مطالعه بیان ژن‏های کلیدی در بیوسنتز مونوترپن‏ها در بافت‏های مختلف و در پاسخ به الیسیتورهای غیرزیستی در گیاه دارویی مرزه تابستانه (hortensis Satureja)

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانش آموخته کارشناسی ارشد، بیوتکنولوژی کشاورزی، دانشگاه کردستان، سنندج، ایران

2 دانشگاه کردستان، دانشکده کشاورزی، سنندج، ایران

چکیده

هدف: هدف از این تحقیق بررسی بیان ژن‏های کلیدی 1-دی‌اکسی دی‌زایلولز-5-فسفات ردوکتوایزومراز (DXR) و گاماترپینن‌سنتاز (GTS) در مسیر بیوسنتز تیمول و کارواکرول در گیاه مرزه تابستانه (Satureja hortensis) یکی از گیاهان دارویی مهم متعلق به خانواده نعناعیان و از منابع مهم ترکیبات فوق بود.
مواد و روشها:  تیمار گیاهان با اسیدسالیسیلیک، متیل جاسمونات و  اشعه UV-B انجام گرفت. RNA  از گیاهان شاهد و تحت تیمار استخراج شد و سپس cDNA سنتز شد. آغازگر‏ها جهت جداسازی و بیان ژنهای DXR و GTS طراحی شدند. بیان ژن‏های مورد مطالعه به‏روش RT-PCR نیمه کمی بررسی شد.
نتایج: قطعاتی از ژن‏های GTS و DXR توالی یابی شدند. نتایج بررسی بیان ژن در سطح رونوشت نشان داد که هر دو ژن DXR و GTS در بافت‏های مختلف (ریشه، ساقه، برگ و گل آذین) دارای بیان‏های متفاوتی هستند و در بافت‏های هوایی به‏ویژه گل آذین و برگ دارای بیان بیشتری می‏باشند. همچنین بیان این ژن‏ها تحت تاثیر الیسیتورهای غیر زیستی شامل اسید سالیسیلیک‏، متیل جاسمونات و اشعه UV-B تغییرات چشم‏گیری نشان می‏دهد.
نتیجهگیری:  تحت شرایط کنترل شده با به‏کارگیری الیسیتورهای غیر زیستی شامل اسید سالیسیلیک‏، متیل جاسمونات و اشعه UV-B می‏توان بیان ژ‏ن‏های DXR و GTS را بالا برده و احتمالا تولید متابولیت ثانویه تیمول و کارواکرول را افزایش داد.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

گیاه مرزه تابستانه با نام علمی Satureja hortensis یک گیاه معطر و یک ساله، متعلق به خانواده نعناعیان Lamiaceae)) است. قسمت‏های هوایی مرزه و برخی دیگر از گونه‏های جنس Satureja از قدیم به‏عنوان طعم دهنده غذاها و همچنین در طب سنتی مورد استفاده قرار گرفته اند (1). بررسی‏های فیتوشیمیایی بر روی مرزه آشکار کرده است که مقادیر زیادی ترکیبات مونوترپن فنولیک در اسانس آن وجود دارد (2). از مهم‏ترین ترکیبات مونوترپنی که در مرزه یافت شده‌است می‏توان به تیمول (Thymol )، کارواکرول (Carvacrol)، گاماترپینن (‌ γ-terpinen )، پی سایمن (p-Cymene )، آلفاپینن (α-pinene ) و بتاپینن β-pinene ) اشاره کرد (2و3). مونوترپن‏ها ترکیباتی بی‏رنگ، چربی دوست و فرار هستند که در دفاع در برابر انواع گیاه‏خواران و عوامل بیماری‏زا نقش دارند (4). تیمول وکارواکرول به‏عنوان اجزای اصلی اسانس مرزه در بیشتر مطالعات معرفی شده اند (5-7). تیمول وکارواکرول دارای خواص اکسیداتیو، ضد میکروبی، ضد سرفه، خلط آور، ضد اسپاسم و ضد باکتری و قارچ هستند (8-11). اثرات ضدمیکروبی آن‌ها به‏دلیل نفوذپذیر نمودن غشای سلول است که می‌توانند با کاتیون‌های سطح غشا کلاته شده و فعالیت‌های حیاتی را مختل کنند (12). همچنین مشخص شده است که این ترکیبات باعث تغییرات در مورفولوژی و تجمع  هیف در قارچ‏ها شده و در نتیجه قطر هیف کاهش یافته و باعث تجزیه دیواره می‏شوند (13). بنابراین تیمول و کارواکرول که اجزای اصلی اسانس‌های مرزه می‌باشند به‏عنوان مهارکننده‌ی رشد در برابر باکتری‌ها و قارچ‌های مختلف شناخته شده اند.

به‏طور کلی ترپنوییدها و ازجمله مونوترپن‏ها در گیاهان علاوه بر  مسیر موالونات (mevalonate ) که منجر به تولید ایزوپنتیل پیرو فسفات Isopentenyl pyrophosphate  (IPP) می‏شود از طریق یک مسیر دیگر که مسیر غیر موالونات یا مسیر متیل اریتریتول فسفات (2-C-methyl-d-erythritol-4-phosphate) نامیده می‏شود، سنتز می‌شوند (14). مسیر MEP در پلاستیدها اتفاق می افتد و شامل هفت واکنش آنزیمی دخیل برای تشکیل ایزوپنتنیل دی‌فسفات (Isopentenyl diphosphate ) (IPP) و دی‌متیل آلیل دی‌فسفات (Dimethylallyl diphosphate) (DMAPP) از پیرووات (Pyruvate) و دی‌گلیسرآلدهید 3-فسفات  D-glyceraldehyde 3-phosphate)(GAP) می‌باشد (شکل 1). واکنشی که توسط آنزیم 1-دی‌اکسی دی‌زایلولز-5-فسفات ردوکتوایزومراز (1-Deoxy-D-xylulose 5-phosphate reductoisomerase) (DXR) کاتالیز می شود یک واکنش مهم است و دارای نقش کلیدی در کنترل بیوسنتز ایزوپرنوئیدها در پلاستیدها است (15-16). بیوسنتز ترپنوییدها با اتصال سر به دم ایزوپنتیل دی‌فسفات (IPP) به ایزومر دی‌متیل آلیل دی‌فسفات (DMAPP) ادامه می یابد که با این اتصال ژرانیل دی‌فسفات (Geranyl diphosphate ) (GPP) حاصل می‌شود. علاوه بر این، از اتصال GPP با واحدهای IPP، پرنیل دی‌فسفات‌های (Prenyl diphosphates ) بزرگ‌‌‍تر مانند فارنسیل دی‌فسفات (Farnesyl diphosphate ) (FPP) و ژرانیل ژرانیل دی‌فسفات (Geranylgeranyl diphosphate ) (GGPP) را تشکیل می‏شوند (14). محصول GPP و FPP طی فرآیندهای حلقوی شدن به‏ترتیب اسکلت‌های مونوترپن و سز‌کویی‌ترپنی را تشکیل می‏دهند. تشکیل تیمول و کارواکرول با مونوترپن گاماترپینن (γ-terpinen ) (GT) شروع شده و در ادامه از طریق پی‌سایمن آروماتیک واکنش‏ها به‏سمت سنتز آن‏ها پیش می‏رود (17). گاماترپینن که به‏وسیله آنزیم گاماترپینن‌سنتاز (γ-terpinen synthase ) (GTS)کاتالیز می‏شود، پیش ماده مونوترپن‏های آروماتیک در ادامه مسیر بوده و بنابراین نقشی اساسی را در این مسیر ایفا می‏نماید (18).

