الگوی آب‏گریزی که توسط ProtScale با استفاده از Kyte & Doolittle Hydrophobicity Scale  محاسبه گردید، نشان داد که این پروتئین آب‏گریز بوده و از مجموع کل اسیدهی آمینه، 24 اسید آمینه بار الکتریکی مثبت (Arg+Lys) و 30 اسید آمینه دیگر بار منفی (Asp+Lys) دارند. همچنین با استفاده از برنامه TMHMM مشخص گردید که با توجه به داشتن دومین غشایی، آنزیم TR II مورد مطالعه یک پروتئین خارج سلولی است. 

بررسی ساختار دوم پروتئین با استفاده از برنامه SOPMA نشان داد که این پروتئین دارای 5/55 درصد اسیدآمینه آب‏گریز و 5/44 درصد اسیدآمینه آب دوست است. پروتئین TR II حاوی 117 مارپیچ α  (38/34 درصد)، 45 صفحه β (31/17 درصد)، 29 پیچ β (15/11 درصد) و 69 مارپیچ تصادفی (54/26 درصد) می‎باشد. این نتایج با ساختار دوم توالی پروتئینی ژن تروپینون ردوکتاز II در سه گیاه  Hyoscyamus niger] با 117 مارپیچ α  (38/34 درصد)، 45 صفحه β (31/17 درصد)، 29 پیچ β (15/11 درصد) و 69 مارپیچ تصادفی (54/26 درصد)[ ، گیاهDartura Strumonium] با 121 مارپیچ α  (54/46 درصد)،  42صفحه β (15/16 درصد)، 22 پیچ β (46/8 درصد) و 75 مارپیچ تصادفی (85/28 درصد)[ و گیاه Solanum tuberosum] با 113مارپیچ α  (30/43 درصد)، 44 صفحه β (86/16 درصد)، 25 پیچ β (58/9 درصد) و 79 مارپیچ تصادفی (27/30 درصد)[  بالاترین تشابه را نشان داد (شکل 4).

 

 

 

A

 

B

 

C

 

D

شکل 4: ساختار دوم پروتئین TR-II گیاه هدف با استفاده از برنامه SOPMA و مقایسه آن با توالی پروتئینی در سه گیاه دیگر: (A) Hyoscyamus niger (گیاه بنگدانه هدف)، (B) Hyoscyamus niger (گیاه بنگدانه موجود در NBCI)، (C) Datura strumonium  و (D) Solanum tuberosum. مارپیچ α (خطوط آبی)، صفحه β (خطوط قرمز)، پیچ β (خطوط سبز) و مارپیچ تصادفی (خطوط بنفش).

 

 

پیش­بینی ساختار سه­بعدی توالی پروتئینی ژن تروپینون ردوکتاز II بوسیله برنامه I-TASSER نشان داد که این آنزیم حاوی 8 صفحه β و 12 مارپیچ α می­باشد. نحوه آرایش مارپیچ­های α و صفحات β در ساختار سه­بعدی پروتئین این آنزیم به گونه­ای است که مارپیچ­های α در سطح خارجی پروتئین و صفحات β در داخل پروتئین قرار گرفته­اند. صفحات β  بطور موازی و هم جهت با هم قرار گرفته اند (شکل 5).

بررسی‎های فیلوژنتیکی توالی پلی پپتیدی تروپینون ردوکتاز II با توالی‎های پروتئینی آنزیم تروپینون ردوکتاز در گیاهان دیگر با استفاده از نرم افزار Mega 4 و با روش Neighbor Joiningنشان داد که توالی پروتئینی تروپینون ردوکتاز II از سه گیاه Hyoscyamus niger, Dartura Strumonium و Solanum tuberosum در یک گروه (I) و توالی پروتئینی تروپینون ردوکتاز I از دو گیاه Dartura Strumonium و Solanum tuberosum در گروه مجزای دیگر(II) قرار دارند. بررسی فیلوژنتیکی توالی پروتیئنی تروپینون ردوکتاز I و II گیاهان خانواده سولاناسه نشان داد که از لحاظ تکاملی از یک جد مشترک می‎باشند (شکل 6) که باتوجه به اینکه تروپینون‌ردوکتازها در 64 درصدبنیان‌های آمینواسیدی مشترک بوده و متعلق به خانواده‌ی دهیدروژناز/ ردوکتاز زنجیره کوتاه(SDR) هستند، موید نتایج دیگران می‎باشد (13). هر چند تصور برخی این است که TRII آنزیمی است که از نظر تکاملی قدیمی‌تر بوده و TRI از آن انشعاب یافته است (38). همانطور که در درخت فیلوژنتیکی مشاهده میشود، آنزیم تروپینون ردوکتاز II استخراج شده از گیاه Hyoscyamus niger(Sample) در گروه I قرار دارد (شکل 6).


