جداسازی و کشت اولیه سلول‏های ستیغ عصبی از لوله عصبی جنین جوجه

نوع مقاله : علمی - پژوهشی

نویسندگان

1 دانشگاه علوم‏پ زشکی اردبیل، دانشکده علوم پزشکی، گروه علوم تشریحی، آزمایشگاه تحقیقاتی جنین‏شناسی و سلول‏های بنیادی، اردبیل، ایران

2 دانشگاه علوم ‏پزشکی اردبیل، دانشکده علوم پزشکی، گروه علوم تشریحی، آزمایشگاه تحقیقاتی جنین‏شناسی و سلول‏های بنیادی، اردبیل، ایران

چکیده

هدف:  هدف از این مطالعه ارائه یک روش ساده و کارآمد جهت جداسازی و تعیین خصوصیت سلول‏های ستیغ عصبی از بافت لوله عصبی می‏باشد.
مواد و روش‏ها: تخم مرغ‏های نطفه‏دار حدود 35 ساعت در دمای 38 درجه سانتی‏گراد و رطوبت نسبی 55 تا 60 درصد در داخل انکوباتور قرار داده شدند تا جنین‏ها به‏مراحل 10-12 طبق جدول تکاملی هامبورگر-هامیلتون رسیدند. سپس جنین‏ها از روی سطح زرده تخم مرغ جداسازی شده  و لوله عصبی از جنین جوجه جدا و به‏مدت 24 ساعت در ظروف کشت سلولی، کشت داده شد تا سلول‏های ستیغ عصبی از آن جدا شوند. آن‏گاه لوله عصبی از کف ظروف کشت جدا و خارج شد و به سلول‏ها به‏مدت 5 روز اجازه تکثیر و ازدیاد داده شد. در نهایت این سلول‏ها جمع‏آوری شدند و جهت ارزیابی پروفایل بیان ژن، PCR صورت گرفت.
نتایج: سلول‏های ستیغ عصبی از لوله عصبی جدا شده و در شرایط کشت گسترش یافتند. این سلول‏ها هم‏چنین نشانگرهای Slug، Sox9 و Sox10 را به‏روش RT-PCR بیان کردند.
نتیجه‏گیری: سلول‏های ستیغ عصبی می‏توانند در محیط آزمایشگاهی از لوله عصبی رها شده و در شرایط کشت مناسب و ساده تکثیر و گسترش یابند.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

 سلول‏های ستیغ عصبی سلول‏های مشتق از نورواکتودرم هستند که در مرز بین صفحه عصبی و اپیدرم در حال تکوین جنین شکل می‏گیرند و با مهاجرت و جابه‏جایی فعال از این ناحیه و نفوذ به مزودرم زیرین از حالت اپی‏تلیالی به‏حالت مزانشیمی تغییر حالت می‏دهند (1). این سلول‏ها به‏عنوان سلول‏های پیش ساز چند توان نامیده می‏شوند، چون قابلیت تمایز به‏رده‏های مختلف سلولی را دارند (2). از مشتقات مختلف سلول‏های ستیغ عصبی می‏توان به بافت همبند و استخوان‏های صورت و جمجمه، گانگلیون‏های اعصاب نخاعی و جمجمه‏ای، سپتوم مخروطی-تنه‏ای در قلب، اودونتوبلاست‏ها، بخش مرکزی غدد فوق کلیه، سلول‏های شوان اشاره نمود (3).  

با توجه به نقایص شدید ناشی از عدم تشکیل سلول‏های ستیغ عصبی، توجه محققان به بیماری‏های مرتبط با این سلول‏ها معطوف شده است؛ چراکه، اختلال در تکوین، تکثیر و مهاجرت این سلول‏ها می‏تواند با ناهنجاری‏های شدیدی در بخش جمجمه و صورت، قلب و عروق و بیماری‏های عصبی همراه باشد (3، 4).

