اثرات سیتوسیدالی پروتئین کریستالی باسیلوس تورنجینسیس بر روی رده سلولی سرطان سینه موش در شرایط آزمایشگاهی

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشجوی کارشناسی ارشد دانشگاه آزاد اسلامی، واحد علوم و تحقیقات فارس، دانشکده علوم پایه، گروه میکروب‌شناسی، شیراز، ایران

2 دانشگاه آزاد اسلامی، واحد شیراز، گروه میکروب‌شناسی، شیراز، ایران

3 دانشگاه علوم پزشکی شیراز، مرکز تحقیقات پیوند و ترمیم اعضا، شیراز، ایران

2

چکیده

هدف: هدف از این تحقیق تاثیر پاراسپورین باسیلوس تورنجینسیس بر روی رده سلولی سرطان سینه موش در شرایط آزمایشگاهی بود.
مواد و روش‏ها: جداسازی توکسین کریستالی از ایزوله‏های باسیلوس تورنجینسیس انجام شد. تیمار رده سلولی سرطان سینه 4T1 با توکسین فعال شده انجام شد. از اثرات سیتوپاتیک سلولی عکس‏برداری شد. توکسین کریستالی با بیشترین خاصیت سیتوسیدالی، با استفاده از SDS-PAGE و روش مولکولی شناسایی شد.
نتایج: از 47 باسیلوس تورنجینسیس، ایزوله E8 دارای بیشترین خاصیت سیتوسیدالی بر روی رده سلولی 4T1  می‏باشد. با توجه به نتایج شناسایی مولکولی ژن پاراسپورین و بررسی اندازه پروتئین جداسازی شده با استفاده از SDS-PAGE پاراسپورین-4 شناسایی شد. پاراسپورین-4 رده سلولی  4T1 را متلاشی نموده و دارای اثرات سیتولیزین می‏باشد. 
نتیجه گیری: نتایج حاصل از این پژوهش پیشنهاد می‏کند که پاراسپورین یک پروتئین سیتولیزین بوده و دارای جایگاه اختصاصی در سطح سلول است و مرگ سلولی را در سلول‏های سرطانی سینه القا می‏نماید.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

داده‏های بهداشت عمومی حاکی از آن است که بار و فشار جهانی ناشی از سرطان پستان در زنان که به‏صورت نرخ وقوع مرگ و میر و هزینه‏های اقتصادی اندازه‏گیری می‏شود، قابل توجه بوده و در حال افزایش است (1). در سراسر جهان، تخمین زده شده است که یک میلیون زن سالانه به سرطان پستان مبتلا می‏شوند و بیشتر از 410 هزار نفر از آن‏ها در اثر این بیماری می‏میرند که نمایانگر 14 درصد کل مرگ و میر ناشی از سرطان در زنان می‏باشد (2). علاوه بر این، نرخ وقوع سرطان پستان در حال افزایش بوده و سالانه 5 درصد جمعیت مبتلایان در کشورهای در حال توسعه در حال افزایش است (3). سرطان پستان رایج‏ترین سرطان و علت اصلی منجر به مرگ ناشی از سرطان در بین زنان سراسر دنیا می‏باشد. هر 19 ثانیه در گوشه ای از دنیا یک مورد سرطان پستان تشخیص داده می‏شود و هر 74 ثانیه در گوشه ای از دنیا یک زن در اثر سرطان پستان می‏میرد. سال 2010، 6/1 میلیون مورد جدید سرطان پستان تشخیص داده شده است (با این نرخ، در طی 25 سال آینده، 41 میلیون نفر به مبتلایان آن اضافه می شود) (4).

