تاثیر بیان بالای فاکتور مهار کننده لوسمی در سلول‏های بنیادی مغز بر ساختار بافتی هیپوکامپ در موش‌های ترانس ژن تولید شده به‏روش TMGT

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشگاه شهید چمران اهواز، دانشکده دامپزشکی، گروه علوم پایه، بخش بافت شناسی، اهواز، ایران

2 دانشگاه شهید چمران اهواز، دانشکده دامپزشکی، گروه علوم پایه، بخش بیوشیمی و بیولوژی مولکولی، اهواز، ایران

3 مرکز تحقیقات حیوانات آزمایشگاهی، دانشگاه علوم پزشکی جندی شاپور اهواز، اهواز، ایران

چکیده

هدف: فاکتور مهارکننده لوسمی (LIF) اثرات مفیدی بر عملکرد سلول‌های بنیادی عصبی و درمان بیماری‌های نورودژنراتیو دارد. اما اطلاعات محدودی در خصوص تأثیر بیان بالای LIF در سلول‌های بنیادی عصبی بر تغییرات بافت مغز وجود دارد. در این پژوهش موش‏های ترانسژن با بیان بالای هدف‌دار LIF تحت پروموتور نستین تولید و ساختار بافتی هیپوکامپ در آن‌ها مطالعه شد.
مواد و روش‌ها: به‌منظور تولید موش‌های ترانسژن، نواحی پروموتوری پلاسمید pIRES2-EGFP با پروموتور دوم اینترون نستین و توالی تشدید‏کننده Hsp68 جایگزین و به‌صورت درون بیضه‌ای (25 میکروگرم) به 10 موش صحرایی نر تزریق شد. پس از جفت‌گیری با موش‏های ماده، تأیید ترانسژنی با استفاده از PCR معمولی، Real time PCR و میکروسکوپ فلوئورسنت انجام شد. از مغز موش‌های صحرایی ترانسژن بالغ (4 ماهه) نمونه‏گیری و پس از تهیه مقاطع بافتی و رنگ آمیزی H&E ساختار بافتی هیپوکامپ در آن‌ها بررسی شد.
نتایج: ژن LIF در سلول‌های بنیادی هیپوکامپ نسبت به گروه‌های کنترل بیان بیشتری داشت (05/0P<). این یافته به‌‌همراه مشاهده حضور پروتئین EGFP در نواحی تجمع سلول‌های بنیادی نشان‌دهندة بروز ترانسژنی در زاده‌ها بود. تعداد سلول‌های الیگودندروسیت در هیپوکامپ موش‌های ترانسژن نسبت به گروه‏های کنترل به‌طور معنی داری بیشتر بود (05/0 P <).
نتیجه‌گیری: بیان بالای LIF در سلول‌های بنیادی مغز موش‌های صحرایی ترانسژن منجر به افزایش جمعیت سلول‌های الیگودندروسیت در هیپوکامپ شد. از آنجا که تخریب سلول‌های الیگودندروسیت در پیشرفت ضایعات نورودژنراتیو دارای نقش مهمی است ممکن است بتوان درصورت انتقال موفقیت آمیز LIF به مغز از این روش به ‏منظور احیای تودة سلول‏های الیگودندروسیت استفاده نمود.
 

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

کاربرد روش­های درمانی بر پایه سلول­های بنیادی پیشرفت روز افزونی داشته است. با این­حال درمان بسیاری از بیماری­های عصبی نورودژنراتیو بر پایه کاربرد سلول­های بنیادی به‏دلیل محدودیت­هایی چون ناکارآمد بودن عبور سلول­های بنیادی از سد خونی مغزی، توزیع نامتجانس سلول­های بنیادی عصبی در بخش­های غیرهدف به­دنبال تزریق درون بطن­ها و احتمال بروز تومورهای مغزی در زمان کاربرد سلول­های بنیادی تغییر یافته ژنتیکی با ویروس­ها، با تردیدهایی روبه‏رو می­باشد. وجود محدودیت‌های فوق، توجه به روش‌های حفاظت عصبی و ژن‌درمانی، به­جای پیوند مستقیم سلول‌های بنیادی به‌منظور ترمیم ضایعات عصبی را افزایش داده است.  بازآرایی جمعیت سلول‏های بنیادی درون­زاد مستقر در نواحی مختلف مغز مانند هیپوکامپ و ناحیه تحت بطنی (SVZ) به‏کمک القای فاکتورهای نوروتروفیک یکی از روش‏های مورد توجه می‏باشد. به‏نظر می‌رسد ادغام این روش توام با انتقال ژن به‏کمک سلول‌های بنیادی روش کارآمدی در درمان اختلالات عصبی انسان در آینده باشد (1). با این­حال در بسیاری موارد اثرات بیان بالای فاکتورهای نوروتروفیک بر خصوصیات ساختاری و عملکردی مغز ناشناخته می­باشد و نگرانی­هایی در خصوص تاثیر این فاکتورها بر سایر جمعیت­های سلول­های عصبی غیر از سلول­های بنیادی یا سلول­های پیش ساز وجود دارد.

  فاکتور مهارکننده لوسمی (Leukemia inhibitory factor (LIF)) پروتئینی با 180 اسید­­­­آمینه، وزن مولکولی 37 تا 62 کیلودالتون می­باشد (2). این پروتئین در بسیاری از انواع سلول‏ها مانند فیبروبلاست، سلول­هایT فعال‌شده، طحال و یا سلول­های ماکروفاژ، کندروسیت­ها، سلول­های استرومایی مغز استخوان، سلول­های بنیادی مزانشیمی، سلول­های اندوتلیال، آستروسیت­ها و سلول­های توموری بیان می­شود (3). در سال‏های اخیر دو عملکرد این پروتئین به‏دلیل کاربرد درمانی بیشتر مورد توجه قرارگرفته است. نخست تسهیل فرآیند لانه گزینی در رحم گونه­های مختلف حیوانات و دوم نقش ویژه پروتئین LIF در حفظ خاصیت چند قوه­زایی سلول­های بنیادی مزانشیمی‌موش (4). تمایز سلول­های بنیادی به سلول­های تمایز یافته سبب کاهش بیان LIF می­شود که نشان­دهنده نقش این پروتئین در حفظ خاصیت چند قوه­زایی سلول­های بنیادی است (5). با این‌حال مکانیسم دقیق تاثیر LIF بر حفظ چند قوه‏زایی سلول­های بنیادی در سطح مولکولی به­طور کامل شناخته ‌نشده است. مطالعات اخیر در موش­های فاقد LIF یا موش­های دارای ضایعات مغزی تحت درمان با LIF اگزوژن نشان­دهنده اهمیت LIF در مراحل مختلف نوروژنز و ترمیم ضایعات نخاعی و مغزی می باشد (6 و 7). اخیرا تاثیر تزریق LIF خارجی بر تکثیر و تزاید سلول­های پیش­ساز رده اولیگودندروسیت و افزایش سنتز میلین به اثبات رسیده است (7). آسیب سلول­های اولیگودندروسیت در شرایط هیپوکسی در محیط کشت، پس از مواجه با LIF کاهش می­یابد (8).