A

B

C

D

Tyr 159

Lys163

Asn 118

Ser146

E

شکل5: مدل­های سه­بعدی توالی پروتئینی ژن TR-II. A) مدل سه­بعدی روبان (Cartoon) توالی پروتئینی با مارپیچ­های α (قرمز)، صفحات β (زرد) و نواحی مارپیچ پیچیده (آبی)؛ B) آمینواسیدهای موجود در جایگاه اتصال به شکل گوی- میله (Ball-stickC) مدل سه­بعدی توالی پروتئینی ژن TR-II با سطح جامد؛ (D اسیدهای آمینهLys  ، Tyr ، Ser و Asn موجود در جایگاه فعال به شکل کروی (SphereE)مدل سه­بعدی توالی پروتئینی ژن TR-IIبه همراه سطح واندروالسی.

I

II

شکل 6: درخت فیلوژنتیکی ژن تروپینون ردوکتاز 1 و2 با توالی‏های پروتئینی تروپینون ردوکتاز از گیاهان دیگر. شماره دستیابی ژن ها در جدول 1 آورده شده است.


بحث

اکثر محققان وجود میزان متعادل از اکسین و سیتوکنین را برای ریشه زایی و شاخه زایی لازم می‎دانند (39). اکسین‎ها در تحریک تقسیم سلولی، افزایش طول سلول‎ها، تحریک آغاز ریشه، تمایز یابی بافت‎های آوندی و افزایش حرکت مواد در آوندها نقش دارند (40). در تمامی مطالعات صورت گرفته توسط سایر محققین (24، 25، 41، 42 و 43) از محیط کشت B5 حاوی 1 میکرومولار هورمون IBA برای رشد ریشه‌های موئین استفاده گردید اما در این آزمایش از ریشه‌های گیاه غیرتراریخت استفاده شد. نتایج این تحقیق با مطالعات انجام گرفته توسط این محققین از نظر امکان تکثیر ریشه همسانی نشان داد، ولی با نتایج هیگا و همکاران (41) مشابهت بیشتری داشت.هر چند به نظر می‎رسد علاوه بر نوع گیاه (44)، نوع ریشه، سن ریشه (45)، ترکیب محیط کشت (46) نیز می‎تواند موثر باشد. ولی به هرحال نتیجه این تحقیق نشان داد که به منظور هدف مشابه می‎توان از ریشه‌های تراریخت جهت تکثیر استفاده نمود.

کریستوسک و همکاران (46) بیان نمودند که روش استخراج با فنل- کلروفرم موجب تجمع RNA، حذف نواحی پلی (A) از انتهای  mRNA می‎شود که با نتایج این آزمایش مطابقت دارد. ابراهیم‌زاده و همکاران (25) از دو روش استخراج با گوانیدین ایزوسیانات و شیب سزیم کلراید و فنل- کلروفرم برای استخراج RNA استفاده نموده و به این نتیجه دست یافتند که روش استخراج با شیب سزیم کلراید بهتر از روش فنل- کلروفرم است که مغایر با نتایج این آزمایش می‎باشد. این نتایج بیانگر این نکته می­تواند باشد که احتمالا شرایط و شیوه انجام آزمایش نیز می‏تواند بر نتیجه آزمایش موثر باشد.

نتیجه RT-PCR حاصل از cDNA  به‌دست آمده با طول bp783 با اندازه توالی ژن ثبت شده در بانک اطلاعاتی NCBI، 99 درصد مطابقت دارد.