امروزه روش‏های آزمایشگاهی متداول و متنوعی برای دست‏یابی به سلول‏های ستیغ عصبی وجود دارد. می‏توان با جداسازی مستقیم این سلول‏ها از لوله عصبی جنین در حال تکوین جانوران (5، 6) یا تمایز سلول‏های بنیادی مختلف به سلول‏های پیش‏ساز ستیغ عصبی و در نهایت سلول‏های ستیغ عصبی، به چگونگی تکوین و تمایز این سلول‏ها پی برد و به بررسی روند تکثیر و مهاجرت این سلول‏ها در شرایط آزمایشگاهی پرداخت (7، 8). هم‏چنین می‏توان با استفاده از (FACS) fluorescence activated cell sorting به‏تمایز و جداسازی جمعیت سلول‏های ستیغ عصبی از پیش سازهای سلول‏های بنیادی با منشا مختلف نظیر پالپ دندان، فولیکول مو و سلول‏های شوآن اقدام نمود. تلاش‏های فراوانی صورت می‏گیرد تا شرایط کشت این دسته از سلول‏ها به‏گونه‏ای بهبود یابد که بتوان با استفاده از آن‏ها به ارزیابی دقیق‏تر فرآیند تکوین و تمایز و رفتار مهاجرتی این سلول‏ها پرداخت (9). بسیاری از این روش‏ها بسیار پرهزینه و مستلزم صرف زمان زیاد می‏باشند و برخی از آن‏ها نیاز به یک لایه سلولی تغذیه کننده (Feeder layer) جهت کشت و تکثیر این سلول‏ها دارند. برخی از سلول‏های بنیادی که به‏عنوان منبع تمایز به ‏سلول‏های ستیغ عصبی به‏کار می‏روند از پتانسیل تمایزی متفاوتی برخوردارند و نمی‏توانند سلول‏های ستیغ عصبی در مرحله پیش مهاجرتی (Premigratory) جهت ارزیابی دینامیک مهاجرت سلولی این سلول‏ها تولید کنند (5، 9). لذا هدف از این مطالعه ارایه یک راه‏کار ساده، سریع و تا حدی کم هزینه جهت جداسازی و کشت اولیه سلول‏های ستیغ عصبی در مرحله پیش مهاجرتی از بافت لوله عصبی جنین جوجه در محیط آزمایشگاهی است.

 

مواد و روش‌ها

جداسازی و کشت اولیه لوله عصبی: در این مطالعه تجربی، تخم مرغ‏های نطفه‏دار حدود 28 تا 33 ساعت در دمای 38 درجه سانتی‏گراد و رطوبت نسبی 55 تا60 درصد در داخل انکوباتور قرار داده شدند تا جنین‏ها به‏مراحل 7 تا 10 برطبق جدول تکاملی هامبورگر-هامیلتون برسند. در این مطالعه کلیه موازین اخلاقی جهت کار بر روی جنین‏های حاصل از تخم‏مرغ‏های نطفه‏دار مطابق با تاییدیه کمیته اخلاق دانشگاه علوم پزشکی اردبیل رعایت شده بود. سپس جنین‏ها از روی سطح زرده تخم‏مرغ جداسازی شده و در محیط (L15) Leibovitz's جمع‏آوری شدند. برای جداسازی راحت‏تر بافت‏ها از هم‏دیگر، جنین‏ها در 5 میلی‏لیتر آنزیم Dispase  با غلظتmg/ml  1 به‏مدت 10 دقیقه قرار داده شدند. سپس برای خنثی شدن اثر آنزیم جنین‏ها به‏مدت 15 دقیقه در محیط L15 حاوی سرم جنینی گوساله قرار داده شدند. سپس در زیر استریومیکروسکوپ به‏کمک سوزن‏های انسولین لوله عصبی از جنین جوجه جدا شد و به‏محیط  L15تازه منتقل شد. لوله‏های عصبی سپس به‏ظروف کشت 6 خانه‏ای که حاویDMEM/F12 + 15% FBS + 10-7µM RA + 20ng/mL bFGF + 10ng/ml EGF + 0.1% β-ME + 1% Pen/Sterp بودند، انتقال داده شدند و پس از گذشت 24 ساعت، سلول‏های ستیغ عصبی شروع به‏جداشدن از لوله عصبی کردند. آنگاه لوله عصبی از کف ظروف کشت جدا و خارج شد. سپس به‏سلول‏ها در محیط کشت DMEM/F12 + 15% FBS + µM RA 7-10 به‏مدت 5 روز اجازه تکثیر و ازدیاد داده شد.