تجمع سلول­های بنیادی عصبی در بخش‌های متعدد هیپوکامپ شامل شاخ آمون، شکنج دندانه دار و ناحیه سابیکولوم و نیز در لایه‌های چهارگانه ناحیه تحت بطنی تایید شده است. هم­چنین نقش آسیب و باز آرایی سلول‌های بنیادی عصبی در این نواحی در آسیب‌های حسی و حرکتی به اثبات رسیده است. در بسیاری از بیماری‌های نورودژنراتیو به‏ویژه آلزایمر، مولتیپل اسکلروز و پیری کاهش سلول­های بنیادی مستقر در هیپوکامپ سبب بروز اختلالات حافظه­ای، حرکتی فضایی و حواسی متعدد می‌شود (9). استفاده از روش‏های تزریقی درون بطن­ها و مشکلات مربوط به عبور پپتیدهای درمانی از سد خونی مغز، شناسایی تاثیرات ساختاری و مولکولی آن­ها را با محدودیت­هایی روبه‏رو می­سازد. استفاده از سایر روش­ها که منجر به بیان مستقیم پروتئین­های درمانی در بافت عصبی شود، امکان بررسی مکانیسم تاثیرات این ترکیبات را فراهم خواهد آورد. تولید حیوانات ترانسژن به‏منظور ارزیابی بیان ژن‌های مختلف و درک مکانیسم تاثیرات آن‌ها در بافت در سال‌های اخیر توسعه یافته است. تولید این حیوانات با استفاده از دو روش اصلی شامل ریز تزریق پیش هسته یا الحاق سلول‌های بنیادی ترانسژن در بلاستوسیت می‌باشد که هر دو این روش‌ها پر هزینه و نیازمند دسترسی به دستگاه‌های ویژه دارد. توسعه روش‌های ارزان قیمت مانند انتقال ژن به‏واسطه اسپرم (Sperm mediated gene transfer) SMGT یا بیضه TMGT (Testes mediated gene transfer ) با کارایی بالا امکان تولید حیوانات ترانسژن با هزینه کمتر و کارایی بهتر را فراهم نموده است (10).

با توجه به نقش پروتئین نوروتروفیک LIF در عملکرد سلول‌های بنیادی عصبی و فقدان مطالعه‏ای که به بررسی اثرات بیان بالا و اختصاصی LIF در سلول­های بنیادی عصبی و تغییرات ساختاری مغز بپردازد مطالعه حاضر طراحی گردید. هدف از این مطالعه القا بیان بالای LIF تحت پروموتور نستین در سلول­های بنیادی عصبی مغز و تاثیر آن بر بافت شناسی هیپوکامپ می‏باشد.

مواد و روش‏ها

اصلاح ناحیه پروموتوری پلاسمید pIRES2-EGFP

در این مطالعه از وکتور بیانی یوکاریوتی pIRES2-EGFP محصول شرکتInvitrogen   (آمریکا) که ناحیه پروموتوری سایتومگالو ویروس (CMV) آن اصلاح شده بود، استفاده شد. با توجه به این­که ژن نستین در سیستم عصبی مرکزی تنها در سلول­های عصبی بنیادی مغز بیان می­شود، لذا استفاده از پروموتور آن در ناحیه پایین دست پروموتوری پلاسمیدهای  بیانی سبب القا بیان اختصاصی ژن هدف در سلول­های بنیادی مغز می‏شود. از این‏رو در توالی ناحیه پروموتوری پلاسمید pIRES2-EGFP توالی اینترون دوم ژن نستین جایگزین شد.  بدین ترتیب که ابتدا پلاسمید pIRES2-EGFP در باکتری E.coli سویه DH5α در محیط کشت TSB حاوی کانامایسین (50 میکروگرم/ میلی­لیتر) تکثیر و سپس با استفاده از کیت تجاریAccuPrep  (بیونیر، کره جنوبی) خالص سازی شد. پروموتور اینترون دوم از ژن نستین موش صحرایی با 637 جفت باز (قطعه 1798-1162 پروموتور)، (11) توسط RT-PCR با استفاده از پرایمرهای  GGCAATGGGTTGTGTGCAGCTCCACA و CCCATACTCTGGAGTGATATCCTC تکثیر شد و با استفاده از آنزیم‏های برشی AseI و NheI در محل پروموتور ECMV در پلاسمید pIRES2-EGFP (توالی بین591-7) جایگزین شد. پروموتور اینترون دوم نستین به‌تنهایی فاقد عملکرد پروموتوری می‌باشد مگر اینکه یک توالی تقویت‌کننده در مجاورت آن قرار گیرد (12 و 13). به‏همین دلیل توالی تقویت‏کننده hsp68 موشی  پس از برش از پلاسمید hsp68-LacZ-pA (تاکارا، ژاپن)  با استفاده از آنزیم­های برشی NheI و XhoI در پلاسمید pIRES2-EGFP  پس از پروموتور نستین قرار داده شد. بدین ترتیب که ابتدا پلاسمید hsp68-LacZ-pA در باکتری E.coli سویه DH5α در محیط کشت TSB حاوی کانامایسین (50 میکروگرم/ میلی­لیتر) تکثیر و سپس با استفاده از کیت تجاریAccuPrep  (بیونیر، کره جنوبی) خالص سازی شد. سپس برش نواحی دوطرف قطعه hsp68 با طول bp340  با استفاده از آنزیم­های برشی Xho1 و NheI  انجام و قطعه برش داده شده با استفاده از کیت استخرج از ژل  AccuPrep Gel Purification Kit(بیونیر، کره) خالص سازی شد. قطعه مورد نظر پس از برش وکتور pIRES2-EGFP با آنزیم‏های در محدوده 613-591 وکتور با استفاده از آنزیم T4 لیگاز جایگزین شد. نقشه ژنتیکی پلاسمید اصلاح شده pIRES2-EGFP در شکل 1 نشان داده شده است.

