تاثیر کیتوزان بر میزان ترکیبات فنلی، اسیدرزمارینیک و بیان ژن‌های کلیدی بیوسنتز اسید رزمارینیک در کشت تعلیقی بادرنجبویه (Melissa officinalis L.)

نوع مقاله : علمی - پژوهشی

نویسندگان

دانشگاه ولی‌عصر (عج) رفسنجان، دانشکده کشاورزی، گروه ژنتیک و تولید گیاهی، رفسنجان، ایران

چکیده

هدف: هدف از این پژوهش بررسی تاثیر کیتوزان بر تولید ترکیبات فنلی، اسید رزمارینیک و بیان ژن­های کلیدی در بیوسنتز این ترکیبات در کشت تعلیقی بادرنجبویه بود.
مواد و روش‏ها: جهت تهیه کالوس از ترکیب نفتالن استیک اسید (1 میلی­گرم بر لیتر)، توفوردی (1 میلی­گرم بر لیتر) و کینتین (5/0 میلی­گرم بر لیتر) و ریزنمونه ساقه استفاده شد. پس از راه‌اندازی کشت تعلیقی، تیمار کیتوزان با سه سطح (0، 50 و 100 میلی­گرم بر لیتر) به مدت یک، سه و پنج روز در قالب آزمایش فاکتوریل بر پایه طرح کاملا تصادفی با سه تکرار انجام شد. فعالیت آنزیم فنیل‌آلانین­ آمونیالیاز، میزان پروتئین محلول، میزان ترکیبات فنلی و میزان اسیدرزمارینیک اندازه­گیری شد. هم­چنین بیان ژن­های فنیل‌آلانین­ آمونیالیاز و رزمارینیک ‌اسید سینتاز با روش Real-time PCR بررسی شد.
نتایج: فعالیت آنزیم فنیل­آلانین آمونیالیاز در غلظت 50 میلی­گرم بر لیتر کیتوزان پس ازگذشت سه روز از شروع تیمار بیش‏ترین افزایش را نشان داد که با افزایش میزان ترکیبات فنلی همراه بود. بیان نسبی ژن فنیل‌آلانین ­آمونیالیاز در غلظت 50 میلی­گرم بر لیتر کیتوزان در زمان سه روز پس از اعمال تیمار نسبت به شاهد 5/2 برابر افزایش نشان داد. این افزایش بیان ژن، افزایش فعالیت آنزیم فنیل­آلانین آمونیالیاز را به‏دنبال داشت. بیش‏ترین افزایش بیان ژن رزمارینیک‌اسید سینتاز در غلظت 100 میلی­گرم بر لیتر کیتوزان پنج روز پس از اعمال تیمار مشاهده شد که به افزایش میزان اسیدرزمارینیک منجر شد.
نتیجه‏گیری: با توجه به نتایج به‏دست آمده تیمار کیتوزان به‏مدت پنج روز جهت افزایش میزان اسید­ رزمارینیک در کشت سلولی بادرنجبویه توصیه می­شود.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

بادرنجبویه (Melissa officinalis L.) از خانواده نعناعیان، به­دلیل تولید متابولیت­های ثانویه مهم و کاربرد این ترکیبات در زمینه­های پزشکی، صنایع آرایشی-بهداشتی و صنایع غذایی بسیار مورد توجه قرار گرفته است (1). اسیدرزمارینیک (استر اسیدکافئیک و 3، 4 دی هیدروکسی فنیل لاکتیک‏اسید) ترکیب فنلی فعال غالب (5/0 تا 8/6 درصد از وزن خشک گیاه) در گیاه بادرنجبویه علاوه بر فعالیت آنتی­اکسیدانتی، دارای خواص ضد­سرطانی، ضد­افسردگی، ضد­آرتروز، ضد­آلرژی و ضد­باکتریایی نیز می‏باشد (2). اسید رزمارینیک از طریق مسیر بیوسنتزی فنیل­پروپانوئیدی با استفاده از پیش­ماده فنیل­آلانین با دخالت آنزیم­ فنیل‌آلانین‌ آمونیالیاز (PAL: EC 4.3.1.5) ساخته می­شود. آنزیم رزمارینیک اسید سینتاز (RAS: EC 2.3.1.140)، در انتهای مسیر بیوسنتزی، تشکیل اسید رزمارینیک را کاتالیز می­کند (شکل 1).

 

 

شکل 1: مسیر بیوسنتزی اسیدرزمارینیک در بادرنجبویه (3)

 

استفاده از راهکارهای زیست­فن‏آوری جهت بهبود کمیت و کیفیت مواد موثره گیاهان دارویی امری ضروری است. پیشرفت در روش‌های زیست­شناسی به‏ویژه کشت بافت گیاهی، ابزار جدیدی را جهت فرآوری تجاری گیاهان دارویی و مواد موثره آن­ها فراهم کرده است. افزودن محرک‌ها به کشت بافت گیاهی، موثرترین تکنیک برای بهبود تولید متابولیت‌های ثانویه در این سیستم­ها می‏باشد، به­گونه­ای که طی پاسخ به محرک‌ها، سیستم دفاعی گیاه فعال و در نتیجه­ی بیان ژن‌های دفاعی و راه‌اندازی مسیرهای بیوسنتزی مربوط، متابولیت‌های ثانویه تجمع می­یابند (4). محرک­های زیستی به منظور افزایش تولید متابولیت‌های ثانویه در شرایط کشت درون شیشه )ortiv ni( از اهمیت ویژه­ای برخوردار می­باشند (5). مطالعات نشان داده است که محرک­های زیستی با القای تنش اکسیداتیو، ترکیبات فنلی را از طریق افزایش فعالیت آنزیم­های دخیل در بیوسنتز آن­ها افزایش می­دهد (6). استفاده از کیتوزان به‏عنوان محرک، چشم­انداز امیدوار­کننده­ای در تولید فیتوالکسین­ها و متابولیت‌های ثانویه در زیست­فن‏آوری ایجاد کرده است (7). کیتوزان پلی­ساکاریدی پلی­کاتیونی و مشتق از کیتین است. به‏دلیل غیر­سمی­بودن، خاصیت جذب بالا، امکان تجزیه در طبیعت و سازگاری با محیط زیست بسیار مورد توجه قرار گرفته است.فعالیت زیستی کیتوزان از باند­شدن به گیرنده­های غشایی ناشی می­شود که نقش آن در القای متابولیسم ثانویه در کشت سلول­ گیاهی، به وزن ملکولی و درجه استیلاسیون آن بستگی دارد (8).

تاثیر مثبت کیتوزان بر تولید متابولیت­های ثانویه در پژوهش­های زیادی به اثبات رسیده است. به­عنوان مثال، نتایج استفاده از کیتوزان در کشت سلولی گیاه ریحان، افزایش مقدار کل ترکیبات فنلی به‏ویژه ­اسیدرزمارینیک را نشان داده است (9). هم­چنین تیمار کیتوزان در کشت ریشه­های مویین گیاهان مختلف افزایش قابل توجهی در میزان متابولیت­های ثانویه را موجب شده است (10- 14). نتایج کمالی­پور آزاد و همکاران (15) نشان داد که کیتوزان با تاثیر بر بیان ژن آنزیم­های کلیدی مسیر بیوسنتزی ترکیبات فنیل­پروپانوئیدی، سبب افزایش تولید متابولیت­های ثانویه شده است.

در گیاهان تولید کننده اسیدرزمارینیک، ارتباط سنتز اسیدرزمارینیک با بیان ژن­های دخیل در مسیر بیوسنتزی آن از جمله ژن‏های فنیل­آلانین آمونیالیاز و رزمارینیک اسید سینتاز تایید شده است. براساس بررسی DNA ژنومی و بررسی­های ساترن بلات مشخص شد که ژن فنیل­آلانین آمونیالیاز جداسازی شده از گیاه بادرنجبویه، شامل یک اینترون می­باشد و پروتئینی مشتمل بر 836 اسید آمینه­ را به‏رمز درمی­آورد. هم­چنین تنها یک نسخه از ژن رزمارینیک اسید سینتاز در بادرنجبویه حضور دارد که فاقد اینترون است و پروتئینی مشتمل بر 427 اسید آمینه را کد می­کند (3).