 

 

 

شکل 1: مسیر بیوسنتز تیمول و کارواکرول از طریق متیل اریتریتول فسفات (MEP). :pyr پیرووات، G3P: گلیسرالدهید ۳-فسفات، DXS: 1-دئوکسی گزیلولوز 5-فسفات سنتاز، DXP: 1-دئوکسی گزیلولوز 5-فسفات ، DXR: 1-دی‌اکسی دی‌زایلولز-5-فسفات ردوکتاز ، MEP: متیل اریتریتول فسفات،CMS: 2-سی متیل دی اریترول 4 فسفات سیتیدیل ترانسفراز، CDP-ME: 4-دی فسفوسیتیدیل 2-سی متیل اریترول، CMK: 4-دی فسفوسیتیدیل 2-سی متیل د-اریترول کیناز،  CDP-MEP: 4-دی فسفوسیتیدیل 2-سی متیل د-اریترول 2-فسفات، MCS: 2- سی-متیل دی اریترول 2و4-سیکلودی فسفات سنتاز،:MEcPP   2- سی-متیل-دی-اریترول 2و4-سیکلودی فسفات، HDS: (ای)-4- هیدروکسی-3-متیل-بوت-2-انیل پیروفسفات سنتاز، HMB-PP: (ای)-4- هیدروکسی-3-متیل-بوت-2-انیل پیروفسفات ، HDR: (ای)-4- هیدروکسی-3-متیل-بوت-2-انیل پیروفسفات ردوکتاز، DMAPP: دی‌متیل آلیل دی‌فسفات، IPP: ایزوپنتنیل دی‌فسفات، GPP: ژرانیل دی‌فسفات.                

 

 

با توجه به اهمیت تیمول و کارواکرول که دارای خواص بسیار مهمی از جمله آنتی اکسیدانت، ضد میکروب و باکتری، ضد سرفه و اسپاسم می‏باشند (8-11)، تاکنون مطالعات زیادی بر روی این ترکیبات صورت گرفته است. تیمول از مهم‌ترین روغن‌های ضروری در مرزه تابستانی است که خاصیت ضد قارچی و ضد عفونی آن از لحاظ علمی ثابت شده است. کارواکرول نیز به‏عنوان افزودنی غذایی به‏دلیل خواص ضد باکتریایی آن استفاده می‌شود. با توجه به افزایش روز افزون مقاومت باکتری‏ها به آنتی‌بیوتیک‌ها و نیز عوارض جانبی این داروها و همچنین استفاده رو به رشد نگه‏دارنده‌های شیمیایی غذایی که بسیاری از آن‏ها ممکن است سرطان‌زا باشند، توجه به عصاره و ترکیبات گیاهان دارویی و مواد ضد میکروبی طبیعی که حاوی تیمول و کارواکرول باشند، افزایش یافته است. در حال حاضر تولید تجاری بیشتر متابولیت‏های ثانویه از طریق گیاهان وحشی یا ارقام موجود انجام می‏گیرد اما روش‎های بیوتکنولوژی نیز امروزه در زمینه بررسی و تولید آن‏ها مورد توجه قرار دارند که می‏توان به روش‏های کشت بافت و سلول گیاهی،  دست‏کاری‏های ژنتیکی، کشت ریشه‎های موئین و مهندسی متابولیت اشاره کرد (19). در روش کشت بافت و سلول گیاهی علاوه بر شناخت چگونگی بیوسنتز متابولیت‏ها و همچنین  مکانیسم تنظیمی آن‏ها راه‏کارهای مختلفی را به‏منظور افزایش تولید متابولیت‎های ثانویه می‏توان به‏کار برد، که از جمله می توان استفاده از الیسیتورها، افزودن پیش سازها و بهینه سازی محیط کشت را نام برد (20). الیسیتورها مواد شیمیایی یا ترکیبات و عوامل زیستی و  غیر زیستی متنوعی هستند که می‎توانند تغییرات فیزیولوژیکی و تجمع برخی ترکیبات ثانویه و فیتوآلکسین‏ها را  در گیاهان القا کنند (21). به‏دلیل آن‏که متابولیت‌های ثانویه نقش دفاعی را در گیاهان بر عهده دارند، مقدار آن‌ها در اثر اعمال تنش‏های زیستی و غیر زیستی افزایش می‌یابد. نقش اسیدسالیسیلیک در واکنش‌های دفاعی گیاه به‏خوبی نشان داده شده است (22-23).  همچنین جاسمونیک‌اسید از تنطیم‌کننده‌های رشد گیاهی نقش مهمی را در سازوکار دفاعی گیاهان نسبت به تنش‌های محیطی و به‌خصوص القای ژن‌های دفاعی در مواجهه با عوامل بیماری‌زا ایفا می کند (23-24). در نتیجه الیسیتورهایی مانند اسیدسالیسیلیک و متیل جاسمونات به‏طورکارآمدی برای افزایش تولید متابولیت‎های ثانویه در گیاهان دارویی از طریق کشت‏های تحت کنترل، هیدروپونیک و کشت‏های سلولی  به‏کار رفته‎اند.

یکی دیگر از اثرات متقابل گیاهان و محیط در ارتباط با جذب اشعه های UV است. متابولیت‏های ثانویه در برابر تابش اشعه‏های UV و به‏ویژه  UV-B نقش مهمی دارند و مطالعات اخیر نشان داده اند که تابش اشعه UV-B یک تنظیم کننده مهم متابولیت‏های ثانویه درگیاهان است (25). بنابراین نقش و تاثیر آن بر روی بیان ژن‏ها و تغییرات متابولیت‏های ثانویه در گیاهان دارویی اطلاعات مناسبی را در راستای افزایش متابولیت‏های ثانویه در اختیار قرار می‏دهد. به‏طور کلی  با توجه به اهمیت مرزه به‏عنوان یک گیاه دارویی که دارای ترکیبات مونوترپنوییدی با ارزشی مانند تیمول و کارواکرول است و همچنین نقش ژن‌های DXR و GTS به‏عنوان ژن‏های کلیدی در بیوسنتز مواد مذکور، تعیین توالی و بررسی میزان بیان آن‌ها تحت الیسیتورهای مختلفی مانند اسیدسالیسیلیک، جاسمونیک اسید و اشعه UV-B مهم به‏نظر می‏رسد. نتایج به‏دست آمده می‌تواند در جهت افزایش و بهره‌برداری تجاری ترکیبات ترپنوییدی تیمول و کارواکرول در مرزه به‏کار گرفته شود.

مواد و روش‌ها

کاشت مرزه و تیمار گیاهان با اسیدسالیسیلیک و جاسمونیک ‌اسید: بذرهای گیاه مرزه از مرکز ملی ذخایر ژنتیکی و زیستی ایران تهیه شد. گیاهان در شرایط گل‏خانه در دمای حدود 20 تا 25 درجه سانتی‌گراد پرورش یافتند. اسیدسالیسیلیک و متیل‌جاسمونات به‏ترتیب با غلظت‌های 1 و 1/0 میلی‌مولار بر روی برگ‌های گیاه مرزه (در مرحله گل‌دهی) و در شرایط رشدی گلخانه محلول پاشی شدند. قبل از اعمال تیمار (صفر) و در 4، 12، 24 و 48 ساعت بعد از اعمال تیمارها از برگ‌ گیاهان نمونه‌گیری انجام شد. همچنین بر روی برگ گیاهان شاهد آب مقطر استریل ‌پاشیده شد و در زمان‏های ذکر شده نمونه‌گیری انجام شد. نمونه‌های گیاهی جهت انجام مراحل بعدی در دمای   80–   درجه سانتی‏گراد نگه‏داری شدند.