 

 

شکل 1: نقشه ژنتیکی پلاسمید اصلاح شده pIRES2-EGFP که ناحیه پروموتوری CMV در آن با توالی پروموتوری اینترون دوم نستین (آبی رنگ) و توالی تقویت‏کننده (Hsp68) جایگزین شد. ناحیه IRES بین ژن هدف (LIF) و پروتئین فلئورسنت EGFP امکان بیان مجزای دو ژن را فراهم می‏نماید. محل برش آنزیم‏های برشی در وکتور pIRES2-EGFP به‏منظور جایگزین نمودن قطعات پروموتوری نشان داده شده است.

 

 تکثیر ژن LIF

به‏منظور کلون سازی ژن LIF موش صحرایی به‏طول bp612
(عدد دسترسی بانک ژن:NM_022196.2) از روش RT-PCR
و سلول­های فیبروبلاست جنینی موشی صحرایی REF
(rat embryonic fibroblast) استفاده شد. بدین ترتیب که پس از تهیه سلول­های REF از مرکز ذخایر ژنتیک و زیستی ایران، استخراج RNA با استفاده از کیت تجاری RNXplus (سیناژن، ایران) انجام شد. سنتز cDNA با استفاده از کیت Accupower Rocketscript (بیونیر کره) و PCR با استفاده از کیت تجاریAccuPower PreMix  حاوی آنزیمDNA پلیمراز pfu انجام شد. توالی پرایمرهای مورد استفاده جهت تکثیر ژن LIF به‏ترتیب شامل شامل5'- AGTAAGGATCCATGAAGGTCTTGGCGGCAGG -3' و5'- CTAGAAGGCCTGGACCACCAGGATCTTCG -3' بودند. طراحی پرایمر با استفاده از نرم افزار Vector NTI Advance  (Thermo Fisher Scientific، آمریکا) انجام شد. پرایمرهای جلویی و عقبی بترتیب دارای  محل­های برش­های آنزیم­های  EcoRI وBamHI    بودند.

چرخه دمایی مورد استفاده در PCR شامل 35 چرخه واسرشتگی (94 درجه سانتی‏گراد، 1 دقیقه)، اتصال پرایمر (58 درجه سانتی‏گراد، 45 ثانیه) و تکثیر (72 درجه سانتی‏گراد، 1 دقیقه) بود. واسرشتگی اولیه (95‏ درجه سانتی‏گراد، 5 دقیقه) و تکثیر نهایی (72 درجه سانتی‏گراد، 5 دقیقه) هرکدام یک مرحله انجام شد. محصول PCR پس از خالص سازی از ژل با استفاده از کیت AccuPrep Gel Purification (بیونیر، کره جنوبی) تعیین توالی شد.

کلون سازی ژنLIF در پلاسمید اصلاح شده

به‏منظور کلونینگ ژن LIF، پلاسمید اصلاح شده pIRES2-EGFP پس از کشت و تخلیص با استفاده از کیت AccuPrep (بیونیر، کره جنوبی) با آنزیم­های BamHI و EcoRI مورد هضم آنزیمی قرار گرفت. محصول PCR ژن LIF نیز به‏منظور ایجاد انتهای چسبان با استفاده از آنزیم­های BamHI و EcoRI مورد هضم آنزیمی قرار گرفتند. سپس پلاسمید پس از الحاق ژن LIF به‏کمک آنزیم لیگاز T4 به سلول­های مستعد Ecoli سویه DH5α که با استفاده از روش کلرید کلسیم سرد و شوک حرارتی تهیه شده بودند، انتقال یافتند. سلول‏های ترانسفورم شده به‏منظور غربال‏گری کلون­های مثبت بر روی پلیت حاوی کانامایسین (50 میکرو گرم/ میلی‏لیتر) کشت داده شدند و کلون­های مثبت با استفاده از پرایمرهای عقبی و جلویی CMV شناسایی شدند.

تولید موش­های ترانس ژن به‏روش TMGT

به‏منظور تولید موش‌های ترانسژن از روش TMGT استفاده شد (10). 50 میکرو­گرم پلاسمید اصلاح شدهpIRES2-EGFP  پس از تکثیر و خالص سازی با استفاده از کیت AccuPrep (بیونیر، کره جنوبی) به نسبت 1:1 با معرف ترانسفکشن DOTAP (Life Science، آمریکا) آماده سازی و در محلول HBS استریل (20 میلی­مولار هیپس و 150 میلی­مولار کلرید سدیم) مخلوط و با استفاده از سرنگ همیلتون شماره 30 به‏صورت درون بیضه‏ای تزریق شد.

 

 

شکل 2: A: برش قطعه پروموتوری ECMV از وکتورpIRES2-EGFP  با استفاده از آنزیم­های AseI و NheI به‏منظور جایگزینی با نواحی پروموتوری جدید، باندی با طول تقریبی bp 600  ایجاد نمود. (1- مارکرHMW، 2- پلاسمید برش داده‌شده، 3- پلاسمید کامل) B: الکتروفورز محصول PCR قطعه پروموتوری اینترون 2 نستین با طول bp 637. C: الکتروفورز ناحیه پروموتوری جایگزین شده پروموتور ECMV پس از برش از وکتور pIRES2-EGFP با استفاده از آنزیم­های AseI و XhoI محصولی با طول Kb 1/1 تولید نمود. (1- مارکر HMW، 2- وکتور کامل، 3- وکتور برش داده‌ شده).

 

گروه بندی حیوانات

در این مطالعه از 9 سر موش صحرایی نر بالغ و 18 سر موش صحرایی ماده بالغ با وزن تقریبی 200 گرم استفاده شد. حیوانات به 3 گروه تقسیم شدند:

 گروه 1: تزریق 250 میکرولیتر پلاسمید حاوی LIF (25 میکروگرم در هر بیضه) به موش­های صحرایی نر (3 حیوان) و جفت­گیری با موش­های صحرایی ماده (6 حیوان) 24 ساعت پس از تزریق (گروه ترانسژن).

گروه 2: تزریق 250 میکرولیتر پلاسمید فاقد (25 میکروگرم در هر بیضه) LIF به موش­های نر (3 حیوان) و جفت­گیری با موش­های صحرایی ماده (6 حیوان)، 24 ساعت پس از تزریق (گروه کنترل پلاسمید).

گروه 3: تزریق 250 میکرولیتر بافر HBS استریل به‏همراه DOTAP به موش­های نر (3 حیوان) و جفت­گیری با موش­های صحرایی ماده (6 حیوان)، 24 ساعت پس از تزریق (گروه کنترل منفی).