باسیلوس تورینجنسیس، یک باکتری گرم مثبت، بی‏هوازی و اسپوردار است که انواع مختلفی از پروتئین‏های سمی در طی مرحله اسپورزایی تولید می‏کند. بعضی از سویه های غیر حشره کش باسیلوس تورینجنسیس پروتئین‏های کریستالی تولید می‏کنند که دارای اثرات ضد سرطان است (2). به‏دلیل انتخابی بودن اثر آن‏ها بر علیه سلول‏های سرطانی در انسان و نه سلول‏های نرمال، تعدادی از این پروتئین‏ها به‏طور وسیعی مطالعه شده‏اند و مکانیسم اثر آن‏ها در کشتن انتخابی سلول‏های سرطانی انسان به‏طور گسترده در ژاپن و مالزی همراه با گزارش‏های متفرقه از جاهای دیگر جهان، مطالعه شده است. فراوانی این باسیل در طبیعت و انتخابی بودن اثر آن‏ها موجب شده که کاندید بالقوه ای برای درمان سرطان باشد. هرچند، ادبیات مرتبط با اثربخشی این پروتئین‏ها در بافت زنده خیلی نادر است. از آنجایی‏که گونه‏های مختلفباسیلوس تورینجنسیس پروتئین‏های سیتوتوکسیک متفاوتی با دامنه وسیعی از اثرات ضد سرطانی و مکانیسم عمل متفاوت تولید می‏کنند، بررسی بیشتر آن‏ها و اثرات آن‏ها بر روی بافت‏های زنده ضروری است تا بتوان آن‏را در نمونه‏های انسانی استفاده نمود (5).

ایران به لحاظ میزان شیوع سرطان سینه جزء کشورهایی با شیوع متوسط است و سالانه 7هزار تا 9 هزار مورد جدید ابتلا به سرطان سینه در کشور شناسایی می‌شوند. در حدود درصد زنان ایرانی به سرطان‌های پستان مبتلا هستند (6). تاکنون تاثیر پاراسپورین ایزوله های ایرانی باسیلوس تورینجینسیس بر روی رده سلولی سرطان سینه مورد مطالعه و بررسی قرار نگرفته است. در این مقاله اثر بازدارندگی پاراسپورین باکتری باسیلوس تورنجینسیس بر روی رده سولی سرطان سینه موشی مورد پژوهش قرار گرفت.

مواد و روش‏ها

جداسازیباسیلوستورنجینسیس:60نمونه خاک از مناطق جغرافیایی مختلف ایران شامل استان‏های بوشهر، خراسان و خوزستان جمع‏آوری شد. جداسازی ایزوله‏ها بر اساس روش تغییر یافته سازمان بهداشت جهانی انجام شد (7). بعد از 24 ساعت گرم‏خانه گذاری، کلنی‏های باسیلوس تورنجینسیس بر اساس مورفولوژی کلنی، رنگ‏آمیزی گرم و اسپور جداسازی شده و ایزوله‏ها از نظرمرفولوژی کلنی و  تولید پروتئین کریستالی مورد بررسی قرار گرفت (8).

رنگ‏آمیزیتوکسینکریستالی:به‏منظور مشاهده توکسین کریستالی، بعد از کشت باکتری در محیط اسپورزا و ورود باکتری به مرحله اسپورزایی رنگ­آمیزی توکسین باکتری انجام شد. در این روش نمونه باکتری را بر روی لام شیشه­ای تثبیت نموده و با محلول حاوی رنگ 133/0 درصد بریلینت آبی که در اسید­استیک 50 درصد حل شده رنگ­آمیزی انجام شد. پس از شستشوی اسلاید با آب مقطر به کمک میکروسکپ نوری و با بزرگنمایی 100 توکسین باکتریایی مشاهده شد (9).