استخراج RNA و انجام RT-PCR: در این بررسی از روش RT-PCR برای ارزیابی بیان ژن‏های Slug، Sox9 وSox10به‏عنوان ژن‏هایی که در سلول‏های ستیغ عصبی بیان می‏شوند، استفاده شد. هم‏چنین بیان ژن‏های BrachyuryوMyoD  که در سلول‏های مزودرمی و پیش‏سازهای عضلانی تجلی می‏یابند در این سلول‏ها مورد بررسی قرار گرفتند. سلول‏های ستیغ عصبی پس از جداسازی از ظروف کشت، در محلول ترایزول قرار داده شده ودر دمای 80- درجه سانتی‏گراد نگه‏داری شدند. پس از استخراج RNA Total از نمونه‏های جدا شده، با استفاده از کیت سنتز cDNA از روی یک میکروگرم Total RNA، cDNA سنتز شد. سپس واکنش PCR برای پرایمرهای اختصاصی مختلف در حجم کلی 25 میکرولیتر با استفاده از دستگاه مَسترسایکلر گرادیان اپندورف مدل 5331 صورت گرفت. لیست پرایمرها و توالی آن‏ها در جدول 1 آورده شده است. در نهایت محصول PCR حاصل از تکثیر بیان ژن‏های اختصاصی Sox9، Sox10،Slug، MyoD و Brachyury و ژن GAPDH به‏عنوان ژن خانگی روی ژل آگارز 1 درصد الکتروفورز شد و باندهای ایجاد شده به‏کمک نور UV دستگاه doc  Gel مشاهده و تصاویر آن ثبت شد.

 

جدول 1: فهرست پرایمرهای مورد استفاده همراه با تعداد جفت بازها (Base pair: bp)، دمای اتصال پرایمر به‏الگو (AT) و تعداد سیکل

Cycle

Length(bp)

AT(°C)

Primer Sequence (5'→3' Gene )

Gene

28

330

50

F: AGTCATCCCTGAGCTGAATG

R: AGGATCAAGTCCACAACACG

GAPDH

35

448

60

F: CAGCCCCACCATGTCGGAT

R: GGTGGTCCTTCTTGTGCTGC

Sox9  

33

447

60

F: CAAGAGCAAACCCCACGTCA

R: CTCGGTCTTAGGGGTGGTGG

Sox10 

33

509

53

F:CCAAGAAGCCAAACTACAGCG     R: GTAGCGTGTGGGTCCTGATGT

Slug   

35

200

55

F:ACTACACGGAATCACCAAATGACC

R: AAGGAATCTGGGCTCCACTGTC

MyoD 

35

388

49

F: CCTCAAGTTTGGCATCTGG

R: GCTGACAGGGGTCTGAATGT

Brachyury

 

نتایج

کشت اولیه لوله عصبی جداشده از جنین جوجه

پس از جداسازی لوله‏های عصبی از جنین جوجه و کشت آن‏ها در ظروف کشت (شکل A1)، لوله‏های عصبی به‏کف این ظروف چسبیدند و طی مدت 24 ساعت، سلول‏های ستیغ عصبی از اطراف آن‏ها شروع به‏جدا شدن نمودند (شکل B1). بعد از این زمان، توده های باقی‏مانده از بافت لوله عصبی از ظروف کشت جدا شدند و جای آن‏ها به‏صورت یک حفره در وسط سلول‏های جدا شده از آن مشاهده شد (شکل C1).

 

شکل 1: کشت اولیه لوله عصبی. A) استقرار لوله عصبی در ظرف کشت، (B جدا شدن سلول‏های ستیغ عصبی از اطراف لوله عصبی کشت داده شده و (C حذف بافت کشت داده شده لوله عصبی از ظرف کشت پس از 24 ساعت (بزرگنمایی 20×).

 

ظهور و تکثیر سلول‏های ستیغ عصبی

بررسی مورفولوژی سلول‏ها با استفاده میکروسکوپ اینورت نشان داد که 24 ساعت بعد از جداسازی توده‏های باقی‏مانده لوله عصبی از ظروف کشت، سلول‏هایی با زواید متعدد که از نظر مورفولوژیکی با سلول‏های ستیغ عصبی مطابقت داشتند، ظاهر شدند (شکل A2). تعداد این سلول‏ها پس از تعویض محیط کشت روبه افزایش نهاد؛ طوری‏که بعد از 5 روز، تعداد فراوانی از آن‏ها با مورفولوژی سلول‏های ستیغ عصبی در کف ظروف کشت مشاهده شدند (شکل B2). حدودا 5-6 روز بعد از تکثیر این سلول‏ها در محیط کشت، برخی از آن‏ها به‏سمت تولید سلول‏های ملانوسیت پیش رفتند. این سلول‏ها از لحاظ مورفولوژیکی، سلول‏هایی با دانه‏های سیتوپلاسمی سیاه رنگ بودند (شکل C2).