انتقال پلاسمید به درون سلول های مستعد باکتری تکنیک کلیدی و مهمی در همسانه سازی مولکولی محسوب می‎شود. میزان بازده تراریختی بدست آمده در این تحقیق (4/0) با مقدار بدست آمده توسط کوهن و همکاران (45/0) (27) قابل توجه می­باشد. همچنین این نتیجه با نتایج زیمینگ و همکاران (47) در روش مشابه و با استفاده از 75 میلی مولار کلرید کلسیم  مطابقت داشت.

همان‏طور که در نتایج ذکر شد حضور قطعه ژن مورد نظر در فاژمید نوترکیب تهیه شده با استفاده از سه روش هضم آنزیمی، PCR و توالی یابی نوکلئوتیدی تائید شد. مقایسه توالی یابی قطعه ژن هدف مستخرج از بنگدانه بومی ایران و قطعه ژن  ثبت شده در بانک اطلاعاتی NCBI نشان می­دهد که احتمالا خاستگاه آن­ها یکسان باشد.

با استفاده از برش‌های آنزیمی، نقشه سازواره‌های ناقل دوتایی حاوی ژن هدف ترسیم گردید (شکل 7). همانطور که در شکل یاد­شده مشاهده می‎شود، ژن تروپینون ردوکتاز II در جهت آنتی سنس به جای ژن بتاگلوکورونیداز  (GUS) قرار گرفته است. به‎هرحال تهیه موفقیت آمیز  سازواره نوترکیب با جهت آنتی­سنس ژن هدف امکان انتقال آن به گیاه بنگ‌دانه و یا گیاهان مشابه تولیدکننده آلکالوئیدهای تروپانی هیوسیامین و اسکوپولامین و غیر تروپانی کالستیژن را فراهم نموده تا پس از بیان ژن هدف در سطح نسخه­برداری در گیاه بتوان میزان متابولیت‌های ثانویه هیوسیامین و اسکوپولامین و همچنین فعالیت آنزیم تروپینون ردوکتاز- II و دیگر آنزیم‌هایی موثر در مسیر بیوسنتزی تولید این متابولیت‌های ثانویه را دقیق­تر بررسی نمود.

بررسی‎های حاصل از ساختار سه بعدی و نتایج حاصل از جایگاه اتصال و جایگاه فعال آنزیم با داده‎های حاصل از یاماشیتا (1) مطابقت کامل ندارد که با توجه به شیوه مطالعه و تخمین ساختار نیاز به مطالعه دقیق‏تر می­باشد.

 

BamH I

tr-II

Sac I

شکل7:  نمودار ترسیمی سازواره نوترکیب بیان: همسانه سازی ژن tr-II در ناقل دوتایی pBI121 در جهت آنتی سنس. سازواره شامل ژن گزارشگر نئومایسین فسفوترانسفراز 2 (NPT-II) برای مقاومت در باکتری و گیاه تحت کنترل پروموتر بیان NOS و ژن تروپینون ردوکتاز 2 (tr-II) (قطعه سنگین) تحت کنترل پروموتر بیان CaMV 35S، که در ناقل دو تایی pBI121 پس از حذف ژن β-GUS در جهت معکوس (آنتی سنس) بجای آن قرار گرفته است.

 

 

همانطور که پیشتر اشاره شد، تروپینون ردوکتاز II در گیاهH. niger در سطح آمینو اسیدی، شباهت بالایی به آنزیمTR-II در دیگر گیاهان خانواده سولاناسه داشته و در یک گروه قرار می‎گیرند، در حالی‎که مجموعه آنزیم­های TR I در گروه مجزای دیگری جای گرفته اند و تنها حدود 66 درصد تشابه آمینواسیدی بین این دو آنزیم وجود دارد . این تفاوت می‎تواند بدلیل ساختار فضایی متفاوت در دو تروپینون ردوکتاز باشد که باعث قرار گرفتن آن­ها در دو گروه مجزا می­شود. الگوی تکامل ژنتیکی بدست آمده در این  مطالعه نشان داد که با نتایج کای و همکاران (48) مطابقت دارد.