جداسازیو فعال سازی پروتئینکریستالی: به‏منظور جداسازی پروتئین، کشت­های اسپورزای باکتری را جمع‏آوری نموده و در نمک طعام یک مولار حاوی 1/0 درصد تریتون X-100  حل شد و به‏دنبال آن سه مرتبه شستشو با آب مقطر انجام شد. به‏منظور خالص سازی پروتئین، مخلوط اسپور و پروتئین در محلول حاوی50 میلی­مولار کربنات­سدیم 50 میلی­مولار (10 pH=) همراه با 10 میلی­مولار دی­تیوتریتول و اتیلن­دی آمین­تترا­استیک­اسید 1 میلی­مولار به‏مدت 1 ساعت در 37 درجه سانتی‏گراد در انکوباتور شیکردار گرم‏خانه­گذاری شد. سپس در دور rpm 16000 به‏مدت 20 دقیقه در 4 درجه سانتی‏گراد سانتریفیوژ گردید (10). مایع رویی حاصل از مرحله جداسازی پروتئین برداشته شده و با آنزیم پروتئیناز­ کا (شرکت فرمنتاز) با غلظت 300 میکروگرم بر میلی­لیتر تیمار نموده و در 37 درجه سانتی‏گراد به‏مدت 90 دقیقه گرم‏خانه­گذاری شد. بعد از تیمار پروتئازی، محلول فنیل­متیل­سولفونید­فلوراید (شرکت فرمنتاز) یک میلی­مولار اضافه شد (11)

کشت سلول: این مطالعه در محیط آزمایشگاه و بر روی رده سلولی سرطان سینه موش (4T1) انجام شد. رده سلولی سرطان سینه از بانک سلولی انیستیتو پاستور (تهران، ایران) تهیه شد. سلول‏های این رده در محیط کشت RPMI 1640 حاوی mM 2 ال-گلوتامین، 10 درصد سرم جنین گاوی، پنی سیلین به میزان unit/mL 100 و استریتوماسیون به‏میزان μg/mL 100 در دمای 37 درجه سانتی‏گراد، 95درصد اکسیژن و فشار 5درصد CO2  کشت داده شدند. شمارش سلول‏ها با کمک هموسایتومتر انجام شد. درصد سلول‏های زنده با تریپان بلو تعیین شد. به‏منظور بررسی فعالیت ضد تکثیری توکسین پروتئینی کریستالی باسیلوس تورینجینسیسابتدا سلول­های رده سلولی کشت داده شدند به‏طوری‏که به هر چاهک پلیت 96 خانه ای تعداد 104×1 سلول اضافه شد. ظروف کشت حاوی سلول به‏مدت 24 ساعت در انکوباتور  CO2دار و در دمای 37 درجه سانتی‏گراد قرار گرفتند. سپس دوزهای مختلف توکسین به سلول‏ها اضافه ­شد. ابتدا توکسین کلیه نمونه­های باسیلوس تورینجینسیس جداسازی شده با غلظت 3 میلی­گرم بر میلی­لیتر بر روی رده سلولی تیمار شد. سپس ایزوله­ای که بیشترین تاثیر کشندگی را (در غلظت 3 میلی‏گرم بر میلی‏لیتر) بر روی سلول­های رده سینه داشتند انتخاب شده و با غلظت­های مختلف توکسین (001/0، 01/0، 1/0، 1، 10 و 100 میکروگرم بر میلی لیتر) تیمار انجام شد. نمونه کنترل مثبت (سلول­های کشته شده با تریتون 100X) و کنترل منفی (فاقد توکسین) نیز ارزیابی شد. پس از اتمام مراحل کار کشت سلولی و اثر دادن غلظت‏های مختلف توکسین کریستالی باسیلوس تورینجینسیس بر سلول­های هدف، به‏هر چاهک 10 میکرولیتر محلول 5 میلی‏گرم بر میلی‏لیتر از MTT اضافه گردید. سپس به‏مدت 3 ساعت در انکوباتور (5درصد) CO2 در 37 درجه سانتی‏گراد انکوبه شد. پس از آن، مایع روئی دور ریخته شد و با افزودن 100 میکرولیتر محلول دی متیل سولفوکساید به‏هر چاهک و قرار دادن آن برای مدت 30 دقیقه بر روی شیکر و دور از روشنایی، کریستال‏های فورمازان ایجاد شده حل شدند. سپس با استفاده از الیزا ریدر میزان جذب نوری چاهک ها در طول موج 595 نانومتر در مقابل کنترل قرائت شد (10، 12).