براساس شواهد تولید اسیدرزمارینیک در کشت سلولی بسیار بیش‏تر از تولید آن در گیاهان طبیعی است (2). از آن‏جایی­که بادرنجبویه یک گیاه مدل دارویی مناسب جهت مطالعه در زمینه تنظیم بیوسنتز اسیدرزمارینیک است، در این پژوهش تاثیر کیتوزان به­عنوان یک محرک زیستی بر بیوسنتز ترکیبات فنلی، اسید رزمارینیک و فعالیت آنزیم­ کلیدی فنیل‌آلانین ‌آمونیالیاز مرتبط با بیوسنتز آن­ها، در کشت تعلیقی آن مورد بررسی قرار گرفت. از آن‏جایی­که ژن­های فنیل­آلانین آمونیالیاز و رزمارینیک اسید سینتاز به­عنوان ژن­های مهم در ارتباط با مسیر بیوسنتزی اسید رزمارینیک در گیاه بادرنجبویه شناسایی شده­اند، بررسی بیان این ژن­ها تحت تاثیر کیتوزان از اهداف دیگر این پژوهش بود.

 

مواد و روش‌ها

تهیه ریزنمونه و القای کالوس از گیاه‏چه­های استریل: بذرهای گیاه بادرنجبویه با درصد جوانه‏زنی 2/96 درصد از شرکت پاکان بذر اصفهان تهیه شد. بعد از ضدعفونی کردن سطحی بذر­ها، با محلول هیپوکلریت سدیم پنج درصد و  سپس محلول اتانول 70 درصد سه بار آبکشی با آب مقطر استریل انجام شد. بذرهای ضدعفونی­شده به شیشه‌های حاوی محیط کشت MS  (50 درصد) بدون هورمون با اسیدیته 7/5، منتقل و جهت رشد به اتاق رشد با دوره نوری شانزده ساعت نور و هشت ساعت تاریکی، دمای 25 درجه سانتی­گراد و شدت نور 3000 لوکس منتقل شدند. بعد از گذشت 30 روز از رشد گیاهچه­ها به­عنوان ریزنمونه مورد استفاده قرار گرفتند. برای القای کالوس، ریزنمونه ساقه و محیط MS شامل 8/0 درصد آگار و 3 درصد سوکروز همراه با ترکیبات هورمونی نفتالن­استیک اسید (NAA)، توفوردی و کینتین به‏ترتیب با غلظت­ 1، 1 و 5/0 میلی­گرم بر لیتر استفاده شد (16). سپس محیط‏های کشت در اتاق رشد در دمای 25 درجه سانتیگراد در تاریکی نگه‏داری شد. بعد از گذشت 7 تا 01 روز القای کالوس­ در ریز نمونه­ها شروع شد. واکشت کالوس­ها هر دو هفته یک­بار انجام شد.

راه‌اندازی کشت سلولی تعلیقی: به­منظور راه‌اندازی کشت سلولی تعلیقی، مقدار دو گرم کالوس ترد و هم­سن درون ارلن 100 میلی­لیتری، حاوی 25 میلی­لیتر محیط کشت مایع MS با ترکیبات هورمونی ذکر شده منتقل و با سرعت 110 دور در دقیقه در دمای 25 درجه سانتی­گراد در تاریکی روی لرزاننده (شیکر) نگه‏داری شدند. به‏منظور تکثیر، همگن­سازی و سازگاری سلول­ها به‏محیط کشت تعلیقی واکشت سلول­ها هردو هفته یک‏بار انجام (5 مرحله) و در هر مرحله سلول­ها بر روی نایلون مش توسط قیف بوخنر با مکش جمع‏آوری و به‏محیط جدید منتقل شد.

تعیین منحنی رشد سلولی: قبل از اعمال تیمار، به‏منظور تعیین منحنی رشد سلول­ها یک گرم کالوس همگن به‏ارلن 100 میلی‏لیتر حاوی 25 میلی­لیتر محیط کشت مایع جدید MS با ترکیب هورمونی قبلی منتقل و از روز اول تا روز 20 پس از واکشت، به‏فاصله زمانی دو روز یک­بار نمونه­برداری انجام و براساس وزن تر توده سلولی منحنی رشد ترسیم شد.

تیمار سلول­ها با کیتوزان: به­منظور اعمال تیمارها، کشت تعلیقی جدید تهیه شد. یک گرم سلول با استفاده از قیف بوخنر و در شرایط مکش برداشت و به‏ارلن حاوی 15 میلی­لیتر محیط کشت مایع منتقل شد. محیط­های کشت در دمای 25 درجه سانتی­گراد با سرعت 110 دور در دقیقه و در محیط تاریک روی لرزاننده (شیکر) نگه‏داری شدند. با توجه به منحنی رشد سلول­ها، که در آزمایشی جداگانه بررسی شد، در روز هفتم از دوره رشد سلولی محلول کیتوزان با غلظت های 0، 50 و 100 میلی‌گرم بر لیتر به محیط کشت سلولی اضافه شد. سپس سلول­ها در زمان­های 24 ساعت، سه روز و پنج روز بعد از اضافه نمودن کیتوزان به محیط کشت برای بررسی‌های بیوشیمیایی و ملکولی برداشت، در نیتروژن مایع منجمد و به‏فریزر 80- درجه سانتی­گراد منتقل شد. جهت تهیه محلول کیتوزان از روش خان و همکاران (17) استفاده شد.

سنجش میزان پروتئین کل و فعالیت آنزیم فنیل‌آلانین ‌آمونیالیاز: 2/0 گرم نمونه­ منجمد با استفاده از هاون در بافر Tris-HCl 50 میلی­مولار با اسیدیته 8/8 حاوی مرکاپتواتانول دو میلی­مولار ساییده و سپس با سرعت 9000 دور در دقیقه به‏مدت 10 دقیقه در دمای چهار درجه­ سانتی­گراد سانتریفیوژ شد. فاز رویی برای سنجش پروتئین کل و فعالیت آنزیم فنیل‌آلانین‌ آمونیالیاز مورد استفاده قرار گرفت. سنجش پروتئین تام بر اساس روش برادفورد (18) انجام گرفت. یک میلی­لیتر معرف برادفورد به 1/0 میلی­لیتر نمونه اضافه و بعد از مخلوط شدن، به‏مدت 10 دقیقه در دمای اتاق نگه‏داری و سپس جذب نمونه­ها در طول موج 595 نانومتر توسط دستگاه اسپکتروفتومتر مدل Analytik Jena ساخت کشور آلمان قرائت شد. آلبومین سرم گاوی (Bovin Serum Albumin) با غلظت­های 0 تا 100 میکروگرم در میلی‏لیتر به‏عنوان استاندارد مورد استفاده­ قرار­ گرفت. فعالیت آنزیم فنیل‌آلانین‌ آمونیالیاز به‏عنوان آنزیمی کلیدی در متابولیسم ترکیبات فنلی اندازه­گیری شد. مخلوط واکنش شامل 5/0 میلی­لیتر فنیل­آلانین (10میلی­مولار)، یک میلی­لیتر بافر Tris-HCl 50 میلی­مولار با اسیدیته 8/8، 4/0 میلی­لیتر آب مقطر و 1/0 میلی­لیتر عصاره استخراجی بود. نمونه­ها به‏مدت یک ساعت در دمای 37 درجه سانتی­گراد (ماکزیمم فعالیت آنزیم) نگه‏داری و واکنش آنزیمی با افزودن اسید­ کلریدریک شش مولار متوقف شد. اسید سینامیک (فرآورده آنزیم PAL) موجود، سه بار با اتیل استات استخراج و توسط جریانی از هوای تصفیه شده خشک شد. میزان اسید سینامیک پس از حل نمودن در NaOH 05/0 مولار، در طول موج 290 نانومتر سنجیده شد. فعالیت آنزیم برحسب میزان اسید سینامیک به‏ازای میلی‌گرم پروتئین در مدت یک ساعت بیان شد. محلول اسید سینامیک با غلظت 0 تا 35 میکرومولار برای رسم منحنی استاندارد مورد استفاده قرار گرفت (19).