 

نتیجه گیری

cDNA ژن عامل آنزیم تروپینون ردوکتاز 2 با توجه به RNA کل مستخرج از ریشه‌های گیاه بنگدانه بومی ایران، کشت شده در شرایط درون شیشه جداسازی و با در ناقل دوتایی pBI121 در جهت آنتی­سنس همسانه سازی و سپس ناقل نوترکیب به اگروباکتریوم تومیفسینس سویه GV3101 منتقل شد. در نهایت خصوصیات بیوشیمیایی ژن مورد بررسی قرار گرفت.

همسانه­سازی با موفقیت مورد تایید قرار گرفت و توالی­یابی نوکلئوتیدی نشان داد که توالی ژن هدف بطول bp 783 بوده و باستثنای یک نوکلئوتید، مشابه با نمونه ثبت شده در بانک جهانی NBCI است و یک پروتئین با 260 اسیدآمینه را رمز می‏نماید. علیرغم تشابه بالای توالی نوکلئوتیدی و پپتیدی،  بررسی ساختارهای پروتئینی کاملا مشابه با آنچه که قبلا در پایگاه اطلاعاتیپروتئین PDB ثبت شده نبود. نتایج حاصل از بررسی‏های فیلوژنتیکی نشان داد که این ژن به گروه I تروپینون ردوکتازها تعلق دارد. با توجه به همسانه سازی موفقیت­آمیز و مشابهت بالای توالی نوکلئوتیدی و پپتیدی ژنهدف با نمونه‏های ثبت شده جهانی، انتظار می‎رود مراحل بیان ژن در نیل به هدف اصلی نیز با موفقیت همراه باشد.

 

تشکر و قدردانی

بدین‏وسیله از جناب آقای دکتر حسن مداح عارفی (سازمان جنگل‌ها و مراتع) جهت اهدای بذرها گیاه بنگ‌دانه و همچنین سرکارخانم دکتر قنادنیا و جناب آقای مهندس سلیمانی (کارشناسان محترم آزمایشگاه‌های کشت بافت و بیولوژی مولکولی) جهت همکاری در انجام این پژوهش، تشکر و قدردانی می‏شود.

1.Yamashita A. Structural basis for the reaction of tropinone reductase –II analyzed by X-ray crystallography, PhD thesis, D Agr, Kyoto University, Japan.1998; pp77.

2. Kai G, Yang S, Zhang Y, Luo X, et al. Effects of different elicitors on yield of tropane alkaloids in hairy roots of anisodus acutangulus. Mol Biol Rep. 2012; 39: 1721-1729.

3. Keiner R, Kaiser H, Nakajimia K, Hashimoto T, et al. Molecular cloning, expression and characterization of tropinone reductase II, an enzyme of SDR family in Solanum tuberosum. Plant Mol Biol. 2002; 48: 299- 308.

4. Nakajima K, Hashimoto T, Yamada Y. cDNA encoding tropinone reductase- II from Hyoscyamus niger. Plant Gene Regist. 1993; 103: 1465-1466.

5. Dehghan E,  Häkkinen ST, Oksman-Caldentey KM, Shahriari Ahmadi F. Production of tropane alkaloids in diploid and tetraploid plants and in vitro hairy root cultures of Egyptian henbane (Hyoscyamus muticus L.). Plant Cell TissueOrgan Cult. 2012; 110: 35-44.

6. Jirschitzka J, Schmidt GW, Reichelt M, Schneider B, et al. Plant tropane alkaloid biosynthesis evolved independently in the Solanaceae and Erythroxylaceae. Proc Natl Acad Sci USA. 2012; 26;109(26):10304-9.

7. Gonzalez DJ. Weathers PJ. Tetraploid Artemisia annua hairy roots produce more artimisinin than diploids.  Plant Cell Rep. 2003; 21: 809-813.

8. Richter U, Rothe G,Fabian AK, Rahfeld B, et al. Overexpression of tropinone reductase alters alkaloid composition in Atropa belladonna root cultures. J Exp Bot.2005;  56 (412): 645-652.

9. Caldentey K.M, Arroo R. Regulation of tropane alkaloid metabolism in plants  and plant  cell cultures. In Verpoorte R, Alfermann AW,(eds). Metabolic  engineering of  plant secondary metabolism.  Dordrecht: Kluwer Academic Publishers; 2000; 253- 281.