قبل از انجام تزریقات، بی‏هوشی با استفاده از ترکیب کتامین/زایلازین انجام شد. سطح خارجی بیضه­ها با استفاده از اسکراپ جراحی و الکل استریل شد.20 روز پس از زایمان، نوزادان از مادرها جدا و تا روز 60 نگه‏داری شدند.

 

 

 

شکل 3: تصویر میکروسکوپ نوری رنگ آمیزی H&E (A) و فلورسنت (B) هیپوکامپ موش­های ترانس ژن شده با استفاده از پلاسمید pIRES2-EGFP تحت القا پروموتور نستین که نشان­دهنده بیان پروتئین EGFP در نواحی شکنج دندانه­دار (DG) و برخی نواحی شاخ آمون (CA1-CA4) هیپوکامپ می­باشد (×4).

 

نمونه­گیری از حیوانات و تایید زاده­های ترانسژن

به ‏منظور تایید مقدماتی زاده­های ترانسژن، پس از خون­گیری از دم و استخراج DNA با استفاده از کیت AccuPrep GenomicDNA Extraction (بیونیر، کره)، واکنش PCR به‏منظور تایید حضور قطعه 110 جفت بازی از بخشی از ناحیه پروموتوری وکتور و ژن LIF با استفاده از پرایمرهای جلویی 5'-CATCCAAACTGAGCAGCCGG-3' و عقبی 5'-CCAACAGCAGGGGCACAACT-3' انجام شد. در صورت ترانس ژن بودن حیوانات و وجود وکتور محصول PCR با طول 110 جفت بازی تولید می‏شود. 

زاده­های ترانسژن و گروه­های کنترل در سن 60 روزگی با استفاده از کلروفرم آسان­کشی شده و پس از برداشت جمجمه اقدام به خارج کردن کل بافت مغز گردید. نیمی از هر نیم کره جهت تهیه مقاطع بافتی و نیمی دیگر به‏منظور ارزیابی سطح بیان LIF با استفاده از Real time PCR مورد استفاده قرار گرفتند. کلیه اقدامات انجام شده در ارتباط با حیوانات آزمایشگاهی در این مطالعه بر اساس دستورالعمل نگه‏داری و تحقیق با حیوانات آزمایشگاهی مصوب NIH به شماره دسترسی23-86  انجام شد.

 ارزیابی بیان EGFP در مقاطع بافتی با روش میکروسکوپ فلورسانس

 به­منظور ارزیابی عملکرد سیستم پروموتور نستین، بیان پروتئین مارکر فلئورسنت EGFP در بخش­های مختلف مغز بررسی شد. حداقل10 زاده ترانس ژن و غیر ترانس ژن نر انتخاب و پس از آسان­ کشی مطابق روش توصیف شده توسط Mothe و همکاران (14)، اقدام به تهیه مقاطع بافتی از دو نیمکره مغز شد و مقاطع بافتی با استفاده از میکروسکوپ فلورسانس Olympus مدل IBX57 (ژاپن) مورد ارزیابی قرار گرفت.

 

 

شکل 4: مقادیر مقایسه­ای بیان ژن LIF در مقایسه با ژن GAPDH در سه گروه کنترل منفی، کنترل مثبت بدون پلاسمید و گروه ترانس ژن. حروف نامتشابه نشان‏دهنده اختلاف معنی‏دار در سطح 05/0P< می‏باشد.

 

 

استخراج RNA و سنتز cDNA

نمونه­های بافت هیپوکامپ از 5 موش در هر گروه ترانسژن، کنترل وکتور فاقد LIF و کنترل منفی فاقد پلاسمید دریافت شد. استخراج RNA با استفاده از کیت TriPure (Invitrogen، آمریکا) و مطابق دستورالعمل کیت انجام شد. تمام نمونه­های RNA به‏منظور حذف آلودگی با DNA با استفاده از آنزیم DNase (سیناکلون، ایران) تیمار و پس از قرائت جذب نمونه­های RNA در طول موج 260 و 280 با استفاده از دستگاه نانو دراپ (Ependorf، آلمان) نمونه­هایی که میزان جذب 280/260 آن­ها بالای 8/1 بود به‏منظور ساخت cDNA استفاده شدند. ساخت  cDNA با یک میکروگرم RNA و با استفاده از کیت Accupower Rocketscript (Bioneer، کره) و پرایمر اولیگو dT انجام شد.

 

 

شکل 5: مقطع بافتی هیپوکامپ موش صحرایی (×100H&E,). A: ناحیه چندشکلی شاخ آمون گروه ترانسژن. B: ناحیه مولکولار شکنج دندانه­دار گروه ترانسژن. C: ناحیه چندشکلی شاخ آمون گروه کنترل منفی فاقد LIF.D: ناحیه مولکولار شکنج دندانه­دار گروه گروه کنترل پلاسمید فاقد LIF. تعداد سلول­های اولیگودندروسیت (پیکان­های سفید) در هیپوکامپ موش­های ترانسژن نسبت به گروه کنترل پلاسمید به‏طور معنی‏داری بیشتر بود. پیکان­های مشکی نشان­دهنده سلول­های آستروسیت می­باشد  (×100H&E,).

 

ارزیابی بیان ژن LIF با آزمون PCR زمان حقیقی

به­منظور ارزیابی بیان ژن LIF درهیپوکامپ از آزمون PCR در زمان حقیقی، روش مقایسه‌ای CtΔΔ و دستگاه Lightcycler Detection System (Roche، امریکا) استفاده شد. روش آزمون بر پایه­ی کاربرد رنگ سایبرگرین کیت qPCRTM Green Master (Jena Biosciense، آلمان) استوار بود. در این مطالعه از ژن GAPDH به‏‌عنوان کالیبراتور استفاده شد. پرایمرهای جلویی و عقبی جهت تکثیر ژن LIF شامل5'- CATCCAAACTGAGCAGCCGG -3' و 5'- CCAACAGCAGGGGCACAACT -3' و جهت تکثیر ژن GAPDH شامل جلویی5'- AGTTCAACGGCACAGTCAAG -3' و عقبی 5'- TACTCAGCACCAGCATCACC -3'  بودند. طراحی پرایمرها با استفاده از نرم‌افزار Beacon desigsner TM V:7.01 (PREMIER Biosoft international,USA) انجام شد. واکنش­ها درحجم 5/12 میکرولیتر شامل 25/6 میکرولیتر مخلوط واکنش X2، 25/0 میکرولیتر از هر یک از پرایمرها با غلظت نهایی 200 نانومول، 3 میکرولیتر cDNA (100 نانوگرم) و 75/2 میکرولیتر آب تهیه شدند. چرخه دمایی شامل 95 درجه سانتی‏گراد به‏مدت 5 دقیقه، 45 سیکل شامل 94 درجه سانتی‏گراد به‏مدت 15 ثانیه، 60 درجه سانتی‏گراد به‏مدت 30 ثانیه بود. نمونه‌های کنترل منفی فاقد cDNA و نمونه RNA در هر واکنش در نظر گرفته ‌شد. واکنش­ها در 3 تکرار انجام شدند. آنالیز داده­ها با استفاده از نرم افزار Lightcycler  ارزیابی و بر اساس فرمول گزارش شد (15).