استخراج و سنجش میزان فنل کل: ترکیبات فنلی کل براساس روش رنگ سنجی با استفاده از معرف فولین-سیوکالتیو اندازه‏گیری شد (20). ابتدا مقدار 2/0 گرم نمونه منجمد شده کالوس در سه میلی­لیتر متانول 80 درصد همگن و به‏مدت 3 ساعت در حمام آب گرم با دمای 70 درجه سانتی­گراد قرار داده شد. سپس با سرعت 9000 دور در دقیقه به‏مدت 15 دقیقه سانتریفیوژ شد و روشناور حاصل برای سنجش فنل کل مورد استفاده قرار گرفت. به 20 میکرولیتر عصاره متانولی، 100 میکرولیتر معرف فولین-سیوکالتیو اضافه شد. به مخلوط حاصل بعد از پنج دقیقه، 300 میکرولیتر محلول کربنات سدیم 5/7 درصد اضافه و به‏مدت 5/1 ساعت در تاریکی و دمای اتاق قرار داده شد. در نهایت جذب هر نمونه در طول موج 765 نانومتر به‏وسیله اسپکتروفتومتر مدل Analytik Jena ساخت کشور آلمان خوانده شد و مقدار فنل کل برحسب میلی­گرم بر گرم وزن تر محاسبه شد. غلظت­های 0 تا 500 میلی‌گرم بر لیتر اسیدگالیک به‏عنوان استاندارد مورد استفاده قرار گرفت (20).

استخراج و سنجش اسید رزمارینیک: عصاره­گیری 1/0 گرم نمونه­های خشک با استفاده از اتانول 30 درصد (v/v) و سونیکاسیون به‏مدت 10 دقیقه در حمام فراصوت انجام شد. برای سنجش میزان اسیدرزمارینیک مخلوط آزمایش شامل 200 میکرولیتر از عصاره صاف شده، سه میلی­لیتر اتانول و زیرکونیوم اکسی کلراید 2ZrOCl در غلظت نهایی 5/0 مولار بود. مخلوط حاصل به‏مدت پنج دقیقه در تاریکی نگه‏داری و سپس جذب نمونه­ها در طول موج 362 نانومتر اندازه­گیری و غلظت اسید رزمارینیک در هر نمونه، با استفاده از استاندارد اسید رزمارینیک برحسب میکروگرم بر گرم وزن خشک محاسبه شد (21).

بررسی بیان ژن­های فنیل­آلانین آمونیالیاز و رزمارینیک اسید سینتاز:استخراج RNA نمونه­ها با استفاده از کیت Column RNA isolation kit براساس دستورالعمل شرکت سازنده (دنا زیست آسیا) انجام و پس از حذف DNA ژنومی با استفاده از آنزیم DNase1، محصول شرکت Thremo Scientific، کمیت و کیفیت RNA استخراجی با استفاده از دستگاه نانودراپ و الکتروفورز در ژل آگارز تایید شد. ساخت رشته اول cDNA از 5/0 میکروگرم RNA کل با استفاده از کیتRevertAid First Strand cDNA Synthesis kit شرکت Thermo Scientific انجام و بعد از رقیق­سازی بهعنوان الگو در واکنش­های RCP emit-laeR مورد استفاده قرار گرفت.

برای بررسی کمی بیان ژن­های فنیل‏آلانین ­آمونیالیاز و رزمارینیک اسید سینتاز، از آغازگرهای اختصاصی با طول قطعه تکثیر شونده 132 جفت باز برای هر ژن استفاده شد (جدول 1). ساخت آغازگرها توسط شرکت ماکروژن کره جنوبی به‏سفارش شرکت دنا زیست آسیا صورت گرفت.

 

جدول 1: فهرست آغازگرهای اختصاصی برای واکنش‌های RT-PCR (22)

ژن

 

توالی آغازگرها

MoPAL

رفت:

برگشت:

5 GCCGAAGTCATGAACGGAAAGC 3

5 CGCAGCCTTAACATAACCGCTC 3

 

MoRAS

رفت:

برگشت:

5 ACGCCCCGACCTCAACCTTATC 3

5 AAGTGGTGCTCGTTTGCCACG 3

 

MoEF1α

رفت:

برگشت:

5 TTGCTGCTGCAACAAGATGGAC 3

5 GGGACGAATGCGATTTTGTCGG 3

 

مخلوط واکنش شامل 4 میکرولیتر cDNA رقیق شده، 25/0 میکرولیتر آغازگرهای رفت و برگشت و 10 میکرولیتر مسترمیکس سایبرگرین (RealQ Plus Master Mix Green) با حجم نهایی 20 میکرولیتر بود. دستگاه Real-time مدل 9600 plus شرکت Bioer، برای بررسی بیان ژن­­ها به‏روش Relative Quantitative PCR مورد استفاده قرار گرفت. مراحل واکنش شامل سه مرحله به‏ترتیب مرحله اول، 95 درجه سانتی‏گراد به‏مدت 15 دقیقه، مرحله دوم،40 چرخه 95 درجه سانتی‏گراد به‏مدت 15 ثانیه، 60 درجه سانتی‏گراد به‏مدت 30 ثانیه و 72 درجه سانتی‏گراد به‏مدت 25 ثانیه و مرحله سوم، منحنی ذوب از 55 تا 95 درجه سانتی‏گراد با فاصله­های افزایشی 5/0 درجه سانتی‏گراد در مدت 15 ثانیه بود. در بررسی کمی بیان ژن­های مورد نظر از αEF1 به‏عنوان شاهد داخلی استفاده شد. با استفاده از روش ΔΔCT- 2 تعداد نسخه­های تکثیر­شده برای هر ژن محاسبه شد. مقدار نسخه‏های هر ژن در هر نمونه نسبت به مقدار نسخه­های تکثیر­شده ژن کنترل داخلی در همان نمونه نرمالیزه و سپس داده‌ها در نمونه­های تیمار نسبت به شاهد کالیبره شد.

طرح آزمایش و بررسی‌های آماری: طرح آزمایش به‏صورت فاکتوریل بر پایه طرح کاملا تصادفی با سه تکرار اجرا شد. کلیه بررسی‌های بیوشیمیایی و ملکولی نیز در سه تکرار مستقل، هریک با سه تکرار تکنیکی انجام شد. از نرم افزار SAS نسخه 9 برای تجزیه آماری داده‌ها استفاده شد. با مشاهده تفاوت معنی­دار در تجزیه واریانس (ANOVA)، مقایسه میانگین­ها در سطح احتمال پنج درصد با آزمون دانکن صورت گرفت. برای تعیین میانگین، انحراف معیار و رسم نمودارها از بسته نرم­افزاری Excel استفاده شد.

 

نتایج

بررسی­های اولیه نشان داد که در گیاه بادرنجبویه ریزنمونه ساقه نسبت به ریزنمونه برگ، میزان کالوس بیش‏تری تولید کرده است (شکل 2). کالوس‌های حاصل از ریزنمونه ساقه ترد و شیری رنگ بوده لذا از آن­ها جهت بررسی‌های بعدی استفاده شد.

