بررسی اثرات ضد سرطانی نانوذرات نقره با پوشش کورمین بر سلول‏های سرطانی تخمدان A2780

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشجوی دکتری تخصصی زیست شناسی تکوین جانوری، دانشگاه خوارزمی، دانشکده علوم زیستی، گروه زیست شناسی، تهران، ایران

2 دانشگاه خوارزمی، دانشکده علوم زیستی، گروه زیست شناسی، تهران، ایران

3 دانشگاه آزاد اسلامی واحد مشهد، گروه زیست شناسی و مرکز تحقیقات بیولوژی کاربردی تکوین جانوری، مشهد، ایران

چکیده

هدف: در مطالعه حاضر اثر، نانوذرات نقره پوشش دار شده با کورکومین بر القای مرگ سلولی  بر رده سلول‏های سرطان تخمدان A2780 بررسی شده است.
مواد و روش‏ها: در این مطالعه تجربی آزمایشگاهی سنتز سبز نانو ذرات نقره با استفاده ازکورکومین انجام شد. سپس سلول‏های رده A2780 با غلظت‏های مختلف نانو ذرات نقره تیمار شدند. اثرات سمی نانو ذرات نقره با روش MTT و اثرات آپوپتوزیس این نانو ذرات با روش‏های رنگ آمیزی DAPI و اکردین اورنج-ﭘﺮوﭘوﺪﻳﻮم یداید و اندازه گیری فعالیت کاسپاز 3 و 9 بررسی شد. تغییرات بیان ژن‏های Bax  وBcl-2 با روش Real Time PCR آنالیز شد.
نتایج: نتایج نشان داد این نانو ذرات باعث مهار تکثیر سلول‏های A2780 به‏طور وابسته به غلظت شده‏اند، غلظت 8 میکروگرم بر میلی‏لیتر منجر به مرگ پنجاه درصد سلول‏ها در 24 ساعت شد. نتایج رنگ آمیزی DAPI و اکردین اورنج-ﭘﺮوﭘودﻳﻮم ﻳﺪاﻳﺪ نشان دهنده افزایش درصد سلول‏های آپوپتوزیس در گروه‏های تیماری بود. مطابق نتایج حاصل از Real Time PCR بیان ژنBax  در سلول تحت تیمار افزایش در حالی‏که بیان ژن Bcl-2 در این سلول‏ها کاهش نشان داد.
نتیجه گیری: نانوذرات نقره پوشش دار شده با کورکومین باعث القای آپوپتوزیس در سلول‏های سرطانی A2780 می‏شود و استفاده از این نانو ذرات می‏تواند به‏عنوان استراتژی امیدوارکننده در درمان سرطان تخمدان مورد توجه قرار گیرد.