تیمار گیاهان با اشعه UV-B: تاثیر UV-B به‏عنوان بخشی از اشعه ماورای بنفش (Ultraviolet) که به زمین می‏رسد، بر بیان ژن ‌در گیاه مرزه مورد ارزیابی قرار گرفت. ابتدا در زمان قبل از شروع تابش اشعه UV-B از گیاهان نمونه برگی تهیه شد (ساعت صفر)، سپس بلافاصله تعدادی از گیاهان به‏مدت 24 ساعت تحت تابش اشعه  UV-Bزیر هود لامینار و تعدادی تحت تابش نور معمولی قرار داده شدند و بعد  از 24  ساعت از آن گیاهان نمونه برگی تهیه شد.

استخراج RNA و ساخت cDNA: RNA از بافت‏های ریشه، ساقه، برگ و گل آذین گیاهان مورد مطالعه در مرحله گلدهی با روش تک ‌مرحله‌ای مبتنی بر محلول ترایزول (Trizol) استخراج شد. به این صورت که به ازای 1/0 گرم از بافت تازه، 1 میلی‌لیتر ترایزول اضافه شد و پس از طی مراحل کامل استخراج، در نهایت 50 میکرولیتر آب تیمار شده با دپس (DEPC) به رسوب به‏دست آمده اضافه شد. به‏منظور به‏دست آوردن RNA خالص و عاری از DNA، نمونه‏های RNAهای جدا شده با استفاده از آنزیم DNase1 شرکت فرمنتاز (Fermentase)  طبق دستورالعمل شرکت سازنده تیمار شدند. کیفیت RNA بر روی ژل آگارز 2/1 درصد تعیین و غلظت با دستگاه نانو دراپ (NanoDrop1000spectrophotometer) در طول موج‏های 260 و 280 نانومتر مشخص شد. برای ساخت DNA مکمل (cDNA)  از کیت سنتز cDNA شرکت سیناژن طبق دستورالعمل استفاده شد.

طراحی آغازگر ها و جداسازی ژن‏های مورد مطالعه: از آن‌جا که ژن‌های GTS  و DXR تاکنون در جنسSatureja وخصوصا گونه مرزه تابستانه توالی‌یابی نشده‌اند، برای تعیین توالی بخشی از آن‏ها ابتدا توالی این ژن‌ها در گیاهان هم‌خانواده مرزه از سایت NCBI دریافت شد و هم‌ردیفی توالی‌ها با استفاده از نرم‌افزار ClustalW (26) انجام گرفت. براساس نواحی حفاظت شده این توالی‌ها و با استفاده از نرم‌افزار Primer3 (27) آغازگرها طراحی شدند. نهایتا پس از جداسازی و تعیین توالی قسمت‏هایی از ژن‏های GTS و DXR، آغازگرهای اختصاصی جهت بررسی بیان این ژن‏ها  در مرزه تابستانه طراحی شد  (جدول 1). با استفاده از نرم افزار Oligo calculator دایمر و مشخصات ترمودینامیکی پرایمرها بررسی شد.

RT-PCRنیمه کمی: جهت اندازه گیری بیان ژن‏های GTS و DXR به روش RT-PCR نیمه کمی از ژن عامل افزایش 1 آلفا (Elongation factor 1 alpha ) (EF1α) (28) به‏عنوان کنترل داخلی (ژن رفرنس) استفاده شد. آغازگرهای اختصاصی به‏کار رفته در جدول 1 ارائه شده است. همسان‌سازی غلظت‌های cDNA جهت هماهنگ سازی کلیه واکنش‏ها انجام گرفت. نسبت­های مواد به‏کار رفته و چرخه­های حرارتی در جدول 2 و جدول 3 آورده شده است.

 

 

جدول 1: مشخصات مربوط به آغازگرهای مورد استفاده جهت بررسی بیان ژن

اندازه  قطعه

دمای اتصال

توالی آغازگر (3→ 5)

نام آغازگر

700 جفت باز

2/61  درجه سانتی‏گراد

GCCTTTTGTCCTTCCTCTTG

F-DXR

 

6/61 درجه سانتی‏گراد

TCCGCTCGATGCTTGTCGC

R-DXR

300 جفت باز

9/51 درجه سانتی‏گراد

CTCTTGGATTCAGACTCCTCAG

F-GTS

 

9/50 درجه سانتی‏گراد

GAGGGAGAGCCAAAGAATG

R-GTS

500 جفت باز

7/56 درجه سانتی‏گراد

AACCTCGACTGGTACAAGGGC

F-EF1α

 

2/56 درجه سانتی‏گراد

GGCTCCTTCTCCAGCTCCTT

R-EF1α

F آغازگر مستقیم، R آغازگر معکوس

 

جدول 2: نوع و غلظت مواد مورد استفاده در هر واکنش PCR

مواد

غلظت در محلول‌پایه

حجم استفاده‌شده

cDNA

-

1میکرولیتر

آغازگر مستقیم یا معکوس

pmol/µl 5

هرکدام میکرولیتر

آنزیم تک DNA پلی‌مراز

u/µl 10

1/0 میکرولیتر

کلرید‌منیزیم

mM 50

3/0 میکرولیتر

بافر PCR

X 10

میکرولیتر

dNTP

mM 10

2/0 میکرولیتر

آب

-

4/5 میکرولیتر

کل

-

10 میکرولیتر

 

 جدول 3: چرخه حرارتی واکنش RT-PCR نیمه کمی

تعداد چرخه

مرحله

زمان

دما (°C)

1

واسرشت اولیه

4 (دقیقه)

94

 

واسرشت

30 (ثانیه)

94

28

اتصال

30 (ثانیه)

*

 

بسط

** (ثانیه)

72

1

بسط نهایی

7 (دقیقه)

72

*بسته به نوع ژن (جدول 1 )، ** بسته به طول ژن (60 ثانیه هر کیلو باز)

 

 

کمی کردن RT-PCRو آنالیز داده­ها: عکس‏های‌­ مربوط به ژل (حاصل از RT-PCR نیمه‌کمی) با استفاده از نرم‌افزار GelQuantNET به داده‌های کمی و عددی تبدیل شدند. آنالیز واریانس داده‏ها براساس طرح کاملا تصادفی با سه تکرار انجام شد. مقایسه میانگین داده‌ها به‏روش دانکن در سطح احتمال 5 درصد )05/0 (p< و با استفاده از نرم‌افزار SPSS انجام شد. نمودار­های مناسب جهت تجزیه و تحلیل بیان ژن‏ها توسط نرم‌افزار Microsoft Excel 2010  رسم شد.

نتایج

 تعیین توالی ژن‏های GTSو DXRو ارزیابی آن‌ها

با توجه به اینکه قطعات تکثیر شده که دارای سایزهای پیش‌بینی شده هستند، اولین مرحله از صحیح بودن همسانه‌سازی ژن‏ها می‌باشند، جهت اطمینان از صحت ژن‏های مورد مطالعه، محصولات تکثیر شده تعیین توالی شدند. نتایج تعیین توالی در شکل‌های2 و 3 ارائه شده است.

 

 

 

 

 

شکل2: توالی به‌دست آمده برای ژن گاماترپینن‌سنتاز در گیاه مرزه (Satureja hortensis).

 

 

شکل3:  توالی به‌دست آمده برای ژن DXR در گیاه مرزه (Satureja hortensis).