 

جدول 1: میانگین و انحراف معیار تعداد سلول­های اولیگودندروسیت در لایه­های مختلف هیپوکامپ در موش­های ترانس ژن، کنترل منفی LIF و گروه کنترل منفی فاقد پلاسمید. حروف نامتشابه در هر ردیف نشان­دهنده اختلاف آماری معنی‏دار در سطح (05/0>p) می‏باشد.

گروه کنترل منفی

گروه منفی

گروه ترانسژن شده

لایه­ها

 

3/2 ± 6/6b

5/2 ± 8/6b

6/3 ± 3/14a

چندشکلی – هرمی

شاخ آمون 1 (CA1)

5/1 ± 7/4b

8/1 ± 8/4b

4/2 ± 1/9a

مولکولار

1/3 ± 5/7b

7/3 ± 6/7b

7/3 ± 8/15a

چندشکلی – هرمی

شاخ آمون 2 (CA2)

0/2 ± 1/5b

8/1 ± 0/5 b

2/2 ± 3/8a

مولکولار

6/2 ± 1/6b

2/3 ± 3/6b

8/1 ± 6/8b

چندشکلی – هرمی

شاخ آمون 3 (CA3)

1/1 ± 4/4b

2/1 ± 1/5b

9/1 ± 3/6 b

مولکولار

9/1 ± 3/6b

4/1 ± 3/5b

6/2 ± 6/9 a

میانگین کل تعداد سلول­های لایه‌های شاخ آمون

0/1 ± 7/3b

8/1 ± 4/3b

3/1 ± 1/7a

هیلوس

5/1 ± 5/4b

9/1 ± 6/4 b

5/1 ± 0/9a

چندشکلی – هرمی

شکنج دندانه­دار

1/2 ± 6/4b

1/2 ± 5/4b

4/1 ± 3/7a

مولکولار

 

6/1 ± 4/4b

7/1 ± 3/4b

3/1 ± 1/8a

میانگین کل تعداد سلول­های لایه‌های شکنج دندانه دار

6/1 ± 6/4b

3/1 ± 5/4b

8/1 ± 6/7a

میانگین تعداد سلول مجموع لایه‌ها

جدول 2: میانگین و انحراف معیار ضخامت لایه­های هیپوکامپ در بین گروه­ ترانس ژن، گروه گروه کنترل پلاسمید و گروه کنترل منفی.

گروه کنترل منفی

گروه کنترل پلاسمید

گروه ترانسژن شده

لایه­ها

ضخامت لایه‌ها(میکرومتر)

7/14 ± 9/91

6/14 ± 5/92

9/25 ± 0/108

چندشکلی

شاخ آمون 1 (CA1)

0/6 ± 7/35

0/6 ± 7/34

4/11 ± 2/35

هرمی

7/62 ± 7/248

7/61 ± 2/249

3/40 ± 9/242

مولکولار

3/47 ± 2/179

0/49 ± 7/178

3/28 ± 7/195

چندشکلی

شاخ آمون 3 (CA3)

4/7 ± 8/54

7/6 ± 0/55

2/10 ± 8/55

هرمی

3/38 ± 6/533

3/38 ± 6/533

8/40 ± 6/601

مولکولار

0/21 ± 5/140

1/21 ± 9/139

9/33 ± 7/153

چندشکلی

شکنج دندانه­دار

8/2 ± 3/40

8/2 ± 6/40

0/10 ± 7/41

هرمی

4/2 ± 4/140

0/3 ± 7/141

0/23 ± 8/163

مولکولار

 

بررسی بافت‌شناسی هیپوکامپ با روش میکروسکوپ نوری

 در این مرحله از هر گروه تعداد 10 سر موش صحرایی نر 60  روزه انتخاب شده و نمونه‏گیری از مغز آن­ها صورت گرفت. نمونه‌ها به فرمالین 10 درصد انتقال داده شدند. سپس به‏روش معمول تهیه مقاطع بافتی قالب‏گیری انجام و برش‌های تهیه شده با ضخامت 5 تا 6 میکرومتر با روش هماتوکسیلین-ائوزین (H&E) رنگ­آمیزی شدند (16). در مطالعه‌ی میکروسکوپی ضخامت طبقات چندشکلی، هرمی و مولکولار در بزرگنمایی x10 و تعداد الیگودندروسیت­ها در بزرگنمایی ×100 (برای هر نمونه 5 اسلاید میکروسکوپی و در هر  اسلاید10 میدان میکروسکوپی) در بخش­های شاخ آمون‏، شکنج دندانه­دار و هیلوس اندازه‌گیری و شمارش شدند. در این مرحله از  نرم­افزار Dino­capture  و عدسی Dino-Eye Microscope AM-423X (ANMO، تایوان) استفاده شد.

آنالیز آماری

به­منظور آنالیز آماری داده‌ها از نسخه­ی شانزدهم نرم‌افزارSPSS  و آزمون آماری student t استفاده شد. نتایج بر اساس میانگین ± انحراف معیار گزارش شدند. سطح معنی‏داری تست­ها 05/0p< در نظر گرفته شد.