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

با وجود پیشرفت‏های فراوان در زمینه کنترل و درمان بیماری‏ها‏، مسئله سرطان هنوز یکی ازچالش‏های جهانی در زمینه سلامت انسان ها باقی مانده است. معمول‏ترین روش برای درمان سرطان‏ها شیمی درمانی می‏باشد. نکته مهم در درمان سرطان با روش‏های  شیمی درمانی، مقاومت اکتسابی تومور به داروهای است و این مسئله مشکلات عمده ای را برای درمان سرطان به‏وجود آورده است. از آنجا که میزان جهش و ناپایداری ژنتیکی در سلول‏های سرطانی بسیار بالاست و تغییرات ژنی به‏سرعت در آن‏ها انجام می‏گیرد، این سلول‏ها نسبت به دارو‏ها مقاومت پیدا می‏کنند. بنابراین پژوهش بیشتر در زمینه کشف استراتژی‏های درمانی نوین برای غلبه بر مقاومت دارویی سرطان‏ها ضروری به‏نظر می رسد (1). در این میان نانو تکنولوژی زمینه امیدوار کننده‏ای درحیطه درمان سرطان به‏وجود آورده است. در سال‏های اخیر اثرات ضد سرطانی و ضد رگ‏زایی نانو ذرات نقره مورد توجه قرار گرفته است و نتایج نشان داده است که نانو ذرات نقره می‏تواند به‏عنوان عامل بالقوه ضد سرطانی محسوب گردد (2 و 3). اما حلال‏های آلی مورد استفاده  برای تولید  این نانو ذرات سمی هستند و می‏توانند اثرات زیست محیطی مخربی داشته باشند. از این‏رو تمایل زیادی برای استفاده از روش‏های سالم برای سنتز نانو ذرات نقره وجود دارد (4). اخیرا مطالعات تحت عنوان شیمی سبز آغاز شده  است که به جستجوی روش سازگار با محیط زیست برای سنتز نانو ذرات می‏پردازد. در سال‏های اخیر، نانو ذرات نقره به‏روش خارج سلولی و با استفاده از عصاره‏های مختلف گیاهی و میکروبی سنتز گردیده است. به‏عنوان نمونه نانو ذرات نقره با  استفاده از عصاره‏های گیاهانی مانند زیتون، بومادران و آلوورا با موفقیت سنتز شده است (5‌، 6 و 7). به‏علاوه مطالعات زیادی در زمینه بررسی خواص ضد باکتری‏، آنتی اکسیدانت و فعالیت‏های ضد تومور این محصولات طبیعی در جریان است. در این راستا Sathish و همکاران اثرات آنتی باکتریایی نانو ذرات نقره، سنتز شده با روش زیستی را بررسی نمودند (8). همچنین Reddy و همکاران اثرات آنتی اکسیدانتی، آنتی باکتریال وضد سرطانی نانوذرات نقره تولید شده با استفاده از عصاره گیاه Piper longum را بررسی نمودند (9). کورکومین یکی از پلی فنل‏های غذایی شناخته شده است که از ریزوم گیاه زرد چوبه (Curcuma longa) به‏دست می‏آید. این پودر زرد رنگ سال‏ها در طب سنتی برای درمان آکنه، پسوریازیس، آماس پوست استفاده می‏شود. اثرات ضد التهابی، آنتی اکسیدانتی و ضد میکروبی کورکومین به‏خوبی شناخته شده است. همچنین این ماده مجموعه ای از اهداف مولکولی و مسیرهای سیگنالینگ، مانند: NF-JB، AKT / mTOR و HIF-1A  را تحت تاثیر قرار می‏دهد و در نتیجه در مهار تکثیر سلول‏های سرطانی، متاستاز، رگ‏زایی و هم چنین القای آپوپتوزیس نیز نقش ایفا می‏کند (10). بنابراین دراین تحقیق جهت افزایش اثر گذاری نانو ذرات نقره، هم‏چنین افزایش دسترسی زیستی کورکومین از این ماده به‏عنوان کاهنده و پایدارکننده نانو ذرات نقره استفاده شد. سپس اثرات ضد سرطانی آن بر سلول‏های سرطان تخمدان A278 مورد بررسی قرار گرفت.

مواد و روش ها

این مطالعه تجربی- آزمایشگاهی در سال 95-94 در مرکز تحقیقات بیولوژی کاربردی- تکوین جانوری وابسته به دانشگاه آزاد اسلامی، واحد مشهد انجام شد.

سنتز زیستی نانو ذرات نقره و شناسایی آن: تولید نانوذرات نقره با روش زیستی: محلول 5/0 مولار نیترات نقره (Merck, Germany) در آب با حجم 1000 میلی‏لیتر تهیه شد و میزان 1 میلی‏لیتر کورکومین ( (Sigma, Uk با غلظت 10 میلی مولاری در DMSO  در دمای اتاق و
2/7 pH= به آن اضافه شد. تغییر رنگ محلول از بی‏رنگ به قهوه‏ای نشان دهنده آغاز تشکیل نانو ذرات در نظر گرفته شد.

 طیف سنجی نور مرئی- فرابنفش:  برای ثبت طیف جذبی نانو ذرات نقره با پوشش کورکومین در ناحیه نور مرئی- فرابنفش، 100 میکرولیتر از نمونه را در یک پلیت 96 قرار داده شد و جذب نمونه‏ها در دامنه 400 تا 700 نانومتر با دستگاه اسپکتروفتومتر (Biotek, US)  اندازه‏گیری شد. همچنین برای شناسایی شکل و ابعاد نانو ذرات تولید شده از میکروسکوپ الکترونی گذاره (Hitachi, Japan) استفاده شد. این مشاهدات با قرار دادن یک قطره از نمونه بر گرید مس پوشش داده شده با یک فیلم کربن، انجام گرفت (11).

طیف سنجی نور پویا (Dynamic light scattering (DLS)): اندازه متوسط نانو ذرات با استفاده از دستگاه DLS (Cordovan, Vaso particle, France)  تعیین شد. بر پایه نتایج طیف سنجی نور مرئی- فرابنفش بهترین نمونه برای آنالیز DLS انتخاب شد. این بررسی در شرایط دمای 25 درجه سانتی‏گراد، با استفاده از زاویه ثابت 90 درجه و در طول موج 657 نانومتر انجام شد.