شناسایی مولکولی ایزوله سیتوسیدال باسیلوس تورنجینسیس: استخراج  DNA با استفاده از کیت مخصوص استخراج DNA ژنوم باکتریایی طبق دستور العمل شرکت سازنده (یکتا طب تجهیز، ایران) صورت گرفت. جهت انجام واکنش زنجیره­ای پلی­مراز، با حجم 25 میکرولیتر، 18 میکرولیتر آب مقطر استریل، 2/5 میکرولیتر بافر PCR با غلظت 10 برابر(سیناژن-ایران)، 75/0 میکرولیتر MgCl2 (سیناژن-ایران) با غلظت 10 میکروگرم بر میکرولیتر، 5/0 میکرولیتر dNTP (سیناژن-ایران) با غلظت میکروگرم بر میکرولیتر، 1 میکرولیتر از پرایمرهای رفت و برگشت (با غلظت 10 پیکومول بر میکرولیتر)(جدول 1)، 25/0 میکرولیتر از آنزیم پلی مراز (سیناژن-ایران) و 1 میکرولیتر از DNA الگو با غلظت 10 میکروگرم بر میکرولیتر مخلوط شدند.

 

 

 

جدول 1: توالی پرایمرهای ژن‏های پاراسپورین باسیلوس تورنجینسیس (13)

اندازه (bp)     نام ژن                                    پرایمر رفت                                          پرایمر برگشت

      1136      پاراسپورین 1     ATCAAGAATTTTCCGATAATC          CCAAAAGTGCCAGAATG

      503    پاراسپورین 2       TGTTGGGACTGTTCAGTACGT        CGTCACGGTACCTCTTAGTGT  

      701     پاراسپورین 3        GGAATCCAGGTGCACTGCT         GTCCCGGATCATACGTTGGA

      681    پاراسپورین 4    AGTGGTCTCCAGGCTCATACTGG   TGATATTCCCGAACCTGCCCT  

 

در این تکنیک برای آغاز فرآیند پلی مریزاسیون دستگاه ترمال سیکلر (BioRAD) به‏مدت 1 دقیقه بر روی دمای 94 درجه سلسیوس تنظیم شد و متعاقبا 35 سیکل PCR به‏صورت 94 درجه سلسیوس برای 1 دقیقه، 54 درجه سلسیوس برای 30 ثانیه و 72 درجه سلسیوس برای مدت 1 دقیقه اجرا شد. در نهایت به‏مدت 4 دقیقه نیز عمل طویل سازی نهایی در 72 درجه سلسیوس انجام شد. سپس جهت اطمینان از تکثیر ژن 16S rDNA، الکتروفورز بر روی ژل آگارز 1درصد، حاوی بافر TBE 1X به‏مدت 60 دقیقه در ولتاژ 90 انجام شد (13). در نهایت جهت مشاهده نتایج ژل از دستگاه UV  ترانس لومیناتور استفاده شد. در نهایت محصول PCR جهت تعیین توالی به شرکت ماکروژن کره جنوبی فرستاده شد (جدول 1).

 بررسی اندازه پروتئین کریستالیبراساس SDS-PAGE: جهت شناسایی پروتئین از SDS-PAGE استفاده شد که شامل ژل جدا کننده 12درصد و ژل متراکم کننده 5 درصد  می‏باشد. ژل جدا کننده حاوی یک مول Tris-HCl با pH   8/8، آمونیوم پرسولفات 10درصد، سدیم دودسیل سولفات 10درصد، 1درصدTEMED ، آکریل امید 30 درصد و بیس آکریل امید 8/0درصد و ژل متراکم کننده حاوی یک مول  اکریل آمید با pH 8/6، آمونیوم پرسولفات 10درصد، سدیم دودسیل سولفات 10درصد و 1درصدTEMED ، اکریل امید 30 درصد و بیس اکریل امید 8/0درصد می‏باشد. رنگ آمیزی ژل‏ها بااستفاده از کومازی بلو انجام گرفت و از مارکر استاندارد فرمنتاز (SMO449) استفاده شد (14).