 

 

جهت تایید نهایی توالی‌های به‌دست آمده برای ژن‌های مورد نظر این توالی‏ها در پایگاه داده‌ای NCBI بلاست (Blast x) شدند. با توجه به e-value و درصد یکسانی توالی با سایر توالی‌های موجود در پایگاه داده، مشخص شد که توالی‌های به‌دست آمده مربوط به ژن‌های GTS و DXR هستند. نتایج حاصل از بلاست و سایر اطلاعات مربوط به آن در جدول 4 و  جدول 5 ارائه شده است. هم‌ردیفی ناحیه تعیین توالی شده ژن‌های GTS  و DXR درگیاه مرزه با همین نواحی در سایر گیاهان هم‌خانواده آن‏ها نشان داد که این ژن‏ها بسیار مشابه و حفاظت شده هستند. این نتایج نشان می‌دهد که توالی‌های معرفی شده به احتمال زیاد (با توجه به e-value ) متعلق به ژن‌های GTS  و DXR باشند.

 

جدول4:  بخشی از نتایج بلاست ناحیه توالی‌یابی شده ژن GTS در مرزه

accession number

Identity

e-value

gene (species)

AGT29345.1

87%

0.0

putative gamma-terpinene synthase (Thymus serpyllum)

AEO27879.1

86%

0.0

putative gamma-terpinene synthase (Origanum syriacum)

AFZ41788.1

86%

0.0

putative gamma-terpinene synthase (Thymus vulgaris)

AGZ58667.1

86%

0.0

putative monoterpene synthase (Origanum majorana)

E2E2P0.1

86%

0.0

Gamma-terpinene synthase, chloroplastic (Origanum vulgare)

AGK88254.1

86%

0.0

gamma-terpinene (Thymus caespititius)

AGK88253.1

86%

0.0

gamma-terpinene synthase (Thymus caespititius)

AGS42395.1

86%

0.0

terpene synthase 2 (Thymus vulgaris)

ADK73620.1

85%

0.0

terpene synthase 2 (Origanum vulgare)

AGT29347.1

85%

0.0

putative gamma-terpinene synthase (Thymus x citriodorus)

ADK73617.1

78%

0.0

terpene synthase 5 (Origanum vulgare)

ABH07678.1

67%

0.0

sabinene synthase (Salvia pomifera)

ABP01684.1

66%

0.0

pinene synthase (Rosmarinus officinalis)

ACN42009.1

64%

0.0

linalool synthase (Perilla frutescens)

AGK88259.1

64%

0.0

alpha-terpineol (Thymus caespititius)

جدول 5: بخشی از نتایج بلاست ناحیه توالی‌یابی شده ژن DXRدر مرزه

accession number

identity

e-value

gene (species)

Q9XES0.2

99%

3e-175

deoxy-D-xylulose 5-phosphate reductoisomerase (Mentha x piperita)

ACK57535.1

99%

2e-174

1-deoxy-d-xylulose 5-phosphate reductoisomerase (Salvia miltiorrhiza)

AGQ04155.1

95%

3e-168

1-deoxy-D-xylulose 5-phosphate reductoisomerase (Lavandula angustifolia)

AHZ96598.1

95%

5e-167

1-deoxy-D-xylulose 5-phosphate reductoisomerase (Aquilaria sinensis)

AFU93070.1

95%

7e-167

chloroplast 1-deoxy-D-xylulose-5-phosphate reductase (Eucommia ulmoides)

CAB43344.1

94%

3e-166

1-deoxy-d-xylulose-5-phosphate reductoisomerase (Arabidopsis thaliana)

EYU42569.1

95%

8e-167

hypothetical protein MIMGU_mgv1a004650mg (Mimulus guttatus)

XP_010459323.1

94%

6e-166

1-deoxy-D-xylulose 5-phosphate reductoisomerase, chloroplastic-like (Camelina sativa)

AHX36947.1

93%

9e-166

putative 1-deoxy-d-xylulose 5-phosphate reductoisomerase (Betula platyphylla)

XP_008464564.1

94%

1e-165

1-deoxy-D-xylulose 5-phosphate reductoisomerase, chloroplastic (Cucumis melo)

XP_010546027.1

94%

2e-165

1-deoxy-D-xylulose 5-phosphate reductoisomerase, chloroplastic (Cleome hassleriana)

AID55340.1

94%

3e-165

1-deoxy-D-xylulose 5-phosphate reductoisomerase (Actinidia arguta)

XP_011071850.1

94%

4e-165

PREDICTED: 1-deoxy-D-xylulose 5-phosphate reductoisomerase (Brassica rapa)

AAW28998.1

93%

4e-165

1-deoxy-D-xylulose-5-phosphate reductoisomerase (Antirrhinum majus)

AAR99081.1

94%

9e-165

1-deoxy-D-xylulose-5-phosphate reductoisomerase (Plectranthus barbatus)

 

 

بیان ژ‌ن‏های‌GTS و DXR  در بافت‏های مختلف مرزه

جهت بررسی بیان ژن در شرایط نرمال در گل‏خانه ابتدا از بافت‏های ریشه، ساقه، برگ و گل آذین نمونه‏گیری و سپس استخراج  RNA با موفقیت انجام شد. RT-PCR نیمه‌کمی برای ژن GTS و ژن رفرنس EF1α در بافت‏های مختلف انجام شد. نتایج به‏دست آمده نشان می‌دهد که بیشترین میزان بیان به‌ترتیب در بافت‌های برگ (6/1) و گل‌آذین (4/1) و کمترین میزان بیان مربوط به بافت ‌ریشه (8/0) و سپس ساقه (4/0) می‌باشد (شکل 4). همچنین RT-PCR نیمه‌کمی برای ژن DXR و ژن رفرنس  EF1αدر بافت‏های مختلف انجام شد. نتایج به‏دست آمده برای این ژن نیز نشان می‌دهد که بیشترین میزان بیان DXR به‌ترتیب در بافت‌های گل‌آذین (8/2) و برگ (2/1) و کمترین میزان بیان مربوط به بافت ساقه (7/0) و سپس ریشه (5/0) می‌باشد (شکل 5 ).

 

 

 

 

شکل 4: نمودار نسبی بیان ژنGTSدر چهار بافت مختلف گیاه مرزه (بالا)، RT-PCR نیمه کمی برای ژن هدف GTS و ژن کنترل EF1α داخلی (پایین، باند حدود 500 جفت باز مربوط به ژن کنترل داخلی EF1α و باند حدود 300 جفت باز مربوط به ژن GTS می‌باشد).

 

 

شکل 5: نمودار نسبی بیان ژن DXRدر چهار بافت مختلف گیاه مرزه (بالا)، RT-PCR نیمه کمی برای ژن هدف DXRو ژن کنترل EF1α داخلی (پایین، باند حدود 500 جفت باز مربوط به ژن کنترل داخلی EF1α و باند حدود 700 جفت باز مربوط به ژن DXRمی‌باشد).

 

 

بیان ژ‌ن‏های‌GTSو DXR  در برگ تحت تاثیر اسید سالیسیلیک

اثر اسیدسالیسیلیک با غلظت 1 میلی‌مولار بر روی میزان بیان ژن گاماترپینن‌سنتاز در برگ‏ها و در زمان‏های متفاوت پس از اعمال تیمار بررسی شد. نتایج نشان‌داد که در گیاهان تحت تیمار و گیاهان شاهد (تیمار نشده) بیان ژن GTS دارای تغییرات معنی‏داری در سطح 5 درصد است. به‏طوری‏که تا 12 ساعت پس از اعمال تیمار در گیاهان تیمار شده نسبت به گیاهان شاهد افزایش بیان مشاهده می‏شود و بعد از 24 ساعت میزان بیان کاهش می‌یابد تا در نهایت پس از 48 ساعت میزان بیان به سطح گیاهان شاهد نزدیک می‌شود و تقریبا در همان سطح 24 ساعت قرار می‏گیرد (شکل 6). اما در گیاهان شاهد (عدم اعمال تیمار) تفاوت معنی‌داری از لحاظ میزان بیان ژن GTS مشاهده نمی­شود (شکل 6).