طیف مادون قرمز برای نانو ذرات نقره با پوشش کورکومین و کورکومین تجاری به تنهایی با استفاده از دستگاه (Perkin Elmer, US) انجام گرفت. قبل از انجام آنالیز به‏منظور حذف هر گونه باقی مانده کورکومین آزاد بدون اتصال به نانو ذرات، نانو ذرات نقره 3 بار با آب مقطر شسته و محصول در 12000 دور بر دقیقه به‏مدت 15 دقیقه سانتریفوژ شد و سپس با دستگاه انجماد خشک پودر شدند. نانو ذرات نقره با پوشش کورکومین با پودر KBr (Merck, Germany) مخلوط و طیف مادون قرمز در محدوده 4000 تا 400 نانومتر به دست آمد ثبت شد (11).

 بررسی اثرات ضد سرطانی نانو ذرات نقره با پوشش کورکومین: رده سلولی سرطان تخمدان A2780 از انیسیتوپاستور تهران تهیه و با محیط  کشتRMPI1640  ((Sigma, UK حاوی سرم جنین گاوی 10 درصد ( (Sigma, Uk و یک واحد پنیسیلین –استرپتومایسین (Sigma, (UK در انکوباتور 37 درجه سانتی‏گراد نگه‏داری شدند.

سنجش سمیت نانوذراتنقره با روشآزمون  (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) : تعداد 104 ×5 سلولدر چاهک پلیت  96 خانه کشت داده شد  پس از گذشت 24 ساعت با غلظت‏های 4،1 ، 8، 12،  25 و 50 میکروگرم  بر میلی‏لیتر از نانو ذرات نقره تیمار شدند. سلول‏های تیمار شده به‏مدت 24 ساعت در انکوباتور قرار گرفت. پس از این مدت به هر پلیت 20 میکرولیتر رنگ MTT )5 میلی‏گرم بر میلی‏لیتر) (Merck, Germany) اضافه شد و به‏مدت 3 ساعت دیگر انکوبه شدند. سپس به هر چاهک 100 میکرولیتر DMSO  اضافه شد تا بلورهای فورمازان حاصل حل شد. جذب نوری توسط دستگاه میکرواسپکتوفتومتر (Biotek, US) در 570 نانومتر ثبت شد. تمامی مراحل آزمایش 3 بار تکرار و درصد سلول های زنده از فرمول زیر محاسبه شد.

100× (میانگین جذب نمونه کنترل/میانگین جذب نمونه تیمار) = درصد زنده های سلول

بررسی مورفولوژیک تغییرات سلول‏های تحت تیمار با رنگ آمیزی آکریدین اورنج/ پروپودیوم یداید:برای این رنگ آمیزی، سلول‏های سرطانی در پلیت‏های 6 خانه کشت داده شدند و با غلظت 8 میکروگرم برمیلی‏لیتر نانوذرات نقره تیمار شدند. پس از گذشت 24 ساعت سلول‏ها با تریپسین از چاهک‏ها جدا و سانتریفیوژ شدند سپس با 10 میکروگرم محلول آکردین اورنج و 10 میکروگرم پروپودیوم یداید(Merck, Germany) به سلول‏ها اضافه شد. پس از گذشت 3 تا 5 دقیقه 100 میکرو لیتراز محلول سلولی بر داشته و بر روی اسلاید قرار داده شد و با میکروسکوپ فلوئوروسانس (Biomed, Korea) آنالیز شد. در هربار مشاهده حداقل 100 سلول شمارش و درصد سلول‏ها ی آپوپتوتیک با استفاده از فرمول زیر محاسبه شد.

100×تعداد کل سلول‏های آپوپتوزیس و نرمال /تعداد کل سلول‏های آپوپتوزیس = درصد سلول‏های آپوپتوزیس

بررسی تغییرات مورفولوژی هسته در سلول‏های تیمار‏ی با رنگ آمیزی هسته‏ای  DAPI: برای بررسی اثرات نانو ذره نقره سنتز شده با کورکومین بر روی هسته سلول‏های سرطان تخمدانA2780  از رنگ آمیزی DAPI ((Sigma, UK استفاده شد. سلول‏ها بعد از کشت بر روی لامل‏های کوت شده با کلاژن در پلیت 6 خانه کشت داده شدند و با غلظت 8 میکروگرم بر میلی لیتر نانو ذرات نقره به‏مدت 24 ساعت تیمار شدند. سپس با پارا فرم آلدئید 4 درصد به‏مدت 15 دقیقه در دمای اتاق فیکس شد و به‏مدت 10 دقیقه در دمای اتاق تحت اثر رنگ DAPI قرار داده شدند در نهایت پس از شستشو با میکروسکوپ فلورسانس  (Biomed, Korea) بررسی شدند.