نتایج

ارزیابی جایگزینی قطعات پروموتوری نستین و Hsp68 در پلاسمید pIRES2-EGFP

در این مطالعه به­منظور جایگزینی قطعه پروموتوری ECMV وکتور pIRES2-EGFP ابتدا قطعه bp 600 مربوط به پروموتور ECMV با استفاده از آنزیم­های AseI و NheI از پلاسمید برش داده شد (شکل –A2). سپس قطعه پروموتوری اینترون 2 نستین با طول bp 637  با استفاده از PCR و پرایمرهای دارای ناحیه برش AseI و NheI  تکثیر (شکل –B2) و در پلاسمید برش ­یافته با آنزیم­های AseI و NheI الحاق شد. به‏منظور الحاق ناحیه تشدید‏کننده hsp68، این ناحیه به طول bp340 پس از برش وکتور hsp68-LacZ-pA  با آنزیم­های Xho1 و NheI در ناحیه پایین دست قطعه پروموتوری نستین 2 از وکتور pIRES2-EGFP که با همین آنزیم­ها برش داده شده بود الحاق شد. طول قطعه پروموتوری جایگزین شده در وکتور bp977 بود که به‏منظور تایید جایگزینی این قطعه نواحی دو طرف پروموتور با آنزیم­های AseI و XhoI برش داده شد. در الکتروفورز باند تقریبی kb1 مشاهده شد (شکل -C2) که نشان­دهنده صحت طول پروموتور الحاقی بود.

نتایج کلونینگ LIF در وکتور اصلاح شده

به­منظور کلونینگ ژن LIF در پلاسمید اصلاح شده، اقدام به تکثیر ژن LIF با استفاده از PCR و آنزیم Pfu  پلیمراز از سلول‏های MEF شد. سپس قطعه تکثیر شده با PCR به‏طول bp612 در  پلاسمید اصلاح شده الحاق و به سلول­های پذیرایی E.coli سویه BL21(DE3) منتقل شد. از مجموع کلون­های رشد یافته بر روی محیط کشت حاوی کانامایسین دارای پلاسمید pIRES2-EGFP حاوی ژن LIF، درمجموع 3 کلون انتخاب شد. انتخاب کلون­های مذکور بر اساس انجام PCR  با استفاده از پرایمرهای اختصاصی LIF بر روی کلون­های رشد یافته بر روی محیط حاوی کانامایسین بود. بر این اساس ازآنجاکه طول ژن LIF bp 612 بود به‏دلیل قطعات حاوی محل برش آنزیم‏ها در زمان PCR یک قطعه با طول تقریبی bp 650 تولید شد. صحت توالی­های به‌دست‌آمده پس از تعیین توالی به‏صورت خوانش از دو طرف، با استفاده از نرم افزار nBLAST و مقایسه با توالی LIF موجود در بانک ژن با عدد دسترسی NM_022196.2 تائید شد.

تایید زاده­های ترانس ژن

به­منظور تایید زاده­های ترانس ژن، نمونه­های جداشده از هیپوکامپ موش­های صحرایی 40 روزه با استفاده از PCR و میکروسکوپ فلورسانس ارزیابی شدند. نتایج حاصل نشان‌دهنده 60 درصد ترانس ژنی در زاده‌های نسل اول بود. PCR بر نمونه‌های بافتی گروه مثبت حاوی پلاسمید و ژن LIF، محصولی با طول bp 180 مربوط به قطعه‌ای از ژن LIF به همراه بخشی از پروموتور Hsp68 در 60 درصد زاده‌ها را نشان داد. در نمونه‌های غیر ترانس ژن و نمونه‌های گروه منفی و  نمونه گروه کنترل منفی محصولی تولید نشد.

ارزیابی مقاطع بافتی با استفاده از میکروسکوپ فلورسانس نشان داد که پروتئین EGFP در نواحی تحت بطنی و شکنج دندانه‌دار هیپوکامپ که محل تجمع سلول‌های بنیادی می­باشد بیان می­شود (شکل 3). با توجه به عدم بیان EGFP در سایر بخش‌ها و نیز با توجه به ساختار وکتور که حاوی پروموتور نستین می‌باشد، القا بیان ژن‌ EGFP در این نواحی و فعال بودن پروموتور نستین در سلول‌های بنیادی تایید شد.

تغییرات بیان ژن LIF

شکل 4 تغییرات بیان نسبی ژن LIF در مقایسه با بیان ژن GAPDH در گروه‌های مختلف را نشان می‌دهد. میزان بیان ژن LIF در گروه ترانسژنیک 8 برابر گروه‏های کنترل منفی بود.

نتایج هیستومتری نمونه­ها

در ارزیابی هیستومتری نواحی CA1، CA2، CA3 وCA4 شاخ آمون و شکنج دندانه­دار از نظر تعداد سلول­های اولیگودندروسیتی و نیز ضخامت لایه های چندشکلی، هرمی و مولکولار مورد ارزیابی قرار گرفتند. بررسی آماری نتایج حاصل از شمارش الیگودندروسیت در نواحی مختلف هیپوکامپ افزایش معنی­دار تعداد این سلول­ها در نواحی CA1 و CA2 شاخ آمون در گروه ترانس­ژن شده را نسبت به گروه کنترل منفی فاقد LIF و گروه کنترل منفی فاقد پلاسمید نشان داد (05/0>p) (جدول1). در ناحیه CA3 شاخ آمون اختلاف معنی‏داری در تعداد سلول­های اولیگودندروسیت بین سه گروه مشاهده نشد (05/0p>) (جدول 2). صرفنظر از نوع لایه­های هیپوکامپ، مجموع سلول‏های شمارش شده در شاخ آمون هیپوکامپ در گروه ترانسژن به‏طور معنی­داری بیشتر از دو گروه کنترل منفی بود (شکل 5).

تعداد سلول­های اولیگودندروسیتی در لایه­های چندشکلی- هرمی ومولکولار شکنج دندانه­دار هیپوکامپ در گروه ترانس ژن به‏طور معنی‏داری بیشتر از گروه­های کنترل بود (05/0>p) (جدول1). در مجموع تعداد سلول­های اولیگودندروسیتی در لایه­های مختلف هیپوکامپ موش­های ترانس ژن بطور معنی‏داری بالاتر از تعداد سلول­های هیپوکامپ در موش­های گروه­های کنترل بود (05/0>p) (جدول2).

 نتایج ارزیابی ضخامت لایه­های مختلف هیپوکامپ

در بررسی نتایج حاصل از اندازه­گیری ضخامت هر کدام از لایه­ها اختلاف معنی­داری بین ضخامت لایه­های هیپوکامپ در بین گروه­های مثبت ترانسژن شده، گروه منفی و گروه کنترل منفی مشاهده نشد (جدول 2).