 

   

(الف)

(ب)

   

(ج)

(د)

شکل 2: الف) گیاهچه­های استریل بادرنجبویه پس از گذشت 30 روز از زمان کاشت بذر ب) تشکیل کالوس اولیه از ریزنمونه ساقه بعد از گذشت 7 روز ج) تشکیل کالوس­های ترد پس از واکشت چهارم از ریزنمونه ساقه د) کشت تعلیقی کالوس‌های حاصل از ریزنمونه ساقه بعد از واکشت پنجم

 

 

 

تعیین منحنی رشد سلول

پیش از اعمال تیمار، میزان رشد سلول­ها در بازه زمانی 20 روزه در کشت تعلیقی بررسی شد. نتایج نشان داد که در دو روز اول پس از کشت، میزان رشد سلول­ها کم بود به‏عبارتی سلول­ها در مرحله تاخیری رشد بودند. سپس رشد سلول­ها از روز چهارم افزایش یافته و این روند افزایشی تا روز دهم ادامه (مرحله لگاریتمی) داشت و پس از این زمان تغییری در وزن سلول­ها مشاهده نشد. به‏عبارتی از روز یازدهم به‏مدت پنج روز میزان رشد ثابت ماند. پس از مرحله سکون از میزان رشد سلول­ها به‏تدریج کاسته شد. با توجه به منحنی رشد در روز هفتم سلول­ها در مرحله لگاریتمی رشد بوده و به‏شدت در حال تقسیم بودند (شکل 3). بنابراین روز هفتم بعد از واکشت به‏عنوان زمان مناسب برای افزودن کیتوزان انتخاب شد.

 

شکل3: منحنی رشد سلولی در کشت تعلیقی بادرنجبویه در طی 20 روز کشت در محیط کشت MS

 

فعالیت آنزیم فنیل‌آلانین ‌آمونیالیاز، میزان ترکیبات فنلی، پروتئین کل و اسید رزمارینیک

نتایج تجزیه واریانس نشان داد که فعالیت آنزیم فنیل‌آلانین ‌آمونیالیاز، میزان ترکیبات فنلی کل و میزان اسید رزمارینیک تحت تاثیر اثرات اصلی کیتوزان، زمان پس از اعمال تیمار و اثر متقابل کیتوزان و زمان پس از اعمال تیمارها قرار گرفت (جدول 2)، در حالی­که میزان پروتئین کل تحت تاثیر اثرات اصلی کیتوزان و زمان پس از اعمال تیمارها قرار گرفت (جدول 2).

جدول 2: تجزیه واریانس اثرات کیتوزان و زمان بر فعالیت آنزیم فنیل­آلانین آمونیالیاز، ترکیبات فنلی، پروتئین کل و اسیدرزمارینیک در کشت تعلیقی بادرنجبویه

 

 

میانگین مربعات

منابع تغییر

درجه آزادی

فعالیت آنزیم فنیل­آلانین آمونیالیاز

ترکیبات فنلی

پروتئین کل

اسیدرزمارینیک

کیتوزان

2

** 83/3676

** 0566/0

** 43/681329

** 89/60902

زمان

2

** 24/6664

** 1645/0

** 72/431354

** 48/32732

کیتوزان×زمان

4

** 62/1361

** 0468/0

65/9452 ns

** 07/9244

اشتباه

18

36/43

0024/0

73/38335

07/168

درصد ضریب تغییرات

 

41/8

02/9

03/9

13/11

** در سطح 1 درصد معنی­دار، * در سطح 5 درصد معنی­دار،ns عدم تفاوت معنی­دار

فعالیت آنزیم فنیل­آلانین آمونیالیاز

چنان‏چه در شکل 4 نشان داده شده است استفاده از کیتوزان با غلظت­ 50 میلی‌گرم بر لیتر در زمان یک، سه و پنج روز پس از اعمال تیمارها، فعالیت آنزیم فنیل‌آلانین ‌آمونیالیاز را نسبت به شاهد به­طور معنی­داری افزایش داد. اما با افزایش غلظت کیتوزان به 100 میلی‌گرم بر لیتر تنها در زمان سه روز پس از اعمال تیمار افزایش معنی­دار فعالیت آنزیم فنیل‌آلانین‌آمونیالیاز  نسبت به شاهد مشاهده شد (شکل 3). بیش‏ترین افزایش فعالیت آنزیم فنیل‌آلانین ‌آمونیالیاز در زمان سه روز پس از اعمال تیمار کیتوزان بود، به‏گونه­ای که کیتوزان با غلظت 50 و 100 میلی‌گرم بر لیتر فعالیت آنزیم را نسبت به شاهد به‏ترتیب به‏میزان 4/2 و 9/1 برابر افزایش داد. تیمار 100 میلی‌گرم بر لیتر کیتوزان اگرچه فعالیت آنزیم را در زمان پنج روز پس از اعمال تیمار نسبت به شاهد افزایش داد اما این افزایش از لحاظ آماری تفاوت معنی­داری نشان نداد (شکل 4).

 

 

شکل 4: اثر کیتوزان و زمان پس از اعمال تیمار بر فعالیت آنزیم فنیل­آلانین آمونیالیاز در کشت تعلیقی بادرنجبویه. میانگین­هایی که دارای حداقل یک حرف مشترک هستند بر اساس آزمون دانکن در سطح احتمال 05/0p≤  اختلاف معنی­داری ندارند.

 

میزان ترکیبات فنلی

میزان ترکیبات فنلی کل با استفاده از کیتوزان در کشت تعلیقی بادرنجبویه افزایش نشان داد (شکل 5). تیمار کیتوزان با غلظت‏های 50 و 100 میلی‌گرم بر لیتر در زمان­های یک و سه روز پس از اعمال تیمار افزایش میزان فنل کل را به‏همراه داشت. در زمان یک روز پس از اعمال تیمار، غلظت­های 50 و 100 میلی‌گرم بر لیتر کیتوزان به­ترتیب 4/1 و 3/1 برابر نسبت به شاهد، ترکیبات فنلی را در کشت سلولی بادرنجبویه افزایش داد. تفاوت معنی­داری بین افزایش میزان ترکیبات فنلی در غلظت­های 50 و 100 میلی‌گرم کیتوزان، در زمان یک روز پس از اعمال تیمار در کشت تعلیقی بادرنجبویه مشاهده نشد (شکل 5)، ولی با گذشت سه روز از اعمال تیمار، کیتوزان با غلظت 50 و 100 میلی‌گرم بر لیتر به­طور معنی­داری میزان ترکیبات فنلی را به­ترتیب به‏میزان 8/1 و 4/1 برابر نسبت به شاهد افزایش داد. با گذشت زمان به‏مدت پنج روز پس از اعمال تیمارها تفاوت معنی­داری در میزان ترکیبات فنلی کل مشاهده نشد (شکل 5).

 

 

شکل 5: اثر کیتوزان و زمان بر میزان ترکیبات فنلی در کشت تعلیقی بادرنجبویه. میانگین­هایی که دارای حداقل یک حرف مشترک هستند بر اساس آزمون دانکن در سطح احتمال 05/0 p ≤  اختلاف معنی­داری ندارند.

 

میزان پروتئین کل

میزان پروتئین کل تحت تاثیر اثرات اصلی کیتوزان و زمان پس از اعمال تیمارها در سطح احتمال یک درصد (01/0p≤) قرار گرفت (جدول 2). غلظت­های 50 و 100 میلی‌گرم کیتوزان به­طور معنی­داری (در سطح احتمال 5 درصد) میزان پروتئین کل را نسبت به شاهد در کشت تعلیقی بادرنجبویه افزایش داد (شکل 6). با افزایش غلظت کیتوزان به 100 میلی‌گرم بر لیتر افزایش کمتری در میزان پروتئین کل نسبت به غلظت 50 میلی‌گرم بر لیتر آن مشاهده شد (شکل 6).

 

 

شکل 6: اثر غلظت کیتوزان بر میزان پروتئین کل در کشت تعلیقی بادرنجبویه. میانگین­هایی که دارای حداقل یک حرف مشترک هستند بر اساس آزمون دانکن در سطح احتمال 05/0p≤ اختلاف معنی­داری ندارند.

 

همان­طور که در شکل 7 مشاهده می­شود میزان پروتئین کل در طی یک و سه روز پس از اعمال تیمارها تفاوت معنی­داری را از لحاظ آماری نشان نداد. در حالی­که با افزایش زمان اعمال تیمار کیتوزان به پنج روز میزان پروتئین کل کاهش یافت (شکل 7).

 

شکل 7: اثر زمان پس از اعمال تیمار کیتوزان بر میزان پروتئین کل در کشت تعلیقی بادرنجبویه. میانگین­هایی که دارای حداقل یک حرف مشترک هستند بر اساس آزمون دانکن در سطح احتمال 05/0p≤ اختلاف معنی­داری ندارند.