تعیین مسیر آپوپتوزیس با استفاده از کیت کاسپاز 3 و 9:سلول‏های A2780 در2 فلاسک کشت سلول متوسط کشت داده شدند. سپس با نانو ذرات نقره سنتز شده با کورکومین با غلظت 8 میکروگرم بر میلی‏لیتر  تیمار و به‏مدت 24 ساعت انکوبه شدند. سپس سلول‏ها تریپسینه و سانتریفوژ شدند و پس از آن محتوی پروتئین سلول‏ها استخراج شد. غلظت پروتئینی باروش بردفورد اندازه‏گیری شد. سپس50 میکروگرم پروتئین از هر نمونه جدا و بر اساس پروتوکل کیت کاسپاز 3 و9 (Abcam, Germany) فعالیت کاسپاز 3 و 9 انداره‏گیری شد. تمامی مراحل ازمایش 3 بار تکرار شد.

بررسی تغییرات بیان ژن‏هایBax و Bcl-2: سلول‏های A2780 در2 فلاسک کشت سلول متوسط کشت داده شدند و با نانو ذره نقره سنتز شده با کورکومین با غلظت 8 میکروگرم برمیلی لیتر  تیمار و به‏مدت 24 ساعت انکوبه شدند. سپس سلول‏ها تریپسین و سانتریفوژ شدند. برای استخراج‏، RNA با توجه به پروتکل کیت(Roche, Germany)  لیز سلول‏ها انجام شد. بعد از لیز شدن کامل سلول‏ها، استخراج به‏کمک کلروفرم و ایزوپروپانل انجام گرفت تا رسوب RNA به‏دست آید. در نهایت پس از شستشو با اتانول 75 درصد، RNA حاصل در آب حل شد. برای تهیه cDNA بر اساس پروتکل شرکت (Thermo, Germany)، 10میکرولیتر از محلول RNA را در65 درجه سانتی‏گراد به‏مدت  5 تا 10 دقیقه انکوبه شد سپس  بافر PCR به آن اضافه شد. محلول حاصله را 10 دقیقه در 25 درجه سانتی‏گراد قرار داده و سپس به‏مدت یک ساعت در 42 درجه سانتی‏گراد انکوبه شد برای توقف واکنش، نمونه در دمای 70 درجه سانتی‏گراد به‏مدت 10 دقیقه قرار گرفت. جهت انجام مراحل PCR کیفی از پرایمرهای اختصاصی (جدول1) و مسترمیکس حاوی رنگ سایبرگرین(Pars tous, Iran)  استفاده شد. چرخه PCR  40 مرحله و توسط دستگاه Real Time PCR (Bio rad, US)    انجام شد.

 

جدول 1: توالی پرایمر‏های مورد استفاده

Genes

Sequence

BCL-2F

CATGTGTGTGGAGAGCGTCAAC

BCL-2R

CAGATAGGCACCCAGGGTGAT

BAXF

TTTGCTTCAGGGTTTCATCCA

BAXR

CTCCATGTTACTGTCCAGTTCGT

GAPDHF

TGAAGGTCGGTGTGAACGGATTTGGC

GAPDHR

CATGTAGGCCATGAGGTCCACCAC

 

آنالیز آماری: جهت مشخص نمودن اختلاف بین گروه‎ها از آزمون واریانس یک‏طرفه و تست Tukey استفاده شد. نتایج توسط نرم افزار SPSS 16 آنالیز و نمودارها با نرم افزار Excell ترسیم شدند.

نتایج

سنتز نانو ذرات نقره  با پوشش کورکومین و تعیین مشخصات آن

 سنتز نانوذرات نقره درحضور کورکومین در زمان 24 ساعت صورت گرفت. اندازه متوسط این نانو ذرات در حدود 2 ± 40 بود و ماکریمم جذب نوری در 450 نانومتر مشخص شد. مطالعات طیف سنجی نور مادون قرمز نشان داد که نمودارهای حاصل از کورکومین تجاری  و نانو ذرات الگوی یکسانی را در پیک‏های جذبی در ناحیه 400 تا 4000 دارند. این موضوع نشان می‏دهد که کورکومین سطح نانوذرات نقره را پوشش داده است (شکل1، ب و ج).

 

 نتایج حاصل از سنجش سمیت نانو ذرات نقره با روش آزمون MTT

  نانوذرات نفره تا غلظت 1 میکروگرم بر میلی لیتر فاقد هر گونه اثر معنی‏داری در زیست پذیری سلول‏ها بودند، در حالی‏که در غلظت‏های 4 میکروگرم بر میلی‏لیتر سطح معنی‏داری بین کنترل و نمونه‏های تیمار افزایش می‏یابد  و غلظت 8 میکروگرم بر میلی‏لیتر 50 درصد سلول‏ها (IC50) دچار مرگ سلولی شده اند و از نظر زیست شناسی می‏توان عنوان کرد که در غلظت‏های  زیر 1 مهار تکثیر سلول‏ها رخ می‏دهد و غلظت‏های بیشتر منجر به مرگ سلول‏ها می‏شود. در حالی‏که در غلظت 50 میکروگرم بر میلی لیتر لیز سلولی در اکثر سلول‏ها نشان می‏دهد (شکل 2).