 

 

شکل2: (A) مورفولوژی سلول‏های ستیغ عصبی با زوائد متعدد. تکثیر فوق العاده آن‏ها بعد 5 روز، (B) سلول‏های ستیغ عصبی با بزرگ‏نمایی بیش‏تر (C) سلول‏های شبیه ملانوسیت 5 روز بعد از کشت.

 

نتایج RT-PCR

با استفاده از روش RT-PCR، بیان ژن‏های Sox9،Sox10، Slug در سلول‏های ستیغ عصبی به‏دست آمده از کشت اولیه لوله عصبی جنین بررسی شد. بیان ژن GAPDH نیز به‏عنوان ژن خانگیدر همه سلول‏ها ارزیابی شد. نتایج به‏دست آمده نشان دادند که ژن‏های Sox9،Sox10، Slug. که نشان‏دهنده هویت سلول‏های ستیغ عصبی بودند در سلول‏های ستیغ عصبی جدا شده از لوله عصبی بیان شدند. هم‏چنین جهت ارزیابی بهتر این سلول‏ها، بیان ژن MyoD به‏عنوان ژنی که درمایوتوم‏های حاصل از سومایت‏های جنینی بیان می‏شود و نیز بیان ژنBrachyury  که خاص سلول‏هایی با منشا مزانشیمی است، مورد ارزیابی قرار گرفت. همان‏طورکه در شکل3 مشخص شده است، بیان این ژن در سلول‏های ستیغ عصبی در مقایسه با کل جنین و حتی ژن‏های اختصاصی سلول‏های ستیغ عصبی به‏مراتب کمتر بود.

 

 

شکل3: نتایج RT-PCR بیان ژن‏های مختلف در سلول‏های ستیغ عصبی (NCC) و کل جنین (WE).

 

بحث

با توجه به ‏اهمیت و گستردگی تمایز سلول‏های ستیغ عصبی در موجودات زنده و بیماری‏های مختلف مرتبط با نواقص و جهش‏های این سلول‏ها، امروزه مطالعات مختلفی برروی نمونه‏های آزمایشگاهی این سلول‏ها معطوف شده است. از بین حیوانات آزمایشگاهی بیش‏تر مطالعات برروی جنین‏های موش و جوجه صورت گرفته است (10). در مطالعه حاضر از لوله عصبی جنین جوجه برای دست‏یابی به سلول‏های ستیغ عصبی درمحیط آزمایشگاهی استفاده شده است.

بررسی‏های صورت گرفته نشان می‏دهد که نوع محیط کشت تاثیر مهمی در تکثیر و تمایز سلول‏ها دارد. به‏عنوان مثال؛ بدون وجود FBS درمحیط کشت، لوله عصبی توانایی اتصال به‏ظروف کشت را ندارد. در غلظت‏های 5، 15 و 20 درصد FBS توانایی اتصال لوله عصبی وجود دارد، اما درصورتی‏که غلظت FBS از 15 تا 20 درصد بالاتر رود توانایی تمایز این سلول‏ها به‏سمت سلول‏های ملانوسیت افزایش می‏یابد. به‏همین دلیل بهترین غلظت حدود FBS 15 درصد است تا علاوه ‏بر اتصال لوله عصبی و آزاد‏سازی سلول‏های ستیغ عصبی، از تمایز سریع آن‏ها به‏سمت سلول‏های ملانوسیت جلوگیری شود. در صورت حضور لوله عصبی، ظرف مدت 1 تا 4 روز جمعیت زیادی از سلول‏های ستیغ عصبی در محیط کشت ایجاد می‏شود. اما در صورت جدا کردن لوله عصبی از محیط، بیشتر سلول ها لیز می‏شوند (11). این امر احتمالا نشان‏دهنده وجود فاکتورهای حفظ کننده بقا سلول‏های ستیغ عصبی است که از لوله عصبی ترشح می‏شود (12). مطالعات مختلف افزودن اسید رتینوییک و بتامرکاپتواتانول را نیز در حفظ بقای سلول‏های ستیغ عصبی موثر دانسته‏اند (13). لذا در این مطالعه از bFGF و EGF و نیز اسید رتینوئیک و بتا مرکاپتواتانول برای حفظ بقا سلول‏های ستیغ عصبی در محیط کشت استفاده شد و نتایج بیان‏گر تکثیر و تزاید این سلول‏ها در محیط کشت بود.