 

میزان اسید رزمارینیک

غلظت­های 50 و 100 میلی­گرم بر لیتر کیتوزان در کشت تعلیقی بادرنجبویه میزان اسیدرزمارینیک را در زمان سه و پنج روز پس از اعمال تیمار به‏میزان 5/1 تا 3 برابر نسبت به شاهد افزایش داد (شکل 8). بیش‏ترین میزان اسید رزمارینیک در تیمار کیتوزان با غلظت 100 میلی­گرم بر لیتر در زمان پنج روز مشاهده شد (شکل 8). اگرچه افزایش اسید رزمارینیک یک روز پس از اعمال تیمار کیتوزان نیز مشاهده شد ولی این افزایش از لحاظ آماری (05/0p≤)معنی­دار نبود (شکل 8).

 

شکل 8: اثر کیتوزان و زمان بر میزان اسید رزمارینیک در کشت تعلیقی بادرنجبویه. میانگین­هایی که دارای حداقل یک حرف مشترک هستند براساس آزمون دانکن در سطح احتمال 05/0p≤   اختلاف معنی­داری ندارند.

 

بررسی بیان نسبی ژن ژن­های فنیل‌آلانین ‌آمونیالیاز و رزمارینیک اسید سینتاز

نتایج تجزیه واریانس نشان داد که بیان نسبی ژن­های فنیل‌آلانین ‌آمونیالیاز (PAL) و رزمارینیک اسید سینتاز (RAS) تحت تاثیر اثرات اصلی کیتوزان و زمان پس از اعمال تیمار و اثرات متقابل کیتوزان و زمان پس از اعمال تیمار قرار گرفت (جدول 3).

 

جدول 3: تجزیه واریانس اثرات کیتوزان و زمان پس از تیمار  بر بیان نسبی ژن فنیل‌آلانین ‌آمونیالیاز(PAL) و رزمارینیک اسید سینتاز (RAS)  در کشت تعلیقی بادرنجبویه

 

 

میانگین مربعات

منابع تغییر

درجه آزادی

بیان نسبی ژن فنیل‌آلانین‌آمونیالیاز

بیان نسبی ژن رزمارینیک اسید سینتاز

کیتوزان

2

** 411/1

** 952/0

زمان

2

** 152/0

** 105/1

کیتوزان×زمان

4

** 125/1

** 297/0

اشتباه

18

060/0

023/0

درصد ضریب تغییرات

 

186/27

595/11

** در سطح 1 درصد معنی­دار، * در سطح 5 درصد معنی­دار،ns عدم تفاوت معنی­دار

بیان نسبی ژن فنیل‌آلانین ‌آمونیالیاز

به­طور کلی تیمار با کیتوزان باعث افزایش بیان ژن فنیل‌آلانین ‌آمونیالیاز در کشت سلولی بادرنجبویه شد (شکل 9). با اعمال تیمار کیتوزان با غلظت 50 میلی‌گرم بر لیتر به‏مدت یک و سه روز، بیان ژن فنیل‌آلانین ‌آمونیالیاز افزایش معنی­داری را در مقایسه با شاهد نشان داد. اما با افزایش زمان اعمال تیمار، افزایش بیان ژن نسبت به شاهد مشاهده نشد (شکل 9). غلظت 100 میلی­گرم بر لیتر کیتوزان بیان ژن فنیل‌آلانین‌ آمونیالیاز را پنج روز پس از اعمال تیمار به­طور معنی­داری نسبت به شاهد افزایش داد (شکل 9).

 

شکل 9: اثر کیتوزان و زمان بر میزان بیان نسبی ژن فنیل‌آلانین ‌آمونیالیاز. میانگین­هایی که دارای حداقل یک حرف مشترک هستند بر اساس آزمون دانکن در سطح احتمال 05/0p≤ اختلاف معنی­داری ندارند.

 

بیان نسبی ژن رزمارینیک ­اسید ­سینتاز

با گذشت یک روز از اعمال تیمار کیتوزان، تغییرات مشاهده شده در بیان ژن رزمارینیک اسید سینتاز نسبت به شاهد از لحاظ آماری معنی­دار نبود (شکل 10). بیان ژن رزمارینیک اسید ­سینتاز با افزایش زمان اعمال تیمار کیتوزان در مقایسه با شاهد به­طور معنی­دار (05/0p≤)افزایش یافت. هم­چنین با افزایش غلظت کیتوزان، افزایش بیان ژن رزمارینیک اسید سینتاز نسبت به شاهد مشاهده شد. به­گونه­ای که کیتوزان با غلظت 100 میلی‌گرم بر لیتر در زمان پنج روز پس از اعمال تیمار، بیش‏ترین افزایش بیان ژن رزمارینیک اسید سینتاز را موجب شد (شکل 10).

 

 

 

شکل 10: اثر کیتوزان و زمان بر میزان بیان نسبی ژن رزمارینیک اسید سینتاز. میانگین­هایی که دارای حداقل یک حرف مشترک هستند براساس آزمون دانکن در سطح احتمال 05/ p≤ اختلاف معنی­داری ندارند.

 

بحث

روش‌های زیست­فن‏آوری با ارایه شواهد در رابطه با چگونگی مسیر بیوسنتزی و تنظیم متابولیت‌های ثانویه، برای محققان امکان دستوری هدفمند ژن­های دخیل در بیوسنتز این ترکیبات را جهت افزایش تولید متابولیت‌های ثانویه با سرعت و هزینه کمتر فراهم نموده است. در سال­های اخیر، افزایش تولید متابولیت­های ثانویه در کشت سلولی گیاهان دارویی به­وسیله محرک‏ها مورد توجه قرار گرفته است. براساس شواهد تولید اسید رزمارینیک در کشت سلولی بسیار بیش‏تر از تولید آن در گیاهان طبیعی می­باشد(2). بادرنجبویه یک گیاه مدل دارویی مناسب، جهت مطالعه در زمینه تنظیم بیوسنتز اسید رزمارینیک است. لذا، در این پژوهش تاثیر کیتوزان به­عنوان یک محرک زیستی بر مسیر بیوسنتزی اسید رزمارینیک در کشت تعلیقی آن مورد بررسی قرار گرفت.

بررسی­های اولیه نشان داد که در گیاه بادرنجبویه ریزنمونه ساقه نسبت به ریزنمونه برگ، میزان کالوس بیش‏تری تولید کرد (شکل 2). بنابراین، در بررسی­های بعدی از کالوس­های به­دست آمده از ریزنمونه ساقه استفاده شد. این نتیجه توسط نتایج پژوهش­های دیگر مورد تایید قرار گرفت (23). با توجه به نتایج به‏دست آمده فعالیت آنزیم فنیل‏‏آلانین ‌آمونیالیاز تحت تاثیر کیتوزان با غلظت 50 میلی­گرم بر لیتر در کشت تعلیقی بادرنجبویه، افزایش فعالیت این آنزیم را موجب شده است. درحالی­که غلظت 100 میلی­گرم بر لیتر در زمان سه روز بعد از اعمال تیمار افزایش نشان داده است (شکل 4). در اکثر موارد به منظور درک تاثیر محرک­ها بر دفاع گیاهی و متابولیسم ثانویه در کشت سلولی، فعالیت آنزیم فنیل‌آلانین ‌آمونیالیاز اندازه­گیری شده است (24). آنزیم فنیل‌آلانین ‌آمونیالیاز، یکی از آنزیم­های کلیدی در شروع مسیر فنیل­ پروپانوئیدی است که جریان متابولیت‏های اولیه را به کانال متابولیسم ثانویه هدایت و کنترل می­کند. به‏عبارتی این مرحله، نقطه تنظیمی مهمی بین متابولیسم اولیه و ثانویه است (25). این آنزیم با دآمیناسیون فنیل­آلانین و سنتز اسید سینامیک، پیش­ ماده مشترک برای بیوسنتز ترکیبات پلی­فنلی مانند لیگنین، فلاونوئید، آنتوسیانین­ها، سینامات و فیتوالکسین­ها را فراهم می­کند (26). نتایج تحقیقات متعددی افزایش فعالیت آنزیم فنیل­آلانین ­آمونیالیاز را تحت تیمار با محرک­ها نشان داده است (15، 27 و 28). استفاده از کیتوزان در کشت سلولی گیاه نارگیل فعالیت آنزیم فنیل‏آلانین ­آمونیالیاز را در شروع تیمار به­طور­معنی­داری افزایش داد. اگرچه این افزایش فعالیت تا روز سوم پس از افزودن کیتوزان ادامه داشت ولی فعالیت آن پس از گذشت پنج روز از آغاز تیمار کاهش نشان داد (29). هم­چنین افزایش فعالیت فنیل­آلانین­ آمونیالیاز، چهار روز پس از اعمال تیمار کیتوزان در کشت سلولی انگور مشاهده شد (30). نتایج تاثیر کیتوزان بر فعالیت آنزیم فنیل­آلانین ­آمونیالیاز نشان داد که فعالیت این آنزیم در شروع تیمار کیتوزان به‏عنوان یک سیستم محافظتی در مقابل محرک افزایش و با گذشت زمان به‏صورت خودتنظیمی از فعالیت آن کاسته شده است.