 

 

 

 

 

پ

شکل 1: الف) میکروسکوپ الکترونی گذاره از نانوذرات نقره سنتز شده به روش سبز، ب) میزان جذب نوری را برای نمونه‏های نانو ذرات سنتز شده با کورکومین که نشان دهنده حداکثر جذب نانو ذرات در 450 نانومتر می‏باشد، پ) نمودار توزیع  نانوذره از نظر اندازه با توجه به آنالیز سایز نانوذرات نقره با دستگاه DLS  ، ج) نتایج حاصل از طیف مادون قرمز از کورکومین (1) ونانو ذرات سنتز شده (2)  این دو طیف  بسیار به یکدیگر شباهت دارند که نشان  می‏دهد کورکومین  برسطح  نانوذرات  نقره اتصال یافته‏اند.

 

 

شکل 2: درصد زیست پذیری سلول‏های A2780  را در حضور غلظت‏های مختلف نانوذرات نقره  نشان می‏دهد  (Mean±S.D  001/0< ***p ، 01/0**p< ).

 

 

 

 

بررسی مورفولوژیک تغییرات سلول‏های تیمار شده با نانو ذرات نقره  با رنگ آمیزی آکریدین اورنج/ پروپودیوم یداید

 در رنگ آمیزی اکردین اورنج سلول‏های زنده به رنگ سبز دیده می‏شود. در حالی‏که سلول‏هایی که در مرحله آپوپتوزیس قرار دارند نارنجی رنگ مشاهده می‏شوند. در گروه‏های  تحت تیمار با نانوذرات درصد سلول‏ها با رنگ نارنجی افزایش چشم‏گیری در مقایسه با کنترل داشتند. شمارش سلول‏های زنده در مقابل سلول‏های آپوپتوزیس  نشان داد که  درصد سلول‏های آپوپتوزیس درگروه تیمار درحدود 56 درصد بود، درحالی‏که این درصد در گروه کنترل کمتر از 2 درصد کل سلول‏‏ها بود (شکل 3). 

 

پ

الف

ب

شکل 3: الف) شکل حاصل از رنگ آمیزی آکردین اورنج/ پروپودیوم یداید. در گروه کنترل بیشتر سلول‏ها سبز رنگ می‏باشند و در خالت نرمال قرار دارند، ب) (در حالی‏که درگروه تیماری  بیشتر سلول‏ها به‏رنگ نارنجی ‏هستند و در مراحله آپوپتوریس قرار دارند، پ) شمارش تعداد سلول‏ها‏ی زنده و آپوپتوریس در گروه کنترل و تیمار نشان داد که درصد سلول‏های آپوپتوزیس درگروه تیمار نسبت به گروه کنترل افرایش داشته است، (بزرگنمایی×400).

 

 

 

بررسی تغییرات مورفولوژی هسته با رنگ آمیزی هسته‏ای  DAPI

 سلول‏های که تحت تیمار با 8 میکروگرم بر میلی لیتر نانوذرات نقره بودند بعد از 24 ساعت دارای کروماتین فشرده و یا قطعه قطعه می‏باشند. این تغییرات که از خصوصیات سلول‏های آپوپتوزیس می‏باشد نشان دهنده آغاز روند مرگ سلول‏ها در گروه تیماری  می‏باشد (‏شکل 4).

 

 

 

شکل 4: الف) شکل حاصل از رنگ آمیزیDAPI، گروه کنترل با هسته، ب) گروه تیمار با نانو ذرات نقره که کروماتین قطعه قطعه شده در آن نمایان می باشد. (بزرگنمایی×400).

 

تعیین مسیر آپوپتوزیس با استفاده از کیت کاسپاز 3 و 9

 خانواده آنزیمی کاسپاز از واسطه‏های اصلی آپوپتوزیس هستند و در طی روند آپوپتوزیس فعالیت آن‏ها افرایش می‏بابد. نتایج  بررسی فعالیت کاسپاز نشان داد که فعالیت کاسپاز 3 و 9 در گروه تیمار شده با 8 میکرو گرم بر میلی‏لیتر نسبت به گروه تیمارنشده افزایش یافته است‏. بنا براین می‏توان گفت که نانوذرات نقره منجر به آغاز روند مرگ سلولی در سلول‏های A278  از  مسیر وابسته به کاسپاز شده است (شکل5 ).