 نتایج

جداسازی و شناسایی باکتری

 از 60 نمونه جمع‏آوری شده از سه استان شامل استان‏های بوشهر، خوزستان و خراسان با شرایط اقلیمی نسبتا مشابه 386 ایزوله جداسازی شد. سپس بر اساس مورفولوژی کلنی و رنگ‏آمیزی گرم 128 جدایه باسیل جداسازی شده و تحت شرایط اسپورزایی قرار گرفتند. از این میان 47 جدایه باسیلوس تورنجنسیس بر اساس رنگ‏آمیزی توکسین کریستالی شناسایی شد. بیشترین ایزوله‏های جداسازی شده باسیلوس تورنجنسیساز شهرستان بوشهر حاصل شد. در نمونه‏ها توکسین کریستالی به‏شکل‏های لوزی و چسبیده به اسپور و بزرگتر از اسپور و در بعضی از نمونه‏ها توکسین به‏شکل کروی و نامنظم دیده شد (شکل 1).

 

 

 

شکل1: رنگ و شکل کلنی باکتری باسیلوس تورنجینسیس بر روی محیط آگار خوندار (a). ساختار باکتری و اسپور (b). توکسین بعد از رنگ‏آمیزی و مشاهده با میکروسکپ نوری که اسپور شفاف و توکسین تیره دیده می‏شود (c).

 

 

تاثیر توکسین باسیلوس تورنجینسیس بر روی رده سلولی سرطان سینه

 به‏منظور بررسی فعالیت سیتوتوکسیسیتی توکسین پروتئینی کریستالی باسیلوس تورنجینسیس، بعد از کشت سلول‏های   4T1، به‏هر چاهک از پلیت 96 خانه تعداد 104×1 سلول اضافه شد. سپس توکسین 18 ایزوله  باسیلوس تورنجینسیس با غلظت  1 میلی‏گرم بر میلی‏لیتر به رده سرطانی اضافه شد که ایزوله E8 بیشترین میزان سیتوتوکسیسیتی را نشان داد. ایزوله E8 بیشترین اثر سیتوتوکسیتی را بر روی رده سلولی در غلظت1 میلی‏گرم بر میلی‏لیتر نشان داد که تقریبا معادل 80 درصد سیستوتوکسیسیتی می باشد، نتیجه میزان سیتوتوکسیتی پروتئین فعال شده در نمودار 1 آمده است.

 

 

 

نمودار1: مقایسه اثر توکسین کریستالی ایزوله E8 باسیلوس تورنجینسیسبر روی رده سلولی سرطان سینه موش (4T1)

در غلظت‏های مختلف به‏صورت سریال دایلوشن.

 

 

 عکس‏برداری با استفاده از میکروسکوپ معکوس

 تیمار رده سلولی سرطان سینه با توکسین کریستالی E8 انجام شد و بعد از 24 ساعت انکوباسیون عکس‏برداری انجام شد. ساختار رده سلولی 4T1 دوکی شکل می‏باشد. ولی پس از تیمار با توکسین کریستالی، سلول‏ها متلاشی شده و ساختار خود را از دست دادند (شکل 2).

 

 

 

(b)                                                                                       (a)

شکل 2: a) عکس‏برداری از سلول‏های کنترل منفی،  (bسلول‏های تیمار شده با توکسین کریستالی  .E8

 

 

نتایج SDS-PAGE

بعد از جداسازی پروتئین کریستالی با استفاده از کربنات­سدیم، دی­تیوتریتول و اتیلن­دی آمین­تترا­استیک­اسید، به‏منظور مشخص نمودن وزن مولکولی توکسین کریستالی نمونه E8،  SDS-PAGE انجام شد. نتایج نشان داد که وزن مولکولی توکسین کریستالی تقریبا 34 کیلو دالتون می‏باشد که از نظر وزن مولکولی پروتئین مشابه پاراسپورین 4 می‏باشد (شکل 3).