 

 

شکل 6: نمودار الگوی بیان نسبی ژن GTS در زمان‌های متفاوت پس از اعمال تیمار با اسیدسالیسیلیک در برگ گیاه مرزه.

حروف یکسان بیان‌گر عدم اختلاف معنی‌دار در سطح 5 درصد با آزمون دانکن می‌باشد.

 

 

همچنین بررسی میزان بیان ژن DXR در برگ‏ها در اثر تیمار با اسیدسالیسیلیک با غلظت 1 میلی‌مولار نشان داد که در گیاهان تیمار شده پس از چهار ساعت افزایش بیان مشاهده می‏شود (شکل 7) و بعد از آن بیان DXR کاهش می‏یابد به‏طوری‏که پس از 48 ساعت از اعمال تیمار سطح بیان این ژن به سطح گیاهان تیمار نشده می‏رسد (شکل 7). به‏طور کلی پس از چهار ساعت از اعمال تیمار بین گیاهان تیمار شده با تیمار نشده اختلاف قابل توجهی وجود ندارد.

 

 

شکل 7: نمودار الگوی بیان نسبی ژن DXR در زمان‌های متفاوت پس از اعمال تیمار با اسید سالیسیلیک در برگ گیاه مرزه.

حروف یکسان بیان‌گر عدم اختلاف معنی‌دار در سطح 5 درصد با آزمون دانکن می‌باشد.

 

بیان ژ‌ن‏های‌GTSو DXR  در برگ تحت تاثیر متیل‌جاسمونات

بیان ژن GTSدر گیاهان تحت تیمار با متیل‌جاسمونات با غلظت 1/0 میلی مولار نیز بررسی شد.  نتایج حاصل نشان داد که بیان این ژن تحت تاثیر متیل‌جاسمونات قرار می‏گیرد، به‏طوری‏که تا 24 ساعت پس از اعمال تیمار ژن GTSافزایش بیان معنی‏داری نشان می‏دهد و سپس بعد از 48 ساعت از میزان بیان ژن کاسته شده  به‏طوری‏که میزان آن تا سطح گیاهان تیمار نشده پایین می آید (شکل 8). اما در گیاهان تیمار نشده تفاوت معنی‌داری در سطح بیان ژن گاماترپینن‌سنتاز مشاهده نمی‏شود (شکل 8).

 

 

شکل 8: نمودار الگوی بیان نسبی ژن GTSدر زمان‌های متفاوت پس از اعمال تیمار با متیل‌جاسمونات در برگ گیاهان مرزه تحت تیمار و کنترل. حروف یکسان بیان‌گر عدم اختلاف معنی‌دار در سطح 5 درصد با آزمون دانکن می‌باشد.

 

 

همچنین اثرتیمار با متیل جاسمونات روی میزان بیان ژن DXR  در شکل 9  نشان داده شده است. نتایج این بررسی نشان داد که بیان DXR در اثر اعمال تیمار متیل جاسمونات 1/0 میلی‌مولار دارای تغییرات است، به‏طوری‏که در 12 ساعت پس از اعمال تیمار میزان بیان ژن DXR  به بالاترین سطح خود می‌رسد و سپس میزان بیان به‏تدریج کاهش یافته و در 48 ساعت پس از اعمال تیمار به سطح میزان آن در گیاهان تیمار نشده نزدیک می‌شود (شکل9)، اما در گیاهان تیمار نشده اختلاف معنی‌داری در سطح بیان ژن DXR  در زمان‌های متفاوت مشاهده نمی‏شود.

 

 

 

 

شکل 9: نمودار الگوی بیان نسبی ژن DXR در زمان‌های متفاوت پس از اعمال تیمار با متیل ‌جاسمونات در برگ گیاهان تیمار شده و گیاهان کنترل. حروف یکسان بیان‌گر عدم اختلاف معنی‌دار در سطح 5 درصد با آزمون دانکن می‌باشد.

 

 

بیان ژ‌ن‏های‌GTSو DXRتحت اشعه  UV-B

آنالیز داده‏های حاصل از RT-PCR نیمه کمینشان داد که ژن GTS در گیاه مرزه تحت تابش اشعه‏ی  UV-B پس از 24 ساعت نسبت به گیاهان کنترل در ساعت صفر و نیز  گیاهان کنترل در معرض 24 ساعت نور معمولی افزایش بیان نشان می‏دهد (شکل 10). بنابراین می‌توان گفت که بیان ژن مذکور 24 ساعت بعد از اعمال تابش اشعه تحت تاثیر قرار می‏گیرد. در گیاهان کنترل (هم قبل از اعمال تابش اشعه UV-B وهم 24 ساعت در معرض نور معمولی) یک روند یکنواخت در میزان بیان ژن  GTSوجود داشت و تفاوت معنی‌داری در سطح بیان ژن در این گیاهان مشاهده نشد (شکل 10).

 

 

شکل 10: نمودار الگوی بیان نسبی ژن GTSدر برگ گیاه مرزه در زمان‌های 0 (شاهد) و پس از اعمال تیمار با اشعه UV-B.

حروف یکسان بیان‌گر عدم اختلاف معنی‌دار در سطح 5 درصد با آزمون دانکن می‌باشد.

 

 

همچنین در بررسی بیان DXR در برگ گیاه مرزه تحت تیمار اشعه ی  UV-B، نتایج به‏دست آمده نشان داد که بیان این ژن در گیاهان تحت UV-B پس از 24 ساعت نسبت به گیاهان کنترل (ساعت صفر) و همچنین گیاهان تحت تابش نور معمولی پس از 24 ساعت، تحت تاثیر قرار گرفته و افزایش معنی‏داری یافته است (شکل 11).

 

 

 

شکل 11: نمودار الگوی بیان نسبی ژن DXR در برگ گیاه مرزه در زمان‌های 0 (شاهد) و پس از اعمال تیمار با اشعه UV-B.

حروف یکسان بیان‌گر عدم اختلاف معنی‌دار در سطح 5 درصد با آزمون دانکن می‌باشد.

 

 

بحث

مرزه یک گیاه دارویی با ارزش است که دارای ترکیبات مهمی به نام مونوترپن‌ها، گروهی از متابولیت‏های ثانویه، هست که در صنایع غذایی و دارویی کاربرد ویژه ای دارند. بنابراین تقاضا برای این ترکیبات رو به افزایش است، اما به‏دلیل محدودیت‏هایی از جمله شرایط آب و هوایی، خاک و تغییرات سطح کشت، که می‏توانند در محتوی، میزان پایین ترکیبات ثانویه و یا کاهش برداشت گیاهان مرزه موثر باشند، نیازمند به‏کارگیری راه‏کارهای متفاوتی جهت افزایش تولید آن‏ها هستیم. روش‏های متعددی از جمله کشت سلول و بافت، کشت ریشه‏های مویین، مهندسی ژنتیک و افزایش بیان ژن در مسیر تولید متابولیت‏های ثانویه، جهت افزایش تولید آن‏ها معرفی شده است (29-32). دست ورزی‌ ژنتیکی در راستای افزایش متابولیت‏های ثانویه گیاهی یکی از روش‏های مهم و کاربردی در عصر جدید است که در این زمینه شناسایی و دست‏کاری ژنتیکی ژن‏های موثر در سنتز متابولیت‏های ثانویه مانند مونوترپن‏ها دارای ارزش زیادی است. بنابراین اولین گام جهت به‏کارگیری روش مهندسی ژنتیک و افزایش بیان ژن‏ها در مسیر بیوسنتزی، توالی یابی و مطالعه بیان ژن‏ها به‏ویژه ژن‏های کلیدی می‏باشد. در این راستا در گیاه مرزه توالی‏های بخشی از ژن‏های DXR و GTSشناسایی و بیان آن‏ها در بافت‏ها و تحت تاثیر دو الیسیتور مهم شیمیایی اسید سالیسیلیک و متیل جاسمونات و همچنین اشعه UV-B به‏عنوان یکی از اجزای پرانرژی‌اشعه ماورای بنفش نور خورشیدی بررسی شد.