 

 

شکل 5: مقایسه فعالیت کاسپار 3 و 9 در گروه تیمار با نانو ذرات نقره و کنترل. فعالیت این آنزیم در گروه‏های تیماری نسبت به کنترل  افزایش معنی‏‏داری داشته است (Mean±S.D،  001/0p<  ***).

 

 

بررسی تغییرات بیان ژنهای Bax و Bcl-2 :  در این جهت مطالعه تغییرات بیان ژن‏های آپوپتوزیس در سلول‏های تیمار و کنترل از روش PCR کمی استفاده شد. نتایج نشان داد که بیان ژن پرو آپوپتوتیک Bax  درگروه تیمار نسبت به کنترل افزایش یافته است، در حالی‏که  بیان ژن آنتی آپوپتتوتیک  Bcl-2  نسبت  به کنترل کاهش یافته است (شکل 6).

 

 

شکل 6: تغییرات بیان ژن‏های Bax  و Bcl-2 در گروه تیمار با نانو ذرات نقره و گروه کنترل. نتایج نشان داد که بیان ژن Bax اقرایش و بیان ژن Bcl-2 نسبت به کنترل به‏صورت معنی‏داری کاهش یافته است. (Mean±S.D، 001/0p< ***).

 

 

بحث

استفاده از ترکیبات طبیعی برای تولید نانو ذرات رویکرد جدیدی است که توجهات زیادی را به‏خصوص برای تولید نانو ذرات فلزی جلب نموده است تا‏کنون گزارش‏های زیادی مبنی بر استفاده از عصاره‏های گیاهی، قارچی و باکتریایی برای تولید نانو ذرات فلزی از جمله نانو ذرات نقره منتشر شده است. به‏عنوان مثال بهارآرا و همکاران (12) از عصاره گیاه مریم گلی برای سنتز نانو ذرات نقره استفاده نمودند. هم‏چنین در مطالعه دیگری از برگ‏های زیتون برای سنتز نانو ذرات نقره استفاده نمودند (13). در این پژوهش تجربی نیز، نانو ذرات نقره با استفاده از کورکومین خالص تهیه شد. کورکومین ترکیب فنولی است که توانایی احیا یون‏های نقره به نانو ذرات نقره را دارد. هم‏چنین کورکومین به­عنوان عامل پوشش دهنده و پایدار کننده نانو ذرات نقره عمل نیز می­کند. سپس اثرات نانو ذرات نقره تولید شده با روش سبز بر القای آپوپتوزیس در سلول­های سرطانی رده A2780 مورد بررسی قرار گرفت. نتایج حاصل از بررسی سمیت سلولی  نشان داد که این نانو ذرات می­توانند به­صورت وابسته به غلظت‏، منجر به کاهش زیست پذیری سلول­ها شوند. با محاسبه IC50  مشخص شد که غلظت 8 میکروگرم بر میلی لیتر در 24 ساعت منجر به مرگ 50 درصد از سلول­ها شده است. در این زمینه بهارآرا و همکاران (6) نانو ذرات نقره را با استفاده از عصاره گیاه بومادران زرد تولید نمودند  و سپس اثرات سمی آن بر رده سلولی سرطانی MCF-7 مورد بررسی قرار دادند. نتایج مطالعات این گروه نشان داد که نانو ذرات نقره با پوشش گیاهی قادر به مهار تکثیر سلولی سرطانی سینه به‏صورت وابسته به دوز بودند. IC50 گزارش شده توسط این گروه برابر با 20 میکروگرم بر میلی لیتر در 24 ساعت بود که این عدد از IC50   (8 میکروگرم بر میلی لیتر) گزارش شده در تحقیق حاضر بیشتر بود که می‏تواند  به‏علت قرار گرفتن کورکومین بر سطح نانو ذرات و در نتیجه افزایش اثر گذاری نانو ذرات باشد. همان‏طور که قبلا اشاره شد، کورکومین دارای اثرات ضد سرطانی قوی می‏باشد و قرار گیری آن بر سطح نانو ذرات می‏تواند علت افزایش اثر گذاری آن‏ها قلمداد شود. این فرضیه نیاز به بررسی‏های بیشتر دارد‏.  