24 تا 48 ساعت بعد از کشت لوله عصبی درمحیط کشت، 2 دسته سلول در اطراف آن از نظر مورفولوژیکی ایجاد می‏شود که یک دسته از سلول‏ها از لحاظ مورفولوژی ستاره‏ای شکل با فضای بین آن‏ها هستند که شبیه سلول‏های ستیغ عصبی می‏باشند و دسته دیگر سلول‏های پهنی هستند که از قسمت شکمی لوله عصبی منشا می‏گیرند. حدود 5-4 روز بعد از کشت، شبکه پیچیده‏ای از آکسون و ساختارهای شبیه نورون در محیط شکل می‏گیرد. هم‏چنین ملانوسیت­ها نیز در این مرحله تشکیل می‏شوند که این نوع تمایز، ارتباط مستقیمی با غلظت‏های بالای FBS دارد (11). در این مطالعه نیز 1 روز بعد از کشت لوله عصبی، سلول‏هایی که از لحاظ مورفولوژی شبیه سلول‏های ستیغ عصبی بودند، تکثیر یافتند و بعد از جداسازی از لوله عصبی و اضافه کردن ترکیبات مکمل به‏محیط کشت، تکثیر قابل توجهی از سلول‏های ستیغ عصبی اتفاق افتاد. با گذشت زمان، از تکثیر سلول‏های ستیغ عصبی در محیط کشت کاسته شده و به‏سمت تمایز پیش رفتند. لذا در این مطالعه حدود 5 روز بعد از تکثیر، سلول‏های ستیغ عصبی از محیط کشت جمع‏آوری شدند.

بعد از جداسازی و جمع‏آوری سلول‏های ستیغ عصبی، ماهیت این سلول‏ها باید از طریق بیان نشانگرهای اختصاصی به‏اثبات برسد. ژن‏های مختلفی برای تعیین ماهیت این سلول‏ها استفاده می‏شود (14، 15 و 16). در مطالعه حاضر بیان ژن‏های Sox9،Sox10  و Slug با استفاده از روش RT-PCR بررسی شدند.

مطالعات نشان می‏دهند که در تشکیل سلول‏های ستیغ عصبی فاکتورهای مختلفی از جمله اعضا خانواده   SoxوSnail درتنظیم تغییر حالت اپی‏تلیال به‏مزانشیم (EMT) و نیز مهاجرت سلول‏های ستیغ عصبی نقش دارند (17، 18 و 19). Sox9 هم به‏طورمستقیم و هم از طریق فعال‏سازی Snail2 سبب این تغییر حالت می‏شود (17، 18). در تشکیل سلول‏های ستیغ عصبی، علاوه‏بر فاکتورهای ذکر شده، مولکول‏های پیام‏رسانی مانند BMP وWNT نیز نقش دارند. در واقع، BMP سبب فعال شدن Snail2 وSox9 می‏شود (20، 21 و 22).

Snail1/2 در مراحل اولیه تشکیل سلول‏های ستیغ عصبی بیان می‏شود که نقش مهمی در تخصص یافتگی این سلول‏ها دارد. اختلال در بیان این ژن سبب بروز مشکلات جمجمه‏ای–‏چهره‏ای مانند کام شکاف‏دار در موش می‏شود (10). Sox10 نقش‏های مختلفی در سلول‏های ستیغ عصبی و مشتقات آن‏ها بازی می‏کند از جمله حفظ ظرفیت تمایز به‏سمت سلول‏های نورون و گلیال، جلوگیری از تمایز آشکار به‏سمت سلول‏های ماهیچه‏ای صاف و نورون و حفظ تکثیر سلول‏های ستیغ عصبی (18). در انسان، موش و ماهی گورخری، جهش‏هایSox10، مشتقات سلول‏های ستیغ عصبی واگال و ترانکال را تحت تاثیر قرار می‏دهد که این نشان می‏دهد سلول‏های ستیغ عصبی این دو منطقه به Sox10 وابسته هستند (23، 24 و 25).