در این پژوهش برای دست یافتن به اهدف فوق، ابتدا با استفاده از توالی‌های مربوط به ژن‌های گاماترپینن‌سنتاز و DXR در گیاهان خویشاوند و نزدیک به مرزه، جفت آغازگرهایی در جهت مستقیم و معکوس جهت جداسازی این ژن‌ها طراحی شد و سایر مراحل تا تعیین توالی محصولات به‌دست آمده با موفقیت انجام گرفت. مقایسه توالی اسیدآمینه به‌دست آمده برای ژن GTSبا سایر گیاهان، نشان‌دهنده بیشترین درجه یکسانی (87 درصد) با گیاهان متعلق به جنس آویشن و پونه از خانواده نعنائیان (Lamiaceae) می‌باشد. مقایسه توالی اسیدآمینه‌ای به‌دست آمده از ژن DXR نیز با توالی پروتئینی آن در سایر گیاهان نشان‏دهنده وجود درجه یکسانی بالاتر از 90 درصد با گونه‏های نعناع و مریم‌گلی از خانواده نعنائیان (Lamiaceae)  است. بنابراین نتایج نشان می‏دهد که مشابهت بالایی بین توالی‏های پپتیدی ژن‏های هدف (DXR و GTS) در مرزه با توالی‏های ثبت شده در NCBI به‏ویژه برای گیاهان متعلق به خانواده نعنائیان (Lamiaceae) وجود دارد که به احتمال زیاد صحت توالی‏های به‏دست آمده را  تایید می‏کند.

در بررسی بیان نسبی ژن در مرزه، میزان بیان ژن GTSدر بافت برگ بیشتر از سایر بافت‌ها بود که این امر می‌تواند تایید کننده نقش مهم این ژن در بیوسنتز مونوترپن‌ها در برگ ‌و احتمالا کرک‌های غده‌ای باشد. زیرا مطالعات انجام شده نشان داده‏اند که اکثر گیاهان خانواده نعناعیان دارای اسانس ترشحی در کرک‌های غده‌ای موجود بر روی اندام‌های رویشی و زایشی هوایی هستند (33). در مطالعات انجام شده روی مرزه گونه Satureja horvatii نیز نشان ‌داده شد که برگ‌ها دارای کرک‌های غده‌ای هستند که محل سنتز مونوترپن‌ها می‌باشند (34). همچنین در بررسی بیان ژن DXR  میزان بیان بالایی در بافت‏های گل‌آذین و برگ‏ها نسبت به بافت‌های ریشه و ساقه مشاهده شد که بیانگر تایید محل بیوسنتز مونوترپن‌ها در این اندام‏های هوایی است. در هماهنگی با این پژوهش، مطالعه‌ای روی بیان ژن DXR در گیاه آرابیدوپسیس انجام شده که نشان‌دهنده وجود بالاترین میزان بیان در بافت گل‌آذین و پایین‌ترین میزان بیان در بافت ساقه می‌باشد (35). همچنین در گیاه جینسنگ هندی (Withania somnifera) نشان داده شد که میزان بیان ژن DXR در بافت برگ نسبت به بافت ریشه خیلی بیشتر است (36)، این امر می‏تواند به‏دلیل تولید متابولیت‏های ثانویه در پلاستیدهای مستقر در برگ‏ها باشد که به‏میزان بالای بیان DXR  نیاز هست و از آن‌جا که بافت ریشه عاری از این ترکیبات است، بنابراین بیان ژن DXR در بافت ریشه از سایر بافت‌ها بسیار پایین‏تر می‌باشد (36).

اطلاعات در مورد بیان ژن‏های کلیدی موثر در مسیر متابولیت‏های ثانویه و چگونگی تنظیم بیان آن ها می‏تواند در راستای افزایش سطح آنزیم‏های کد شونده به‏وسیله این ژن‏ها و نهایتا افزایش متابولیت ثانویه به‏کار گرفته شود. بدین‏منظور بیان دو ژن GTS و  DXR تحت تاثیر دو الیسیتور شیمیایی اسیدسالیسیلیک و متیل جاسمونات و همچنین اشعه UV-B به‏عنوان اشعه غالب در زمین که همیشه گیاهان در معرض آن قرار دارند، بررسی شد. اسیدسالیسیلیک و متیل جاسمونات نقش مهمی را در واکنش‌های دفاعی گیاه ایفا می‌کنند که افزایش مقدار آن‏ها منجر به تولید پیام‏هایی در گیاهان می‏شوند که در نهایت بیان گروه‏های خاصی از ژن‏ها به‏ویژه ژن‏های دفاعی افزایش می‏یابد (21 و37). در این پژوهش هر دو ژن GTSوDXR  در ابتدای اعمال تیمار اسیدسالیسیلیک (4 ساعت پس از تیمار گیاهان) افزایش بیان و سپس روند کاهشی نشان دادند. با توجه به ارتباط مستقیم بین متابولیت‏های ثانویه (مانند مونوترپن) و بیان ژن‌های کلیدی (مانند GTS و DXR )، به‏نظر می‏رسد که زمان مناسب اعمال تیمار در جهت افزایش مونوترپن در گیاه مرزه ابتدای اعمال تیمار با اسیدسالیسیلیک ‌باشد. بنابراین تاثیر تیمارهای کوتاه مدت در راستای افزایش مونوترپن‏ها مفیدتر خواهد بود. در مطالعه ای که تاثیر تیمار اسیدسالیسیلیک  بر گیاه جینسنگ هندی بررسی شد، بیان ژن DXR در 6 ساعت پس از اعمال تیمار افزایش یافت و متعاقبا کاهش نشان داد (36)، که این نتایج تقریبا مشابه با یافته‌های این تحقیق می‌باشد.  پنولاس و همکاران (38)  نیز نشان دادند که متیل سالیسیلات، از مشتقات اسیدسالیسیلیک، نرخ انتشار مونوترپن در گیاه چوبی بلوط همیشه سبز (Quercus ilex) را افزایش می‌دهد. به‏طور کلی نتایج نشان می‌دهندکه اسیدسالیسیلیک می‌تواند به‌عنوان یک تقویت کننده بالقوه برای افزایش تولید متابولیت‏های ثانویه در گیاهان از جمله مونوترپن‏ها در مرزه استفاده شود.