بحث

در مطالعه حاضر بمنظور ارزیابی تاثیر بیان بالای فاکتور مهارکننده لوسمی ‌بر جمعیت سلول‌های اولیگودندروسیت در هیپوکامپ از مدل موش صحرایی ترانس ژن تولیدشده با روش TMGT استفاده شد. در این مدل بیان بالای فاکتور مهارکننده لوسمی تحت عملکرد پروموتور نستین و عامل تشدید‏کننده hsp68 القا شد. در مطالعه حاضر بیان ژن LIF در بافت هیپوکامپ موش‌های ترانس ژن نسبت به گروه‌های کنترل فاقد وکتور و کنترل فاقد LIF  افزایش یافت. در مطالعات محدود انجام‌شده به‌منظور ارزیابی بیان بالای LIF در مغز و تاثیر آن بر جمعیت و شاخص‌های مولکولی سلول‌های بنیادی، محدودیت‌هایی وجود داشته است که در مدل طراحی‌شده در مطالعه حاضر رفع شده است. نخست اینکه در مطالعه Deverman و Patterson (7)، از تزریق مستقیم LIF در بطن‌ها استفاده‌ شده است که به‏دلیل پاک‌سازی سریع پروتئین‌های خارجی، توزیع نامتناجس آن‌ها در مغز پس از ورود به بطن‌ها و نیز عدم امکان تعیین میزان جذب، ارزیابی اثرات تزریق درون مغزی  LIF به‌منظور توسعه کاربرد بالینی آن را امکان‌پذیر نمی‌سازد. همچنین روش تزریق درون بطنی و امکان برداشت LIF اگزوژن توسط سلول‌های غیر هدف محدودیت مهمی در کاربرد این روش در شرایط بالینی می‌باشد. در مطالعه Bauer و Patterson (6) از وکتور آدنوویروسی تحت کنترل پروموتور آنسفالومیوکاردیت استفاده شده است. مهم‌ترین محدودیت‌های این روش القا بیان ژن LIF در تمام سلول‌های آلوده با وکتور آدنوویروسی است چرا که پروموتور ECMV در تمام سلول‌های پستانداران قابلیت القا را دارد. دیگر این­که در این روش عموما سلول‌های اپاندیمال در حاشیه خارجی بطن‌ها آلوده می‌شوند که همه آن‌ها خاصیت بنیادی ندارند لذا بروز اثرات بیان بالای LIF در سلول‌های بنیادی به‌صورت متغیر ظاهر شده است (6). در مطالعه حاضر با الحاق پروموتور اینترون نستین و ناحیه تشدیدگر hsp68 محدودیت‏های فوق در خصوص کنترل بیان وکتور درسلول های بنیادی عصبی رفع شد.

القا تکثیر سلول‌های عصبی یا سلول‌های نیایی و یا پیوند آن‌ها برای جایگزینی سلول‌هایی که در صدمات یا بیماری‌ها از دست ‌رفته‌اند، امید تازه‌ای به‌منظور درمان اختلالات عصبی ایجاد کرده است (17). تزریق مستقیم یا بیان بالای فاکتورهای رشد عصبی (نوروتروف) یکی از بهترین این راه‏کارها می‏باشد. تزریق مستقیم فاکتورهای رشد مانند فاکتور پایه رشد فیبروبلاستی و عامل رشد اپیدرمی ‌به درون بطن‌ها در حیوانات آزمایشگاهی منجر به گسترش جمعیت سلول‌های پیش ساز ناحیه زیر بطنی تولید نورون‌ها و آستروسیت­ها شده است. همچنین تزریق فاکتور رشد ترانسفورم‏کننده آلفا در حیواناتی که سیستم دوپامین آن‌ها آسیب‌دیده بود منجر به تکثیر سلول‌های بنیادی در بخش جلویی حفره قدامی‌مغز و به‏دنبال آن مهاجرت سلول‌های پیش ساز عصبی و گلیال شده است. با این‌حال در تمام این روش‌ها ترمیم موقت و غیر تجدید شونده مانع از باز یافت عملکرد کامل سیستم عصبی آسیب‌دیده شده است. همچنین نیاز به انجام تزریقات پیاپی انجام بالینی چنین روش درمانی را با  محدودیت روبه‏رو می‌سازد (17 و 18).

در مطالعه حاضر بیان پروتئین EGFP در ناحیه شیار دندانه‌دار با استفاده از میکروسکوپ فلورسانس تائید شد درحالی‌که در گروه‌های کنترل، پروتئین EGFP بیان نشد. مطالعات موجود نشان داده است که سلول‌های بنیادی نیایی عصبی در سه ناحیه شامل ناحیه تحت بطنی بطن­های جانبی، شکنج دندانه­دار هیپوکامپ، باقی­مانده بخش نورواپی‏تلیوم دوره جنینی متمرکز هستند (19). تمایز این سلول‌ها به سلول‌های پیش ساز سبب کاهش خاصیت چند قوه­زایی آن‌ها توام با خاموش شدن ژن‌های شاخص چند قوه­زایی و تعهد آن‌ها به تمایز به یک نوع رده سلولی شامل نورون و سلول‌های گلیال (آستروسیت­ها و اولیگودندروسیت­ها) می‌شوند (20). تحقیقات اخیر نشان می‌دهد که سلول‌های موجود در نواحی تحت بطنی دارای توان تکثیر سریع بوده (نوع C) و عموما پس از تکثیر به نورون‌ها تمایز یافته و به ناحیه لوب بویایی مهاجرت می‌کنند درحالی‏‌که سلول‌های بنیادی موجود در هیپوکامپ عموما دارای توان تکثیر آهسته بوده (نوع B) و پس از تمایز به سلول‌های گلیال به‌ویژه اولیگودندروسیت­ها تبدیل و به نواحی مجاور مغز به‌ویژه جسم پینه‌ای که حاوی بیشترین فعالیت میلین‏زایی در مغز می‌باشد مهاجرت می‌کنند. افزایش بیان ژن LIF توام با بیان پروتئین EGFP در شیار دندانه‌دار هیپوکامپ در این مطالعه با نتایج Kawaguchi و همکاران (12)، مبنی بر تمرکز سلول‌های بنیادی نیایی در این ناحیه همخوانی دارد. بیان پروتئین EGFP در بخش‌هایی از هیپوکامپ ونیز بیان بالای LIF در هیپوکامپ موش­های ترانس ژن، می‌تواند نشان‌دهنده بیان نستین و القا پروموتور آن در سلول‌های بنیادی پیش ساز باشد که در برخی بخش‌های هیپوکامپ توزیع شده‌اند.