 

شکل 3: نتایج .SDS-PAGE ستون1) مارکر استاندارد فرمنتاز (SMO449) ، ستون 2) توکسین نمونه  E8

شناسایی مولکولی

 بعد از تعیین وزن مولکولی پروتئین، پرایمر بر اساس ژن پاراسپورین-4 سنتز شد و PCR انجام شد. باند 680 جفت بازی حاصل شد که بعد از انجام تعیین توالی، 98درصد همولوژی با ژن پاراسپورین-4 باسیلوس تورنجینسیس در بانک ژنی نشان داد.  نتایج در شکل 4 آمده است.

 

شکل 4: نتایج الکتروفورز. ستون 1) قطعه تکثیر یافته با پرایمرهای اختصاصی پاراسپورین-4 با سایز 681 جفت باز، ستون 2) مارکر 100 جفت بازی سیناژن.

بحث

امروزه با توجه به اینکه درمان‏های فعلی برای سرطان دارای هزینه‏های زیادی بوده و بیشتر درمان‏ها یا معمولا جواب‏گوی بیمار نمی‏باشد و یا باعث اثرات زیان‏بار دیگر در بیماران می‏شود، توجه دانشمندان و متخصصین  را به سمت داروها و متابولیت‏های مستخرج از مواد طبیعی سوق داده است. یکی از کارهایی که در این زمینه صورت گرفته و هنوز در حال بررسی و پژوهش می‏‏باشد، استفاده از پروتئین کریستالی باکتریباسیلوس تورنجینسیس می‏باشد که یک باکتری خاک‏زی و فاقد بیماریزایی برای انسان می‏باشد. تحقیقات اخیر نشان می‏دهد که این توکسین بر روی  برخی سلول‏های سرطانی، در شرایط آزمایشگاهی دارای اثر سیتوتوکسیسیتی می‏باشد (15).

 نتایج این تحقیق نشان داد که نمونه‏های خاک جمع‏آوری شده از مناطق مختلف ایران دارای درصد بالایی باسیلوس تورنجینسیس بوده و دارای توکسین لوزی شکل و کروی می‏باشند. این سم که ساختمان کریستالی از جنس پروتئین دارد برای اولین بار توسط ایشواتا معرفی شد. مرفولوژی کلنی  باسیلوس تورنجینسیسخشک، به‏رنگ سفید، لبه‏های نامنظم و در وسط کلنی برآمده می‏باشد که مشابه تخم مرغ نیمرو است. مورفولوژی سلولی ارگانیسم باسیل شکل می‏باشد. این باکتری اسپور بیضی شکل در ناحیه نیمه انتهایی تولید می‏کند که با نتایج به‏دست آمده از مطالعات بائوم وهمکاران (14) مطابقت داشت. در این مطالعه پاراسپورال‏ها با اندازه‏ی کوچک به رنگ آبی تیره و اسپور به شفاف دیده شد که با مشاهدات آمونز (15) در مطابقت دارد.

مطالعات زیادی بر روی ویژگی‏های پاراسپورین و مکانیسم عمل آن‏ها بر روی رده‏های سلول‏های سرطانی انجام شده است. مشخص شده که مکانیسم عمل این توکسین‏ها متفاوت بوده و بسته به نوع توکسین و ایزوله باکتری باعث ایجاد برآمدگی در سطح سلول، تخریب میتوکندری و تخریب اسکلت سلولی می‏شود. همچنین تغییر در ساختار اسکلت سلولی و قطعه قطعه شدن اندامک‏ها در سلول‏هایی که با توکسین مجاور شده‏اند دیده می‏شود. ناداراجاح و همکاران (16) گزارش کردند که پاراسپورین در غشای پلاسمایی سلول قرار گرفته خاصیت نفوذ ناپذیری غشا را افزایش می‏دهد. این توکسین به‏عنوان یک سیتولیزین که هدف آن غشای پلاسمایی سلول هدف است عمل می‏کند که احتمالا می‏توان از آن به‏عنوان یک پارا سیتولیزین یاد کرد.