در بررسی اثر متیل‌جاسمونات بر بیان ژن‌های GTS و DXR در مرزه، در زمان‏های 4 تا 24 ساعت پس از اعمال تیمار افزایش بیان معنی‏داری مشاهده شد و پس از زمان 24 ساعت یک روند کاهشی را نشان داند. در استفاده از متیل‌جاسمونات در گیاه جینسنگ هندی نیز میزان بیان ژن DXR در بافت برگ تا زمان 72 ساعت پس از اعمال تیمار افزایش یافت (38). در تحقیق دیگری روی گیاه ریحان شیرین (Ocimum basilicum) از متیل‌جاسمونات به صورت محلول‌پاشی روی گیاهان استفاده شد و کل محتوای فنلی از جمله ترپنوییدها به‌صورت قابل توجهی بعد از اعمال تیمار در مقایسه با گیاهان شاهد افزایش یافت (39). با توجه به این نتایج به‏نظر می‏رسد که به‏کار بردن تیمار متیل جاسمونات نیز می‏تواند منجر به افزایش بیان ژن‏های موثر در مسیر متابولیت‏های ثانویه شده و نهایتا محتوی کل متابولیت‏ها افزایش می‏یابد. بنابراین در مرزه می‏توان دوره 4 تا 24 ساعت را برای اعمال تیمار و افزایش بیان ژن‏هایی مانند GTS و DXR  و نهایتا افزایش مونوترپن‏ها در نظر داشت. 

گیاهان همیشه در معرض انواع تنش‏های زنده و غیر زنده هستند و متابولیت‏های ثانویه نقش مهمی در مقابله با این تنش‏ها به‏صورت اثر متقابل با آن‏ها دارند. یکی از این اثرات متقابل گیاهان و محیط در ارتباط با جذب اشعه های UV است. متابولیت‏های ثانویه در برابر تابش اشعه‏های فرابنفش (UV) و به‏ویژه  UV-B نقش مهمی دارند (25). مطالعات اخیر نشان داده‏اند که تابش اشعه UV-B یک تنظیم کننده مهم متابولیت‏های ثانویه در گیاهان است (25). دوزهای پایین و در محدوده اکولوژیکی اشعه UV-B ( nm315-280 ) می‏تواند محتوی بیوسنتز متابولیت‏های ثانویه از جمله ترکیبات فنلی، کاروتنوئیدها وگلوکوزینولات‏ها را کاملا تغییر دهد (25و40 ). بنابراین اعمال تیمار در دوز مناسب و کنترل شده اشعه UV-B ممکن است بتواند متابولیت‏های ثانویه در گیاهان را افزایش دهد. تحقیقات نشان داده اند که ژن‏های کلیدی بیوسنتز فلاونوئیدها توسط اشعه UV-B افزایش بیان نشان می‏دهند و محتوای فلاونوئیدهای سلولی افزایش می‏یابد (25).  در پژوهش حاضر که تاثیر اشعه UV-B بر بیان ژن‌های GTS و DXR به‏عنوان دو ژن کلیدی در مسیر بیوسنتز مونوترپن‏ها در مرزه، مورد ارزیابی قرار گرفت، هر دو ژن تحت تاثیر قرار گرفتند و افزایش بیان چشم‏گیری نشان دادند. در شرایط کم UV-B در آرابیدوپسیس بیان فاکتور رونویسی HY5  افرایش نشان داده است (41). همچنین مقادیر فلاونئوئیدها، آنتوسیانیدین‏ها و هیدروکسی بنزوئیک اسیدها درگیاهان انگور فرنگی سیاه (Ribes nigrum) که در معرض اشعه UV-B قرار گرفته بودند، افزایش محتوی نشان دادند (42). هائو و همکاران (43) در کشت کالوس گیاه Ginkgo biloba تحت تابش UV-B نشان دادند که نیتریک اکسید سنتاز و فنیل آلانین آمونیا لیاز افرایش فعالیت بیشتری دارند. در چندین گونه‏ گیاهی دیگر نیز تولید متابولیت‏های ثانویه در پاسخ به UV-B به‏خوبی مستند شده است (40، 44-45).  به‏طور کلی نتایج نشان می‏دهند که متابولیت‏های ثانویه و ژن‏های مرتبط با مسیر بیوسنتزی می‏توانند تحت تاثیر اشعه UV-B قرار گرفته و افزایش نشان می‏دهند. روی هم رفته، نتایج اولیه اثرات تیمار گیاهان مرزه با UV-B نشان می‏دهد که پتانسیل مناسبی جهت افزایش ترکیبات با ارزش متابولیت‏های ثانویه از این طریق وجود دارد.

نتیجه گیری

درک مسیر متابولیت‏های ثانویه و چگونگی تنظیم بیان ژن‏های مرتبط با آن‏ها می‏تواند در راستای تولید بیشتر متابولیت ثانویه در گیاهان دارویی بسیار موثر باشد. نتایج بررسی بیان دو ژن کلیدی (GTSو DXR) در مسیر متیل اریتریتول فسفات در پلاستیدها در گیاه مرزه تابستانه نشان داد سطوح بیان در بافت‏ها متفاوت است و همچنین اعمال الیسیتورهای غیرزیستی مختلف مانند اسید سالیسیلیک‏، متیل جاسمونات و اشعه UV-B می‏توانند سطح بیان این ژن‏ها را تغییر دهند. با توجه به این‏که محتوی ترکیبات ثانویه تحت تاثیر بیان ژن‏ها ی درگیر در بیوسنتز آن‏هاست، بنابراین می‏توان با انتخاب الیسیتورهای مناسب و اعمال آن‏ها در زمان‏های مناسب بیان ژن‏های موثر در مسیر بیوسنتزی را افزایش داده و قاعدتا ترکیبات ثانویه از جمله ترکیبات مونوترپنی را در مرزه افزایش داد.

. Hajhashemi V, Sadraei H, Ghannadi AR, Mohseni M.  Antispasmodic and antidiarrheal effect of Satureja hortensis L. essential oil. Journal of  Ethnopharmacology. 2000; 71(1-2): 187-192.

2. Gora J, Lis A, Lewandowski A. Chemical composition of the essential oil of cultivated summer savory (Satureja hortensis L. CVnSaturn). Journal of  Essential Oil Research. 1996; 8: 427-428.

3. Ghannadi A, Hajhashemi V, Sadraei H, Mohseni M. Composition of the essential oil of Satureja hortensis L. grown in Iran. Iranian Journal of Basic Medical Sciences. 2000; 2: 5-8.

4. Langenheim JH. Higher plant terpenoids: a phytocentric overview of their ecological roles. J Chem Ecol. 1994; 20(6): 1223-1280.

5. Adiguzel A, Ozer H, Kilic H, Cetin B. Screening of antimicrobial activity of essential oil and methanol extract of Satureja hortensis on foodborne bacteria and fungi. Czech J. Food Sci. 2007; 25(2): 81-89.

6. Mohammadhosseini  M, Beiranvand  M.  Chemical Composition of the Essential Oil from the Aerial Parts of Satureja hortensisAs a Potent Medical Plant Using Traditional Hydrodistillation.  Journal of Chemical Health Risks. 2013; 3(4): 43-54.

7.  Kargar V, Alizadeh A, Namayandeh A. Essential oil constituents of Satureja sahendica Bornm. and Satureja hortensis L. cultivated in Iran. Intl J Farm & Alli Sci. 2014; 3(1): 91-94.

8. Höferl M, Buchbauer G, Jirovetz L, et al. Correlation of antimicrobial activities of various essential oils and their main aromatic volatile constituents.  Journal of Essential Oil Research.  2009; 21(5): 459-463.

9. Youdim KA, Damien Dorman HJ, Deans SG. The antioxidant effectiveness of thyme oil, α-tocopherol and ascorbyl palmitate on evening primrose oil oxidation. Journal of Essential Oil Research.  1999; 11(5): 643-648.

10. Barnes, J, Anderson, LA, Philipson, JD. Herbal Medicines. 3th Ed. London: Pharmaceutical Press; 2007.

11. Dorman HJD, Deans SG. Antimicrobial agents from plants: antibacterial activity of plant volatile oils.  Journal of Applied Microbiology. 2000; 88(2): 308-316.