10.  Kandoth K, Singh S, Jayabaskaran C. Expression of hyoscyamine 6b-hydroxylase in the root  pericycle cells and accumulation of its product scopolamine in leaf and stemtissues of  Datura metel L. Plant Sci. 2010; 178(2): 202–206.

11.  Kim YD, Kang SM, Min JY, Choi WK, et al. Production of Tropane Alkaloids during De- differentiation of Scopoliaparviflora calli. J Nat Prod. 2010; 73(2): 147–150.

12.  Koelen KJ, Gross GG. Partia1 purification and properties of tropine dehydrogenase from root cultures of Datura stramonium.Planta Med .1982; 44(4): 227-230.

13. Drager B. Tropinone reductases, enzymes at the branch point of tropane alkaloid metabolism. Phytochem. 2006; 67(4): 327-337.

14. Hashimoto T, Nakajima K, Ongena G, Yamada Y. Two tropinone reductases with distinct stereospecifies from cultured root of Hyoscyamus niger. Plant Physiol. 1992; 100(2): 836- 845.

15. Nakajima K, Hashimoto T, Yamada Y. cDNA encoding tropinone  reductase-  II from Hyoscyamus  niger. Plant Gene Regist. 1993; 103: 1465-1466.

16. Hashimoto T, Yamada Y. Hyoscyamine 6β- hydroxylase, a 2- oxoglutarate- dependent dioxygenase, in alkaloid- producing root culture. Plant Physiol. 1986; 81(2): 619- 625.

17. Matsuda J, Okabe S, Hashimoto T, Yamada Y. Molecular cloning of hyoscyamine 6β- hydroxylase, a 2- oxoglutarate- dependent dioxygenase, from cultured root of Hyoscyamus niger. Biol chem. 1991; 266(15): 9460- 9464.

18. Griffin W, Lin D. Chemotaxonomy and geographical distribution of tropane alkaloids. Phyto chem. 2000; 53(6):623-37.

19. Dräger B, Schaal A . Tropinone reduction in Atropa belladonna root cultures. Phytochem. 1994; 35:1441–1447.

20. Kai G, Li L, Jiang Y, Yan X, et al. Molecular cloning and characterization of two tropinone reductases in and enhancement of tropane alkaloid production in AaTRI-transformed hairy roots. Biotechnol Appl Biochem. 2000; 54(3):177-86.

21. Bahmanzadegan A, Sefidkon F, Sonboli A. Determination of Hyoscyamine and Scopolamine in Four Hyoscyamus Species from Iran. Iranian J of Pharma Res. 2009; 8(1): 65-70.

22. Mahmoodzadeh A, Nojvan M, Bagheri Z. [Effects of different treatments on breaking of  dormancy and seed germination of Datura stramonium L.]. Iranian J Biol. 2005; 18(4): 341-349. Persian.

23. Akramian M, Fakhr Tabatabaei SM, Mirmasoumi M. Virulence of Different Strains of Agrobacterium rhizogenes on Genetic Transformation of Four Hyoscyamus Species. American-Eurasian J. Agric. and Environ. Sci. 2008; 3(5): 759-763.

24. Mohkami A, Marashi H, Farsi M, Bahrami AR. Isolation of h6h gene from cultured roots of Hyoscyamus niger and cloning it in E. coli. Agricul Sci and Technol J. 2007; 21(2): 57-64.

25. Ebrahimzadeh H, Teimoori A, Lohrasbi T. Hyoscyamin 6-β-hydroxylase gene isolation from  in vitro cultured roots of Hyoscyamus niger L. and Hyoscyamus tenuicaulis schonbeck-Temesy". Daru. 2003; 11(1): 34-37.

26.  Ainsworth C. Isolation of RNA from floral tissue of Rumex acetosa (Sorrel). Plant Mol Biol Rep. 1994; 12: 198–203.

27. Cohen SN, Chang AC, Boyer HW, Helling RB. Construction of biologically functional bacterial plasmid in vitro. Proc Natl Acad Sci U S A. 1973; 70(11): 3240-3244.

28. Birnboim HC, Doly J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA.  Nucl. Acid. 1979; 7(6): 1513-1523.

29. Sambrook, J, Russell, D.W. Molecular cloning: a laboratory manual, 3nd Ed. New York, USA: Cold Spring Harbor Laboratory Press, Cold Spring Harbor; 2001; Vol:1-3.