فعالیت آنزیم فنیل‌آلانین ‌آمونیالیاز، به­عنوان آنزیمی کلیدی در شروع مسیر فنیل­ پروپانوئیدی، نقش مهمی در سنتز ترکیبات فنلی به‏عهده دارد (25). نتایج تحقیقات مختلف یک ارتباط مثبت بین فعالیت آنزیم فنیل­آلانین ­آمونیالیاز و تجمع ترکیبات فنلی کل را نشان داده است. به­عبارتی قرار گرفتن در معرض محرک به افزایش تجمع ترکیبات فنلی از طریق تحریک فعالیت این آنزیم منجر می­شود (27). براساس نتایج این پژوهش افزایش در میزان ترکیبات فنلی در گیاه بادرنجبویه هماهنگ با افزایش فعالیت آنزیم فنیل­آلانین آمونیالیاز بود. به­گونه­ای که در زمان سه روز پس از اعمال تیمار کیتوزان با افزایش فعالیت آنزیم فنیل­آلانین آمونیالیاز بیش‏ترین افزایش در میزان ترکیبات فنلی مشاهده شد (شکل 5). استفاده از کیتوزان در کشت تعلیقی سیب طی سه روز پس از تیمار تولید ترکیبات فنلی را 5/1 تا 2 برابر در مقایسه با شاهد افزایش داد (31). تحریک تجمع ترکیبات فنلی به­وسیله محرک‌ها در کشت درون شیشه گونه‌های دیگر گیاهی مانند نارگیل با استفاده از کیتوزان (29)، مریم‏گلی با استفاده از عصاره مخمر (32) نیز گزارش شده است. نتایج پژوهش اسماعیل زاده و همکاران (33) در کشت تعلیقی کتان سفید افزایش ترکیبات فنلی را با تیمار کیتوزان نشان داد. استفاده از تیمار کیتوزان در گیاه گل میمونی سازویی نیز افزایش ترکیبات فنلی را موجب شد (15).

کیتوزان به­عنوان محرک زیستی خارج سلولی آنزیم­های مسیر فنیل­پروپانوئیدی و تولید متابولیت­های ثانویه را تحت تاثیر قرار می‏دهد (29 و 34). تحقیقات بسیاری نشان داده است که کاربرد کیتوزان به­عنوان محرک سلولی بیوسنتز متابولیت­های ثانویه را در گیاهان گوناگون افزایش داده است (9، 35- 38). بررسی­ها نشان داده است که غلظت محرک، برحسب گونه گیاهی نقش مهمی در تحریک و شدت پاسخ گیاه به محرک دارد (39). چنان­چه در نتایج این پژوهش نشان داده شده است استفاده از کیتوزان به‏مدت سه و پنج روز در کشت تعلیقی بادرنجبویه میزان اسید رزمارینیک را نسبت به شاهد افزایش داده است. در این راستا نتایج اسماعیل­زاده بهابادی و همکاران (33) نشان داد که بیش‏ترین میزان تجمع متابولیت­های ثانویه پودوفیلوتوکسین و لاریسی­رزینول در کشت سلولی کتان سفید، تحت تاثیر تیمار کیتوزان با غلظت 100 میلی­گرم بر لیتر، در روز پنجم پس از اعمال تیمار به‏دست آمد. استفاده از کیتوزان میزان تولید گلیکوزید فنیل اتانویید در کشت سلولی گیاه سیستان‏چه (40)، سورولین در کشت سلولی باکوچی (41)، تانن­ها در کشت سلولی فیلانتوس (42) و آرتمیزین را در کشت ریشه مویین آرتمزیا (12) افزایش داد.

نتایج این پژوهش نشان داد که تیمار کیتوزان افزایش میزان پروتئین کل را نسبت به شاهد موجب شده است. افزایش میزان پروتئین در حضور محرک­ها، با افزایش سنتز پروتئین­هایی مانند دهیدرین­ها، پروتئین­های شوک حرارتی و آنزیم­های آنتی‏اکسیدانت نسبت داده شده است (43). هم­چنین کاهش میزان پروتئین کل در زمان پنج روز پس از اعمال تیمار کیتوزان با تخریب اکسیداتیو پروتئین­ها و کاهش میزان آن­ها با افزایش تولید گونه­های فعال اکسیژن و افزایش حساسیت آن­ها را در مقابل پروتئولیزکننده داخل سلولی مانند پروتئازها و پپتیدازها مرتبط است. به‏عبارتی افزایش مدت زمان تیمار می­تواند با مرگ سلولی و تخریب پروتئین­ها کاهش میزان پروتئین­ها را موجب شود (44).

اثر محرک­ها بر ژن­های درگیر در مسیر بیوسنتزی اسید رزمارینیک به­ویژه فنیل­آلانین آمونیالیاز و رزمارینیک ­اسید­ سینتاز در گیاهان مختلف نشان داده­ شده است (45). بررسی­های بیان ژن فنیل‌آلانین ‌آمونیالیاز نشان داد که ژن فنیل‌آلانین ‌آمونیالیاز در زمان­های اولیه بعد از تیمار با کیتوزان افزایش بیان داشته است. به‏عبارتی افزایش بیان ژن و فعالیت این آنزیم به‏عنوان اولین واکنش گیاه در برابر محرک­­ها عمل می­کند. فعالیت آنزیم فنیل­آلانین آمونیالیاز تاحدی از طریق تغییرات پس­ترجمه­ای تنظیم می‏شود؛ به­گونه­ای که فسفریلاسیون، موجب غیرفعال­شدن آن می­شود (46). با افزایش زمان قرار گرفتن سلول­ها در معرض محرک کیتوزان، به‏دلیل افزایش فرآورده آنزیم فنیل‌آلانین ‌آمونیالیاز (اسید سینامیک)، کاهش فعالیت آنزیم از طریق افزایش فسفریلاسیون مشاهده شد. کاهش فعالیت آنزیم فنیل‌آلانین ‌آمونیالیاز در زمان پنج روز پس از اعمال تیمار کیتوزان، القای سریع بیان نسبی ژن فنیل­آلانین آمونیالیاز را موجب شده است. مطالعات فری و همکاران (2009) تغییر بیان ژن تعدادی از آنزیم­های اساسی درگیر در مسیر فنیل­پروپانوئیدی و پروفایل بیان پروتئین کل را بعد از تیمار با کیتوزان نشان داد. افزایش بیان ژن و پروتئین فنیل­آلانین آمونیالیاز (PAL)، افزایش تجمع متابولیت­های ثانویه در تیمار با کیتوزان را نشان داد (27). با توجه به مسیر بیوسنتزی اسید رزمارینیک در گیاه بادرنجبویه، آنزیم رزمارینیک ­اسید­ سینتاز آخرین مراحل را در این مسیر متابولیسمی کاتالیز می­کند. پژوهش‏های اولیه تجمع اسید رزمارینیک را با بیان ژن رزمارینیک اسید سینتاز در کشت سلولی بادرنجبویه مرتبط نشان دادند (3). براساس بررسی DNA ژنومی و بررسی­های ساترن بلات مشخص شد که تنها یک نسخه از ژن رزمارینیک اسید سینتاز که فاقد اینترون است در بادرنجبویه حضور دارد. بنابراین بادرنجبویه یک گیاه مدل دارویی مناسب جهت تحقیقات در زمینه تنظیم بیوسنتز اسیدرزمارینیک است (3). نتایج بررسی بیان ژن آنزیم رزمارینیک اسید ­سینتاز نشان داد بیان آن در زمان پنج روز پس از تیمار کیتوزان نسبت به شاهد حدود سه برابر افزایش یافته است. به‏عبارتی براساس ارتباط بین بیان ژن آنزیم رزمارینیک ­اسید­ سینتاز و تجمع اسید رزمارینیک، با افزایش زمان تیمار کیتوزان، میزان تولید اسیدرزمارینیک نیز افزایش نشان داده است. به‏عبارتی دیگر سنتز متابولیت ثانویه اسیدرزمارینیک پس از سنتز پیش­ماده­های لازم برای این ترکیب توسط آنزیم فنیل‌آلانین ‌آمونیالیاز صورت می­گیرد. در این راستا افزایش بیان ژن رزمارینیک ­اسید­ سینتاز به تجمع اسید رزمارینیک در گیاه آویشن منجر شد (47). هم­چنین استفاده از اسیدآبسیزیک به­عنوان یک محرک در کشت شاخه بادرنجبویه، با افزایش بیان ژن فنیل‌آلانین ‌آمونیالیاز و رزمارینیک ­اسید­ سینتاز افزایش اسید رزمارینیک را موجب شده است (48).