12. Ultee A, Kets TPW, Smid EJ. Mechanisms of action of carvacrol on the food-borne pathogen Bacillus     cereus. Applied and Environmental Microbiology.1999; 65(10): 4606-4610.

13. Soylu S, Yigitbas H, Soylu EM, Kurt S. Antifungal effects of essential oils from oregano and fennel on Sclerotinia sclerotiorum. Journal of Applied Microbiology. 2007; 103: 1021-1030. 

14. Ultee Dubey VS, Bhalla R. An overview of the non-mevalonate pathway for terpenoid biosynthesis in plants.

Journal of Biosciences. 2003; 28(5): 637-646.

15. Carretero-Paulet L, Ahumada I, Cunillera N, Rodrı́guez-Concepción M, et al. Expression and molecular analysis of the Arabidopsis thaliana DXR gene encoding 1-deoxy-D-xylulose 5-phosphate reductoisomerase, the first committed enzyme of the 2-C-methyl-D-erythritol 4-phosphate pathway. Plant Physiol. 2002; 129:1581-1591.

16. Takahashi S, Kuzuyama T, Watanabe H, Seto H. A 1-deoxy-D-xylulose 5-phosphate reductoisomerase catalyzing the formation of 2-C-methyl-D-erythritol 4-phosphate in an alternative nonmevalonate pathway for terpenoid biosynthesis. Proc Natl Acad Sci USA. 1998; 95(17): 9879-9884.

17. Poulose AJ, Croteau R. Biosynthesis of aromatic monoterpenes : Conversion of γ-terpinene to p-cymene and

thymol in Thymus vulgaris L. Archives of Biochemistry and Biophysics. 1978; 187(2): 307-314.

18. Poulose AJ, Croteau R. γ-Terpinene synthetase: A key enzyme in the biosynthesis of aromatic monoterpenes. Archives of Biochemistry and Biophysics. 1978;191(1): 400-411.

19. Zhoua LG, Wu JU. Development and application of medicinal plant tissue cultures for production of drugs and herbal medicinals in China. Nat Prod Rep. 2006; 23(5): 789-810.

20. Raoa SR, Ravishankar GA. Plant cell cultures: Chemical factories of secondary metabolites. Biotech Adv. 2002; 20(2): 101-153.

21. Zhao J, Davis LC, Verpoorte R. Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol Adv. 2005; 23(4): 283-333.

22. Rivas-San Vicente M, Plasencia J. Salicylic acid beyond defence: its role in plant growth and development. J Exp Bot. 2011; 62(10): 3321-3338.

23. Reymond P,  Farmer EE. Jasmonate and salicylate as global signals for defense gene expression. Current Opinion in Plant Biology. 1998; 1(5): 404-411.

24. Seo HS, Song JT, Cheong JJ, Lee YH, et al. Jasmonic acid carboxyl methyltransferase: a key enzyme for jasmonate-regulated plant responses. Proc Natl Acad Sci USA. 2001; 98(8): 4788-4793.

25. Schreiner M, Martínez-Abaigar J, Glaab J, Jansen M. UV-B induced secondary plant metabolites. Optik Photonik 2014; 9(2): 34-37.

26. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research. 1994; 22(22): 4673-4680.

27. Rosen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. In: Misener S, Krawetz SA. (eds). Bioinformatics methods and protocols: methods in molecular biology. Totowa, New Jersey: Humana Press; 2000; 365-386.

28. Crocoll C, Asbach J, Novak J, Gershenzon J, et al. Terpene synthases of oregano (Origanum vulgare L.) and their roles in the pathway and regulation of terpene biosynthesis. Plant Mol Biol. 2010; 73: 587-603.

29. Bourgaud F, Gravot A, Goniter E. Production of plant secondary metabolites. Plant science. 2002; 161(5): 839-851.

30. Rao SR, Ravishankar GA. Plant cell cultures: Chemical factories of secondary metabolites. Biotechnology Advances. 2002; 20(2): 101-153.

31. Mulabagal V, Tsay HS. Plant cell cultures-an alternative and efficient source for the production of biologically important secondary metabolites. International Journal of Applied Science and Engineering. 2004; 2: 29-48.

32. Kumar J, Gupta PK. Molecular approaches for improvement of medicinal and aromatic plants. Plant Biotechnology Reports. 2008; 2(2): 93-112.

33. Werker E. Function of essential oil secreting glandular hairs in aromatic plants of the Lamiaceae – a review.

Flavour and Fragrance Journal. 1993; 8: 249-255.

34. Marin M, Ascensao L, Lakusic B. Trichomes of Satureja horvatiisilic (Lamiaceae) -micromorphplogy and

hictochemistry. Archives of Biological Sciences. 2012; 64: 995-1000.

35. Carretero-Paulet L, Ahumada L, Cunillera N, Rodrıguez-Concepcion, et al. Expression and molecular analysis of the Arabidopsis DXR gene encoding 1-deoxy-D-xylulose 5-phosphate reductoisomerase, the first committed enzyme of the 2-C-methyl-D-erythritol 4-phosphate pathway. Plant Physiology. 2002; 129: 1581-1591.

36. Gupta P, Agarwal AV, Akhtar N, Sangwan RS, et al. Cloning and characterization of 2-C-methyl-D-erythritol-4-phosphate pathway genes for isoprenoid biosynthesis from Indian ginseng, Withania somnifera. Protoplasma. 2013; 250(2): 285-295.

37. Borad V, Sriram S.. Pathogenesis-related proteins for the plant protection. Asian J Exp Sci. 2008; 22:189-196.

38. Penuelas J, Llusia J. Filella I. Methyl salicylate fumigation increases monoterpene emission rates. Biologia

Plantarum. 2007; 51(2): 372-376.

39. Kim HJ, Chen F, Wang X, Rajapakse NC. Effect of methyl jasmonate on secondary metabolites of sweet basil (Ocimum basilicum L.). Journal of Agricultural and Food Chemistry. 2006; 54(6): 2327-2332.

40. Mewis I, Schreiner M, Nguyen CN, Krumbein A, et al. UV-B Irradiation Changes Specifically the Secondary Metabolite Profile in Broccoli Sprouts: Induced Signaling Overlaps with Defense Response to Biotic Stressors. Plant Cell Physiology. 2012; 53(9): 1546-1560.

41. Favory JJ. Interaction of COP1 and UVR8 regulates UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis. EMBO Journal. 2009; 28(5): 591-601.

42. Huyskens-Keil S, Eichholz I, Kroh LW, Rohn S. UV-B induced changes of phenol composition and antioxidant activity in black currant fruit (Ribes nigrum L.). J. Appl. Bot. Food Qual. 2007; 81:140-144.

43. Hao G, X Du, Zhao F, Shi R, Wang J. Role of nitric oxide in UV-B-induced activation of PAL and stimulation of flavonoid biosynthesis in Ginkgo biloba callus. Plant Cell Tiss Organ Cult. 2009; 97: 175-185.

44.  Kakani VG, Reddy KR, Zhao D, Mohammed AR. Effects of ultraviolet-B radiation on cotton (Gossypium hirsutum L.) morphology and anatomy. Ann. Bot. 2003; 91(7): 817-826.

45. Rai R, Meena RP, Smita SS, Shukla A, et al. UV-B and UV-C pre-treatments induce physiological changes and artemisinin biosynthesis in Artemisia annua L.- An antimalarial plant. Journal of Photochemistry and Photobiology B: Biology. 2011; 105(3): 216-225.