با توجه به این موضوع که آپوپتوزیس یا مرگ برنامه ریزی شده سلولی روند مهمی در جهت کنترل تکثیر سلول­ها، حفظ هوموستاز طبیعی بدن و از بین بردن سلول­های مضر و سرطانی می­باشد (14). در مرحله بعد توانایی ایجاد آپوپتوزیس در سلول­های سرطانی رده A2780 توسط غلظت IC50 از نانوذرات نقره بررسی شد. تغییرات ظاهری هسته و  ایجاد شکست در کروماتین سلول یکی از نشانه‏های بارز آغاز روند مرگ سلولی است. در این پژوهش تغییرات مورفولوژیک هسته، در سلول‏های تیمار شده با نانو ذرات نقره با پوشش کورکومین با رنگ آمیزی هسته‏ای DAPI بررسی شد. نتایج نشان داد که در سلول‏های تیماری تغییرات هسته‏ای از جمله فشرده شدن کروماتین و  قطعه قطعه شدن آن نسبت به گروه کنترل افزایش یافت. هم­چنین در این مطالعه برای تعیین نوع مرگ سلولی القا شده توسط نانوذرات نقره از روش رنگ­آمیزی اکریدین اورنج- پروپودیوم یداید استفاده شد. نتایج نشان داد که در سلول‏ها تیمار شده با نانوذرات نقره تعداد سلول‏های آپوپتوزیس افزایش یافت. از مجموعه بررسی‏های مورفولوژی با رنگ امیزی DAPI و اکریدین اورنج/ پروپودیوم یداید می‏توان دریافت که نانو ذرات نقره با پوشش کورکومین منجر به فعال شدن روند آپوپتوزیس در سلول‏های A2780 می‏شوند (15). هم‏چنین کاسپاز‏ها از واسطه‏های مهم در فرآیند آپوپتوزیس هستند. در طی فرآیند مرگ سلولی برنامه ریزی شده ابتدا در اثر محرک آپوپتوزیس کاسپاز 3 فعال می‏شود سپس این کاسپاز با شکست‏های پروتئولیتیک منجر به فعال شدن کاسپاز 8 و 9 می‏شود که این کاسپاز‏ها مسئول آغاز فعالیت مولکول‏های افکتور دیگر برای پیشرفت روند آپوپتوزیس هستند. در این تحقیق نشان داده شد که تیمار سلول‏های سرطانی A2780 با نانو ذرات تقره پوشش‏دار با کورکومین  منجر به افزایش فعالیت کاسپاز 3 و 9 می‏شوند. در مطالعات گذشته نیز اثرات آپوپتوزیس نانو ذرات نقره تولید شده با روش زیستی بر رده‏های سلولی مختلف بررسی شده است به عنوان مثال اثرات نانو ذرات تقره سنتز شده با عصاره گیاهAlbizia adianthifolia بر سلول‏های سرطانی ریه بررسی شد. نتایج این مطالعات نشان داد که نانوذرات نقره موجب مهار تکثیر و افزایش میزان آپوپتوزیس در سلول‏های سرطانی ریه می‏شود. این نانو ذرات از طریق مسیر درونی (میتوکندری) مرگ برنامه ریزی شده سلولی را آغاز می‏کنند (15). هم‏چنین حکمت و همکاران (16) اثرات نانو ذرات نقره در القای آپوپتوزیس در رده سلول‏های T-47D و MCF-7 را بررسی و گزارش نمودند که نانو ذرات نقره منجر به افزایش تراکم هسته و شکست کروموزومی در هسته‏های سلول‏های تیماری می‏شوند.   Jeyaraj و همکاران (4) اثرات نانو ذرات نقره سنتز شده با واسطه عصاره گیاهPodophyllum hexandrum  را بر روند آپوپتوزیس در سلول‏های سرطانی دهانه رحم بررسی نمودند و نتایج تحقیقات این گروه نشان داد که این نانو ذرات منجر به القای مرگ سلولی در سلول‏های مذکور به‏صورت وابسته به کاسپاز می‏شوند. این یافته‏ها با نتایج تحقیق حاضر هم‏سو می‏باشد. هم‏چنین در این مطالعه جهت بررسی مسیر مولکولی وابسته به مرگ سلولی تغییرات بیان ژن‏های آپوپتوزیس Bax و Bcl-2  مورد بررسی قرار گرفت. نتایج نشان داد که بیان ژن پرو آپوپتوزیس Bax در سلول‏های تیماری افزایش یافت. در حالی‏که بیان ژن آنتی آپوپتوزیس Bcl-2  کاهش یافت. در تحقیقی مشابه نیز نشان داده شد که نانو ذرات نقره سنتز شده با روش سبز منجر به مهار ژن‏های Bcl-2 و افزایش بیان ژن Bax می‏شود (6). این نتایج هم‏سو با یافته‏های پژوهش حاضر می‏باشد.

نتیجه گیری

نتایج حاصل از این تحقیق نشان داد که نانوذرات نقره پوشش دار شده با کورکومین منجر به مهار تکثیر و القای  آپوپتوزیس از مسیر وابسته به کاسپاز در سلول‏های A2780 می‏شود.