 

نتیجه­گیری

اهمیت اقتصادی متابولیت‌های ثانویه به‏دست آمده از گیاهان، تحقیقات را به استفاده از روش‌های زیست­فن‏آوری جهت افزایش تولید این ترکیبات سوق داده است. کشت بافت و سلول گیاهی یکی از روش‌هایی است که امروزه در زمینه بررسی متابولیت‌های گیاهی مورد توجه خاصی قرار گرفته است. علاوه بر آن استفاده از محرک­ها یکی از موثرترین روش­ها برای بهبود سنتز متابولیت‏های ثانویه در کشت سلولی گیاهان دارویی است. کیتوزان به‏عنوان یک محرک زیستی از طریق تحریک سیستم­ دفاعی گیاه و بیان برخی ژن­ها، تولید متابولیت‌های ثانویه را در گیاهان دارویی موجب شده است. کیتوزان با افزایش فعالیت آنزیم فنیل‏آلانین آمونیالیاز آنزیم کلیدی دخیل در بیوسنتز ترکیبات فنلی، افزایش ترکیبات فنلی را در زمان سه روز پس از اعمال تیمار موجب شد. در زمان پنج روز پس از اعمال تیمار کاهش فعالیت آنزیم فنیل­آلانین آمونیالیاز به کاهش میزان ترکیبات فنلی منجر شد. بررسی­های بیان نسبی ژن فنیل‌آلانین ‌آمونیالیاز در زمان­های یک و سه روز بعد از تیمار با کیتوزان با فعالیت آنزیم مربوطه هماهنگ بود. کاهش فعالیت آنزیم فنیل­آلانین آمونیالیاز در زمان پنج روز پس از اعمال تیمار کیتوزان افزایش بیان نسبی ژن فنیل­آلانین آمونیالیاز را موجب شد. افزایش بیان ژن آنزیم رزمارینیک ­اسید ­سینتاز، تجمع اسید رزمارینیک را با افزایش زمان تیمار کیتوزان نشان داد. با توجه به مسیر بیوسنتزی اسید رزمارینیک این نتیجه به‏دست می­آید که سنتز اسیدرزمارینیک پس از آماده‏سازی پیش­ماده­های لازم برای این متابولیت ثانویه توسط آنزیم فنیل‌آلانین‌ آمونیالیاز صورت می­گیرد. در نهایت، با توجه به نتایج این پژوهش، تیمار کیتوزان با غلظت 100 میلی‌گرم بر لیتر به‏مدت پنج روز با افزایش فعالیت و بیان ژن­های مرتبط با مسیر بیوسنتزی اسیدرزمارینیک می­تواند افزایش این ماده دارویی ارزشمند را موجب شود. بنابراین، استفاده از کیتوزان جهت افزایش متابولیت­های ثانویه به‏عنوان چشم­اندازی امیدوارکننده، در مطالعات زیستفناوری تایید می­شود.

 

تشکر و قدردانی

نویسندگان مراتب قدردانی خود را از معاونت محترم پژوهش و فناوری دانشگاه ولی­عصر (عج) برای حمایت­های مالی و در اختیار قرار دادن امکانات لازم جهت انجام این تحقیق اعلام می­دارند.