30. Liu Z,  Binns AN. Functional subsets of the VirB type IV transport complex proteins involved in the capacity of Agrobacterium tumefaciens to serve as a recipient in VirB-mediated conjugal transfer of plasmid RSF1010. J. Bacteriol. 2003; 185(11): 3259–3269.

31. Brent R, Irwin N. Minipreps of plasmid DNA. In Ausubel FM, Brent R, Kingston K, Moore D, et al. (eds). Short Protocols in Molecular Biology, 2nd ed. NewYork: John Wiley & Sons, NY; 1992; 1-16.

32. Gasteiger E, Hoogland C, Gattiker A, Duvaud, S, et al. Protein identification and analysis tools on the ExPASy server. In Walker J. M. (eds), The proteomics protocols handbook. Humana Press; 2005; 571-607.

33. Yang Z. I-TASSER server for protein 3D structure prediction. BMC Bioinformatics, 2008; 9: 40.

34. Ambrish R, Jianyi Y, Yang Z. COFACTOR: an accurate comparative algorithm for structure-based protein function annotation. Nucleic Acids Res, 2012; 40: W471-W477.

35. Ambrish R, Alper K, Yang Z. I-TASSER: A unified platform for automated protein structure and function prediction. Nature Protocols, 2010; 5(4): 725-738.

36. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 2007; 24(8): 1596 –1599.

37. Felsenstein J. Confidence limit on phylogenies: an approach using the bootstrap. Evol. . 1985; 39(4): 783-91.

38. Nakajima K, Hashimoto T. Two tropinone reductases, that catalyze opposite stereospecific reductions in tropane alkaloid biosynthesis, are localized in plant root with different cell-specific patterns. Plant and Cell Physiol. 1999; 40(11): 1099-1107.

39- Gousiadou C, Karioti A, Heilmann J, Skaltsa H. Iridoids from Scutellaria albida ssp. albida. Journal of Phytochemistry. 2007; 68: 1799-1804.

40- Mohammadi J. [Servey the effectof growth regulator substances on sexual emersion in cucumber via in vitro method]. Abstract proceeding of the First Iranian Horticultural Congress. 1996, Tat press. Persian.

41. Higa A, Miyamoto E, Rahman L, Kitamura Y. Root tip-dependent, active riboflavin secretion by Hyoscyamus albus hairy roots under iron deficiency. Plant Physiol Biochem. 2008; 46: 452-460.

42. Kanegae T, Kajiya H, Amano Y, Hashimoto T, et al. Specie- dependent expression of the hyoscyamine 6β- hydroxylase gene in the pericycle. Plant Physiol. 1994; 105: 483- 490.

43. Matsuda J, Okabe S, Hashimoto T, Yamada Y. Molecular cloning of hyoscyamine 6β- hydroxylase, a 2- oxoglutarate- dependent dioxygenase, from cultured root of Hyoscyamus niger. Biol chem. 1991; 266(15): 9460 - 9464.

44. Sueng HW, Jong MP, Ji- Won Y. Induction of branch roots by cutting method in  Hyoscyamus niger root culture. J Plant Growth Regul. 1997; 16:159–167.

45. Biondi S, Lenzi C, Baraldi R,  Bagni N. Hormonal Effects on Growth and Morphology of Normal and Hairy Roots of Hyoscyamus muticus. Plant Cell Tissu Organ Cult. 1997; 48:131–134.

46. Krystosek A, Cawthon L,  Kabat D. Methods for purification and assay of eukaryotic messenger ribonucleic acids and ribosomes. Biol chem. 1975; 250(15): 6077-6084.

47. Zhiming T, Guangyuan H, Kexiu XLi, Minigjie JC, et al. An improved system for competent cell preparation and high efficiency plasmid transformation using different Escherchia coli strains. Microbial Biotech. 2005; 1-7.

48. Kai G, Yang S, Zhang Y, Luo X, et al. Molecular cloning and characterization of two tropinonereductases in Anisodus acutangulus and enhancement of tropanealkaloid production in AaTRI-transformed hairy roots.Biotechnol. Appl. Biochem. 2009; 54: 177-186.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


دوره 3، زمستان 91
زمستان 1391
صفحه 307-318