مجله سلول و بافت (علمی-  پژوهشی)، جلد 7، شماره 3، پائیز 1395

248

 

در این پژوهش از کل ایزوله های جداسازی شده، باسیلوس تورنجینسیس ایزوله E8 که از خاک اصفهان جداسازی شد دارای توکسین کریستالی از نوع پاراسپورین 4 می‏باشد. توکسین این ایزوله دارای بیشترین اثر سیتوسیدالی قوی بر روی رده سلولی سرطان سینه می‏باشد که تایید کننده اختصاصی عمل کردن توکسین این باکتری می‏باشد که با نتایج اوکامارا و همکاران (17) مطابقت دارد. همچنین در آزمایش اوکامارا فعالیت سیتوتوکسیتی پاراسپورین 4 بر روی 20 رده ی سلولی پستانداران (11 سلول تومور انسانی، 1 سلول تومور موش صحرایی و 8 نوع سلول بافت‏های موش جونده) آزمایش شد که بیشترین اثر را روی سلول‏های روده و سلول های سرطان رحم داشت (17). در این پژوهش سلول‏های رده سینه بعد از تیمار با توکسین E8، به‏نظر می‏رسد ساختار اسکلت سلولی تغییر نموده و به‏شکل کروی در می‏آیند و به‏شکل برآمدگی بزرگ همراه با تاول‏هایی در سطح سلول مشاهده شد. کیتادا و همکاران (18) گزارش نمودند که پروتئین فعال 30 کیلودالتونی که پاراسپورین-2 می‏باشد، باعث ایجاد تغییرات مورفولوژی در رده سلولی HepG2 می‏شود که این تغییرات شامل ایجاد تاول‏هایی در سطح سلول‏ها و بزرگ شدن آن‏ها می‏باشد.

 در تحقیق حاضر که تاثیر توکسین بر روی رده سینه انجام گرفت تغییرات مشابه با نتایج کیتادا به‏دست آمد ولی پاراسپورین-4 شناسایی شد. سلول‏های رده سینه تحت تاثیر پاراسپورین فعال شده ایزوله E8 به‏شکل برآمدگی‏هایی در سطح سلول، بزرگ شدن سلول‏ها و در برخی سلول‏ها متلاشی شدن سلول‏ها مشاهده شد. کیتادا و همکاران (18) علت ایجاد برآمدگی در سطح سلول را افزایش نفوذ‏پذیری غشا پلاسمایی و آسیب رساندن پاراسپورین در غشا اعلام نمودند. با توجه به متفاوت بودن درصد سیتوتوکسیسیتی توکسین ایزوله‏های مختلف باسیلوس تورنجینسیس بر روی رده سلولی سرطان سینه، این نتایج نشان دهنده وجود گیرنده اختصاصی برای این توکسین کریستالی در سطح سلول می‏باشد که کیتادا و همکاران (18) نیز نتایج مشابه را گزارش نمودند.

با توجه به اینکه نتایج این پژوهش هم‏سو با نتایج سایر تحقیقات انجام شده در این زمینه می‏باشد، به‏منظور تکمیل نتایج و جامع تر شدن ابعاد این بررسی، پیگیری فعالیت سیتوسیدالی توکسین کریستالی در سطح in vivoپیشنهاد می‏شود.

نتیجه گیری

نتایج حاصل از این پژوهش تایید کننده اثر مهاری توکسین کریستالی باکتری باسیلوس تورنجینسیس، با خاصیت سیتوسیدالی بر روی رده سلولی 4T1 می‏باشد. توکسین کریستالی سویه ایرانی موجب مهار تکثیر رده سرطانی شده که تاکنون در هیچ مطالعه ای بررسی نشده و برای اولین بار در این پژوهش مورد بررسی قرار گرفت. لازم به‏ذکر است که نتایج این مطالعه کار در محیط آزمایشگاهی است. لزوم انجام تحقیقات بیشتر مورد تاکید می‏باشد.