1. Moradkhani H, Sargsyan E, Bibak H, Naseri B, et al. Melissa officinalis L., a valuable medicine plant: A review. J Med Plant Res. 2010; 4(25): 2753-2759.
2. Petersen M, Simmonds MS. Rosmarinic acid. Phytochemistry. 2003; 62(2): 121-125.
3.Weitzel C, Petersen M. Cloning and characterisation of rosmarinic acid synthase from Melissa officinalis L. Phytochemistry. 2011; 72(7): 572-578.
4. Naderi S, Fakheri B, Esmaeilzadeh BS, Kamaladini H. Increasing of phenyl alanine ammonia lyase (PAL) gene expression and phenylpropanoid compounds of basil (Ocimum basilicum) by chitosan. Mod Genet J. 2014; 9(3): 259-266.
5. Esmaeilzadeh Bahabadi S, Sharifi M. Increasing the production of plant secondary metabolites, using biotic elicitors. J Cell and Tissue. 2013; 4(2): 119-128.
6. Halder M, Sarkar S, Jha S. Elicitation: A biotechnological tool for enhanced production of secondary metabolites in hairy root cultures. Eng Life Sci. 2019; 19(12): 880-895.
7. Orlita A, Sidwa‐Gorycka M, Paszkiewicz M, Malinski E, et al. Stepnowski P. Application of chitin and chitosan as elicitors of coumarins and furoquinolone alkaloids in Ruta graveolens L.(common rue). Biotechnol Appl Biochem. 2008; 51(2): 91-96.
8. Kauss H, Jeblick W, Domard A. The degrees of polymerization and N-acetylation of chitosan determine its ability to elicit callose formation in suspension cells and protoplasts of Catharanthus roseus. Planta. 1989; 178: 385-392.
9. Kim H-J, Chen F, Wang X, Rajapakse NC. Effect of chitosan on the biological properties of sweet basil (Ocimum basilicum L.). J Agric Food Chem. 2005; 53(9): 3696-3701.
10. Flocco CG, Giulietti AM. Effect of chitosan on peroxidase activity and isoenzyme profile in hairy root cultures of Armoracia lapathifolia. Appl Biochem Biotechnol. 2003; 110(3): 175-183.
11. Pitta-Alvarez SI, Giulietti AM. Influence of chitosan, acetic acid and citric acid on growth and tropane alkaloid production in transformed roots of Brugmansia candida Effect of medium pH and growth phase. Plant Cell, Tissue Organ Cult. 1999; 59(1): 31-38.
12. Putalun W, Luealon W, De-Eknamkul W, Tanaka H, et al. Improvement of artemisinin production by chitosan in hairy root cultures of Artemisia annua L. Biotechnol Lett. 2007; 29(7): 1143-1146.
13. Hasanloo T, Eskandari S, Najafi F. The role of chitosan on elevation of flavonolignans production in Silybum marianum hairy root culture. J Cell and Tissue. 2015; 6: 257-267.
14. Ayyobi N, Hosseini B, Fattahi M. Induction effects of colchicine and chitosan on rosmarinic acid production in hairy root cultures of zarrin-giah (Dracocephalum kotschyi Boiss). J Mol Cell Res. 2017; 30(1): 1-13.
15. Kamalipourazad M, Sharifi M, Zare Maivan H, Behmanesh M, et al. Increasing of P-coumarate 3-hydroxylase gene expression and phenylpropanoid compounds of Scrophularia striata by chitosan. J Plant Process Funct. 2017; 6: 81-90.
16. Shams Ardekani M, Amanzadeh Y, Jahanshir F, Jamshidi A. Pharmacognosical and plant tissue culture studies of Melissa officinalis L. J Med Plants. 2005; 4(13): 68-71.
17. Khan W, Prithiviraj B, Smith DL. Chitosan and chitin oligomers increase phenylalanine ammonia-lyase and tyrosine ammonia-lyase activities in soybean leaves. J Plant Physiol. 2003; 160(8): 859-863.
18. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal biochem. 1976; 72(1-2): 248-254.
19. Wang JW, Zheng LP, Wu JY, Tan RX. Involvement of nitric oxide in oxidative burst, phenylalanine ammonia-lyase activation and Taxol production induced by low-energy ultrasound in Taxus yunnanensis cell suspension cultures. Nitric Oxide. 2006; 15(4): 351-358.
20. Singleton VL, Orthofer R, Lamuela-Raventós RM. Analysis of total phenols and other oxidation substrates and antioxidants by means of folin-ciocalteu reagent. Meth Enzymol. 1999; 299: 152-178.
21. Öztürk M, Duru ME, İnce B, Harmandar M, et al. A new rapid spectrophotometric method to determine the rosmarinic acid level in plant extracts. Food Chem. 2010; 123(4): 1352-1356.
22. Döring AS, Pellegrini E, Della Batola M, Nali C, et al. How do background ozone concentrations affect the biosynthesis of rosmarinic acid in Melissa officinalis? J plant physiol.2014; 171(5): 35-41.
23. Meftahizade H, Lotfi M, Moradkhani H. Optimization of micropropagation and establishment of cell suspension culture in Melissa officinalis L. Afr J Biotechnol. 2010; 9(28): 4314-4321.
24. Zhao JL, Zhou LG, Wu JY. Effects of biotic and abiotic elicitors on cell growth and tanshinone accumulation in Salvia miltiorrhiza cell cultures. Appl Microbiol Biotechnol. 2010; 87(1): 137-144.
25. Huang J, Gu M, Lai Z, Fan B, et al. Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiol. 2010; 153(4): 1526-1538.
26. Sahu R, Gangopadhyay M, Dewanjee S. Elicitor-induced rosmarinic acid accumulation and secondary metabolism enzyme activities in Solenostemon scutellarioides. Acta Physiol Plant. 2013; 35: 1473-1481.
27. Nag S, Kumaria S. In silico characterization and transcriptional modulation of phenylalanine ammonia lyase (PAL) by abiotic stresses in the medicinal orchid Vanda coerulea Griff. ex Lindl. Phytochemistry.  2018; 156: 176-183.
28. Yu XZ, Fan WJ, Lin YJ, Zhang FF, et al. Differential expression of the PAL gene family in rice seedlings exposed to chromium by microarray analysis. Ecotoxicology. 2018; 27(3): 325-335.
29. Chakraborty M, Karun A, Mitra A. Accumulation of phenylpropanoid derivatives in chitosan-induced cell suspension culture of Cocos nucifera. J Plant Physiol. 2009; 166(1): 63-71.
30. Ferri M, Tassoni A, Franceschetti M, Righetti L, et al. Chitosan treatment induces changes of protein expression profile and stilbene distribution in Vitis vinifera cell suspensions. Proteomics. 2009; 9(3): 610-624.
31. Cai Z, Kastell A, Smetanska I. Chitosan or yeast extract enhance the accumulation of eight phenolic acids in cell suspension cultures of Malus× domestica Borkh. J Hortic Sci Biotechnol. 2014; 89(1): 93-99.
32. Chen H, Chen F. Effect of yeast elicitor on the secondary metabolism of Ti-transformed Salvia miltiorrhiza cell suspension cultures. Plant Cell Rep. 2000; 19: 710-717.
33. Esmaeilzadeh Bahabadi S, Sharifi M, Behmanesh M. Increased the genes expression of phenylpropanoid biosynthesis pathway and production of podophyllotoxin by chitosan in cell cultures of Linum album. Modares J Biotechnol. 2013; 4: 57-64.
34. Korsangruang S, Soonthornchareonnon N, Chintapakorn Y, Saralamp P, et al. Effects of abiotic and biotic elicitors on growth and isoflavonoid accumulation in Pueraria candollei var. candollei and P. candollei var. mirifica cell suspension cultures. Plant Cell, Tissue Organ Cult. 2010; 103: 333-342.
35. Mhlongo MI, Piater LA, Madala NE, Steenkamp PA, et al. Phenylpropanoid defences in Nicotiana tabacum cells: Overlapping metabolomes indicate common aspects to priming responses induced by lipopolysaccharides, chitosan and flagellin-22. PLoS One. 2016; 11(3): e0151350.
36. Cai Z, Kastell A, Mewis I, Knorr D, et al. Polysaccharide elicitors enhance anthocyanin and phenolic acid accumulation in cell suspension cultures of Vitis vinifera. Plant Cell, Tissue Organ Cult. 2012; 108(3): 401-409.
37. Udomsuk L, Jarukamjorn K, Tanaka H, Putalun W. Improved isoflavonoid production in Pueraria candollei hairy root cultures using elicitation. Biotechnol Lett. 2011; 33(2): 369-374.
38. Wiktorowska E, Długosz M, Janiszowska W. Significant enhancement of oleanolic acid accumulation by biotic elicitors in cell suspension cultures of Calendula officinalis L. Enzyme Microb Technol. 2010; 46(1): 14-20.
39. Vasconsuelo A, Boland R. Molecular aspects of the early stages of elicitation of secondary metabolites in plants. Plant Sci. 2007; 172(5): 861-875.
40. Cheng XY, Zhou HY, Cui X, Ni W, et al. Improvement of phenylethanoid glycosides biosynthesis in Cistanche deserticola cell suspension cultures by chitosan elicitor. J biotechnol. 2006; 121: 253-260.
41. Ahmed SA, Baig MMV. Biotic elicitor enhanced production of psoralen in suspension cultures of Psoralea corylifolia L. Saudi J Biol Sci. 2014; 21(5): 499-504.
42. Malayaman V, Sisubalan N, Senthilkumar R, Ranjithkumar R. Chitosan mediated enhancement of hydrolysable tannin in Phyllanthus debilis Klein ex Willd via plant cell suspension culture. Int J Biol Macromol. 2017; 104(Pt B): 1656-1663.
43. Landi S, Capasso G, Ben Azaiez FE, Jallouli S, et al. Different roles of heat shock proteins (70 kDa) during abiotic stresses in barley (Hordeum vulgare) genotypes. Plants. 2019; 8(8): 248-267.
44. Jaleel CA, Gopi R, Kishorekumar A, Manivannan P, et al. Interactive effects of triadimefon and salt stress on antioxidative status and ajmalicine accumulation in Catharanthus roseus. Acta Physiol Plant. 2008; 30(3): 287-292.
45. Trócsányi E, György Z, Zámboriné-Németh É. New insights into rosmarinic acid biosynthesis based on molecular studies. Curr. Plant Biol. 2020; 3: 100162.
46. Bolwell GP. A role for phosphorylation in the down-regulation of phenylalanine ammonia-lyase in suspension-cultured cells of french bean. Phytochemistry 1992; 31(12): 4081-4086.
47.Trócsányi E, György Z, Inotai K, Szabó K, et al. Enhanced rosmarinic acid accumulation and rosmarinic acid synthase gene expression under drought stress in thyme (Thymus vulgaris). Planta Med. 2015; 81(16): PM_246.
48. Mousavi S, Shabani L. Rosmarinic acid accumulation in Melissa officinalis shoot cultures is mediated by ABA. Biol Plant. 2019; 63: 418-424.