Slug و Snail از اولین عوامل رونویسی بودند که در سلول‏های ستیغ عصبی شناسایی شدند. این ژن‏ها جزو خانواده Zn-finger هستند و به‏وفور به‏عنوان نشان‏گر سلول‏های ستیغ عصبی استفاده می‏شوند. در جنین جوجه Slug بیان می‏شود ولی snailبیان ندارد؛ اما در موش و ماهی گورخری سلول‏های ستیغ عصبیSnail را به‏جای Slug بیان می‏کنند (16، 19). کاهش عمل‏کردSlug  در جنین جوجه و Xenopus سبب نقص مهاجرت سلول‏های ستیغ عصبی درمحیط آزمایشگاهی می‏شود. بنابراین  Slugاز مهم‏ترین عوامل لایه‏زایی سلول‏های ستیغ عصبی به‏شمار می‏رود (16، 17).

در مطالعه حاضر بیان ژن‏های Sox9،Sox10  وSlugروی سلول‏های ستیغ عصبی با استفاده از روش RT-PCR بررسی شد که نتایج نشان‏دهنده بیان بالای ژن‏های ذکر شده روی سلول‏های ستیغ عصبی بود. از آن‏جایی‏که صرف بیان ژن‏ها در سلول‏های کشت داده شده نمی‏تواند تعیین‏کننده هویت سلول‏ها باشد بلکه ژن‏هایی که در آن سلول‏ها بیان نمی‏شوند نیز باید مورد بررسی قرار گیرند )26)، در این مطالعه بیان دو ژن MyoDوBrachyury نیز در این سلول‏ها بررسی شدند که نتایج به‏دست آمده نشان دهنده عدم بیان MyoDو بیان بسیار ضعیفBrachyury  در سلول‏های ذکر شده بود. MyoD از ژن‏هایی می‏باشد که در سومایت‏ها با غلظت بالا تحت تاثیر SHH بیان می‏شود و در واقع نشان‏دهنده هویت میوژنیک در سلول‏های سومایتی می‏باشد و عدم بیان ژن ذکرشده در سلول‏های ستیغ عصبی نیز به‏نوعی ماهیت غیرمزودرمی این سلول‏ها را نشان می‏دهد (27).

ژن Brachyury که در گره اولیه، سلول‏های پیش‏ساز نوتوکورد و نوتوکورد تجلی می‏یابد، تنظیم تشکیل مزودرم پشتی را در نواحی میانی و دمی رویان کنترل می‏کند. این ژن برای مهاجرت سلول‏ها از طریق شیار اولیه ضرورت دارد. Brachyury نوعی پروتئین متصل شونده به توالی­های اختصاصی DNA را که به‏عنوان عامل نسخه‏برداری عمل می‏کند، رمزگذاری می‏نماید (1). این ژن نیز در سلول‏های ستیغ عصبی بیان بسیار ضعیفی را در مقایسه با ژن‏های اختصاصی سلول‏های ستیغ عصبی نشان داد که این امر بیان‏گر ماهیت غیرمزودرمی این سلول‏ها بود.

 

نتیجه­گیری

نتایج حاصل از این مطالعه نشان می‏دهد که لوله عصبی جنین جوجه در محیط آزمایشگاهی قادر به‏رهاسازی سلول ستیغ عصبی می‏باشد و می‏توان هویت آن‏ها را از طریق بیان ژن‏هایی که در شکل‏گیری و مهاجرت این سلول‏ها نقش دارد مانند Slug، Sox9 وSox10 و عدم بیان ژن‏هایی که نقشی در تشکیل آن‏ها ندارند مثل MyoD و Brachyury تعیین نمود. هم‏چنین با استفاده از یک محیط کشت غنی حاوی فاکتورهای رشد می‏توان به تکثیر و ازدیاد این سلول‏ها مبادرت نموده و از آن‏ها در مطالعات آتی بهره جست.

 

تشکر و قدردانی

این مقاله برگرفته از پایان نامه دانشجویی با کد 0539 در دانشگاه علوم پزشکی اردبیل می‏باشد و بدین‏وسیله نویسندگان مقاله مراتب تقدیر و تشکر خود را از معاونت تحقیقات و فناوری دانشگاه علوم پزشکی اردبیل جهت تامین اعتبار این پایان نامه به‏عمل می‏آورند. 