  1. Mirmalek SA, Kani E. Clinical Application OF Breast Cancer Biology. J of Iranian surgery. 2009; 17(1): 1-17.
  2. Mizuki E, Ohba M, Akao T, Yamashita S, et al. Unique Activity Associated With Non- Insecticidal Bacillus Thuringiensis Parasporal Inclusions; In vitro Cell- Killing Action On Human Cancer Cells. J.Appl. Microbiol. 2009; 86: 477-486.
  3. Lehrer S, Green S, Rosenzweig KE. Affluence and Breast Cancer. Breast J. 2016; 22(5):564-7. [Epub ahead of print].
  4. Williams F, Thompson E. Disparity in Breast Cancer Late Stage at Diagnosis in Missouri: Does Rural Versus Urban Residence Matter? J Racial Ethn Health Disparities. 2016; 3(2): 233-9.
  5. Akiba H, Abe Y, Kitada S, kusakaY, et al. Crystal Structure of the Parasporin-2 Bacillus Thuringiensis Toxin That Recognize Cancer Cells. J Mol Biol. 2009; 13: 38(1): 33-121.
  6. Enayatrad M, Amoori N, Salehiniya H. Epidemiology and Trends in Breast Cancer Mortality in Iran. Iranian Journal of Public Health, 2015; 44(3): 430-431.
  7. Mizuki E, Park YS, Saitoh H, Yamashita S, et al. Parasporin, A Human Leukemic Cell-Recognizing Parasporal Protein of Bacillus Thuringiensis. Clinical and Diagnostic Laboratory Immunology, 2000; 7 (4): 625-634.
  8. Santana MA, Moccia CC, Gillis AE. Bacillus thuringiensis improved isolation methodology from soil samples. J. of Microbiol. Methods. 2008; 75(2): 357-358.
  9. Moazamian E, Bahador N, Rasouli M, Azarpira N, et al. Investigation of Cytocidal Activity of Bacillus Thuringiensis Parasporal Toxin on CCRF-CEM Cell Line. Journal of Fasa University of Medical Sciences. 2012; (4):  247-253.
  10. Ohba M, Mizuki E, Uemori A. Parasporin, A New Anti-Cancer Protein Group from Bacillus Thuringiensis. Anticancer Res. 2009; 29(1): 427-433.
  11. Okumura S, Saitoh H, Ishikawa T, Mizuki E, et al. Identification and Characterization of a Novel Cytotoxic Protein, Parasporin-4, Produced by Bacillus Thuringiensis A1470 Strain. Biotechnol. Annu. Rev. 2006; 14: 225-252.
  12. Nabiuni M, Yarahmadi A, Delfan B, Mirsepasi S. The anti-proliftrative and lethal effects of D-alpha tocopheryl succinate (vitamin E succinate) and Honey bee venom (BV) on human promylocyte leukemia cell line (HL-60). JCT. 2013; 3(4): 287-296.
  13. Lenina NK, Naveeenkumar A, Sozhavendan AE, Balakrishnan N, et al. Charactrrization of parasporin gene harboring Indian isolate of Bacillus thuringiensis. 3 Biotech. 2014; 4(5): 545-551.
  14. Baum JA, Kakefuda M, Gawron-Burke C. Engineering Bacillus thuringiensis bioinsecticides with an indigenous site-specific recombination system. Appl Environ Microbial 1996; 62(12): 4367-4373.        
  15. Ammons D. Usefulness of staining parasporal bodies when screening for Bacillus thuringiensis. J of Invertebrate Patholo, 2002; 79(3): 203-204.
  16. Nadarajah V, Ting D, Chan K, Mohamed S, et al. Selective Cytotoxicity Activity Against Leukaemic Cell Lines from Mosguitocidal Bacillus Thuringiensis Parasporal Inclusions Southeast. Asian Journal of Tropical Medicine and Public Healt. 2008; 39(2): 235-245.
  17. Okumura S, Saitoh H, Ishikawa T, Inouye K, et al. Mode of Action of Parasporin-4, A Cytocidal Protein from Bacillus Thuringiensis. Biophys. Acta. 2011; 1808: 1476-1482.
Kitada S, Abe Y, Shimada H, Kusaka Y, et al. Cytocidal Actions of parasporin-2, an Anti-tumor Crystal Toxin from Bacillus thuringiensis. J of Biolo Chem, 2006; 281(36): 26350-26360.