تشکر و قدردانی

از همکاران مرکز تحقیقات بیولوژی کاربردی- تکوین جانوری دانشگاه آزاد اسلامی واحد مشهد، صمیمانه سپاسگزاری می‏شود.

1.             Baharara J, Hosseini N, Farzin TR. Extremely low frequency electromagnetic field sensitizes cisplatin-resistant human ovarian adenocarcinoma cells via P53 activation. Cytotechnology; 2015; 68(4):1403-13.

2.             Castiglioni S, Caspani C, Cazzaniga A, Maier JA. Short- and long-term effects of silver nanoparticles on human microvascular endothelial cells. World journal of biological chemistry. 2014; 5(4): 457–64.

3.             Satapathy S, Mohapatra P, Preet R, Das D, et al. Silver-based nanoparticles induce apoptosis in human colon cancer cells mediated through p53. Nanomedicine. 2013; 8(8): 1307–22.

4.             Jeyaraj M, Sathishkumar G, Sivanandhan G, MubarakAli D, et al. Biogenic silver nanoparticles for cancer treatment: an experimental report. Colloids and surfaces B, Biointerfaces. 2013; 106: 86–92.

5.             Khalil MMH, Ismail EH, El-Magdoub F. Biosynthesis of Au nanoparticles using olive leaf extract. Arabian Journal of Chemistry. 2012; 5(4): 431–7.

6.             Baharara J, Namvar F, Ramezani T, Mousavi M, et al. Silver nanoparticles biosynthesized using Achillea biebersteinii flower extract: apoptosis induction in MCF-7 cells via caspase activation and regulation of Bax and Bcl-2 gene expression. Molecules (Basel, Switzerland). 2015; 20(2): 2693–706.

7.             Medda S, Hajra A, Dey U, Bose P, et al. Biosynthesis of silver nanoparticles from Aloe vera leaf extract and antifungal activity against Rhizopus sp. and Aspergillus sp. Applied Nanoscience [Internet]. Springer Berlin Heidelberg; 2015; 5(7): 875–80.

8.             Sathish M, Kumar M, Sneh K, Won S, et al. Cinnamon zeylanicum bark extract and powder mediated green synthesis of nano-crystalline silver particles and its bactericidal activity. Colloids and Surfaces B: Biointerfaces. 2009; 37: 332–8.

9.             Reddy NJ, Nagoor Vali D, Rani M RS. Unbound MEDLINE : Evaluation of antioxidant, antibacterial and cytotoxic effects of green synthesized silver nanoparticles by Piper longum frui. Materials science & engineering. C, Materials for biological applications. 2014; 34:115-22.

10.          Yanyan L, Zhang T. Targeting cancer stem cells by curcumin and clinical applications. Cancer letters [Internet]. Elsevier Ireland Ltd; 2014; 346(2): 197–205.

11.          Baharara J, Namvar F, Ramezani T, Hosseini N, et al. Green Synthesis of Silver Nanoparticles using Achillea biebersteinii Flower Extract and Its Anti-Angiogenic Properties in the Rat Aortic Ring Model. Molecules (Basel, Switzerland). 2014 Jan; 19(4): 4624–34.

12.          Baharara J, Namvar F, Mousavi M, Ramezani T, et al. Anti-Angiogenesis Effect of Biogenic Silver Nanoparticles Synthesized Using Saliva officinalis on Chick Chorioalantoic Membrane (CAM). Molecules. 2014; 19: 13499–508.

13.          Khalil MMH, Ismail EH, El-Baghdady KZ, Mohamed D. Green synthesis of silver nanoparticles using olive leaf extract and its antibacterial activity. Arabian Journal of Chemistry. 2014; 7(6): 1131–9.

14.          Vaskivuo TE, Stenbäck F, Tapanainen JS. Apoptosis and apoptosis-related factors Bcl-2, Bax, tumor necrosis factor-α, and NF-κB in human endometrial hyperplasia and carcinoma. Cancer [Internet]. Wiley Subscription Services, Inc., A Wiley Company; 2002; 95(7): 1463–71.

15.           Govender R, Phulukdaree A, Gengan RM, Anand K, et al. Silver nanoparticles of Albizia adianthifolia: the induction of apoptosis in human lung carcinoma cell line. Journal of nanobiotechnology. 2013; 11(1): 5-17.

16. Hekmat A, Saboury AA, Divsalar A. The Effects of Silver Nanoparticles and Doxorubicin Combination on DNA Structure and Its Antiproliferative Effect Against T47D and MCF7 Cell Lines. Journal of Biomedical Nanotechnology [Internet]. American Scientific Publishers; 2012; 8(6): 968–82.