1. Sadler TW. Langman's medical embryology.13th Ed. USA: Walter kluwer; 2015.
2. Zhang J, Duan X, Zhang H, Deng Z, et al. Isolation of neural crest-derived stem cells from rat embryonic mandibular processes. Cell Biology. 2006; 98(10): 567–575.
3. Schoenwolf GC. Larsen’s human embryology. 5th Ed. Philadelphia: CH Livingstone; 2014.
4. Szabó A, Mayor R. Mechanisms of neural crest migration, Annual Review of Genetics. 2018; 52: 43-6.
5. Pfaltzgraff ER, Mundell NA, Labosky PA. Isolation and culture of neural crest cells from embryonic murine neural tube, Journal of Visualized Experiments. 2012; 64: e4134.
6. Zhu S, Liu W, Ding H, Cui H, et al. BMP4 and Neuregulin regulate the direction of mouse neural crest cell differentiation, Experimental and Therapeutic Medicine. 2019; 17: 3883-3890.
7. Zhu Q, Li M, Yan C, Lu Q, et al. Directed differentiation of human embryonic stem cells to neural crest stem cells, functional peripheral neurons, and corneal keratocytes. Biotechnology Journal. 2017; 12(12): 1700268.
8. Huang M, Miller ML, Mchenry LK, Zheng T, et al. Generating trunk neural crest from human pluripotent stem cells. Scientific Report. 2016; 6: 19727.
9. Etchevers H. Primary culture of chick, mouse or human neural crest cells, Nature Protocols, 2011;6(10):1568-1577.
10. Brüstle O, Hoch M. Neural crest development in a human embryonic stem cell-based model system. Dissertation, Bonn 2012; 24: 08-2012.
11. Hou L, Takeuchi T. Differentiation of reptilian neural crest cell in vitro. Developmental Biology 1992; 28A(5):348-354.
12. McLennan R, Schumacher LJ, Morrison JA, Teddy JM, et al. VEGF signals induce trailblazer cell identity that drives neural crest migration. Developmental Biology 2015; 1606(15):30-124.
13. Ito K, Morita T. Role of Retinoic Acid in Mouse Neural Crest Cell Development In Vitro. NIH. 1995; 204(2): 211-218.
14. Barrallo GA, Nieto MA. The Snail genes as inducers of cell movement and survival: implications in development and cancer. Development. 2005; 132(14): 3151-3161
15. Cheng U, Cheung M, Elmagd AM, Orme A, et al. Chick sox10, a transcription factor expressed in both early neural crest cells and central nervous system. Brain Research. 2000; 121(2): 233-241.
16. del Barrio MG, Nieto MA. Overexpression of Snail family members highlights their ability to promote chick neural crest formation. Development. 2002; 129(7): 1583-1593.
17. Sakai D, Suzuki T, Osumi N, Wakamatsu Y. Cooperative action of sox9, snail2 and PKA signaling in early neural crest development. Development 2006; 133: 323-333.
18. Kim J, Lo L, Dormand E, David J. Anderson. Sox10 Maintanance, Multipotency and inhibit neuronal differentiation of neural crest cell Neuron. 2003; 38(1): 17-31.
19. Nieto MA. The Snail superfamily of Zinc-finger transcription factors.Cell Biology. 2002; 3(3): 155-166.
20. Sefton M, Sanchez S, Nieto MA.  Conserved and divergent roles for members of the Snail family of transcription factors in the chick and mouse embryo. Development. 1998; 125: 3111-3121.
21. Castro MI, Marcelle C, Fraser M. Ectodermal Wnt function as a neural crest inducer. Science. 2002; 297(5582): 848–851.
22. Chang C, Hemmati BA. Neural crest induction by Xwnt7B in Xenopus. Developmental Biology. 1998; 194(1):129-34.
23. Morais d, Silva S, Hacker A, Harley V, et al. Sox9expression during gonadal development implies a conserved role for the gene intestis differentiation in mammals and birds. Nature Genetics. 1996; 14(1): 62-68.
24. Kleber M, Sommer L. Wnt signaling and the regulation of stem cell function. Cell Biology. 2004; 16(6): 681-687.
25. Kleber M, Lee HY, Wurdak H, Buchstaller J, et al. Neural crest stem cell maintenance by combinatorial Wnt and BMP signaling. Cell Biology. 2005; 169(2): 309-320.
26. Diez D, Corral R, Storey KG. Markers in vertebrate neurogenesis. nature review. 2001; 2(1):835-839.
27. Gordon M, Jay W, Frank E. Sonic hedgehog enhances somite cell viability and formation of primary slow muscle fibers in avian segmented mesoderm. Anatomy embryology 1999; 200(3): 239-252.