نتایج حاصل از این مطالعه نشان داد که تعداد سلول‌های اولیگودندروسیت در نورون‌های هرمی، مولکولار و چندشکلی بخش‌های  CA1 و CA2 شاخ آمون و شیار دندانه‌دار هیپوکامپ در موش‌های ترانس ژن با بیان بالای LIF نسبت به موش‌های کنترل افزایش یافت. درحالی‌که ضخامت لایه‌های نورونی در بخش‌های مختلف هیپوکامپ موش‌های ترانس ژن و غیر ترانس ژن تفاوت نداشتند. این یافته افزایش تمایز سلول‌های نیایی بنیادی به سلول‌های پیش ساز در مدل طراحی‌شده در این مطالعه را تائید می‌نماید. نتایج مطالعات موجود در شرایط آزمایشگاهی و مدل‌های حیوانی تجربی اطلاعات متناقضی در خصوص تاثیر LIF بر تکثیر و تمایز سلول‌های بنیادی نشان می‌دهد که احتمالا مربوط به متغیرهایی چون نحوه تجویز و دوز LIF‏، نوع سلول‌های هدف که LIF در آن‌ها بیان می‌شود و یا فعال شدن مسیرهای انتقال سیگنال متفاوت می‌باشد (6، 7و 5).

Zhao و همکاران (5) نشان داده‌اند که علی‌رغم تشدید تکثیر متقارن سلول‌های بنیادی عصبی و نیز تمایز آن‌ها به سلول‌های بنیادی پیش ساز گلیال در حضور LIF، میزان تمایز این سلول‌ها به بافت‌های مزودرمی‌و اندودرمی‌خارج رویانی مهار می‌شود. در مطالعه حاضر افزایش تکثیر سلول‌های اولیگودندروسیت در هیپوکامپ نشان‌دهنده کارکرد مسیرهایی است که ضمن افزایش توان خودنوزایی سلول‌های بنیادی نیایی، تمایز آن‌ها به رده‌های گلیال را تشدید نموده است. این یافته با نتایج Zhao و همکاران (5) مطابقت دارد. مطابق با نتایج این مطالعه، Mayer و همکاران (20) نشان داده‌اند که کاربرد LIF نوترکیب در محیط کشت عصاره بافتی هیپوکامپ سبب افزایش تعداد اولیگودندروسیت­های بالغ می‌شود که این تغییرات توام با افزایش میزان تولید میلین در محیط کشت بوده است (21). Deverman و همکاران (7) نشان داده‌اند که 3 تا 5 هفته پس از تزریق پلاسمید آدنوویروسی حاوی LIF تعداد سلول‌های پیش ساز اولیگودندروسیتی در نواحی اطراف بطن افزایش یافته است. با توجه به این که در مطالعه Deverman و همکاران (7) عموما سلول‌های اپاندیمال جدار بطن پس از تزریق پلاسمید آلوده شده‌اند تغییرات جمعیت سلول‌های پیش ساز  تنها در نواحی مجاور بطن‌ها مشاهده است. نتایج حاصل از مطالعه حاضر نشان داد که القای بیان بالای LIF به‌صورت اختصاصی در سلول‌های نستین مثبت سبب گسترش جمعیت سلول‌های اولیگودندروسیت در بخش‌های مختلف هیپوکامپ می‌شود (7).

نتیجه‏گیری

درمجموع نتایج این تحقیق نشان داد که می­توان از وکتورهای القایی تحت پروموتور نستین به‏طور موفقیت آمیزی در تولید حیوانات ترانسژن با بیان اختصاصی فاکتورهای نوروتروف در سلول­های بنیادی استفاده نمود. بیان بالای LIF در موش­های ترانسژن در نواحی از هیپوکامپ که محل تجمع سلول­های بنیادی نیایی و سلول­های پیش ساز رده‏های مختلف سلولی می‏باشد سبب افزایش تعداد سلول­های میلین ساز اولیگودندروسیت در هیپوکامپ می‏شود.  نتایج این تحقیق تاییدی بر امکان کاربرد پروتئین LIF در درمان ضایعات حاصل از کاهش یا آسیب سلول‏های اولیگودندروسیت می‏باشد. با این‏حال مطالعات بیشتری در این زمینه ضروری می‏باشد.

تشکر و قدر دانی

نویسندگان این مقاله از معاونت پژوهشی دانشگاه شهید چمران اهواز به‏دلیل تامین هزینه های طرح تقدیر و تشکر می‏نمایند.

  1. Ben-Hur T, Ben-Menachem O, Furer V, Einstein O, et al. Effects of proinflammatory cytokines on the growth, fate, and motility of multipotential neural precursor cells. Mol Cell Neurosci. 2003; 24(3): 623–631.
  2. Trouillas  V, Saucourt  C, Guillotin B, Gauthereau X, et al. The LIF cytokine: towards adulthood. Eur Cytokine Netw J.1993; 20(2): 51–62.
  3. Nasef A, Mazurier C, Bouchet S. Leukemia inhibitory factor: role in human mesenchymal stem cells mediated immunosuppression. J Cell Immunol.2008; 253(1-2): 16-22.
  4. Xavier G, Nadine T, Vincent P, Pierre T, et al. LIF-dependent signaling: New pieces in the lego. Stem Cell Rev Rep. 2012; 8(1):1–15.
  5. Zhao HE, Jing-Jing LI, Zhen CC, Feng LY, et al. Effect of leukemia inhibitory factor on embryonic stem cell differentiation: implications for supporting neuronal differentiation. Acta Pharmacol Sin. 2006; 27(1): 80–90.
  6. Bauer S, Patterson PH. Leukemia inhibitory factor promotes neural stem cell self-renewal in the adult brain. J Neurosci. 2006; 26(46): 12089 –12099.
  7. Deverman BE, Patterson PH. Exogenous leukemia inhibitory factor stimulates oligodendrocyte progenitor cell proliferation and enhances hippocampal remyelination. J  Neurosci. 2012; 32(6): 2100 –2109.
  8. Kubota Y, Hirashima M, Kishi K, Stewart CL, Suda T Leukemia inhibitory factor regulates microvessel density by modulating oxygen-dependent VEGF expression in mice. J Clin Investig. 2008; 118:2393-2403.
  9. Miller RH. The promise of stem cells for neural repair. Brain Res. 2006; 1091(1): 258-64.

10. Chang KT, Ikeda A, Katsuhiko H, Yasufumi F, et al. Production of transgenic rats and mice by the testis-mediated gene transfer. J Reprod Dev. 1999; 45(1): 29-36.

11. Lothian Cl, Lendahl U. An evolutionarily conserved region in the second intron of the human nestin gene directs gene expression to CNS progenitor cells and to early neural crest cells. Eur J Neurosci. 1997; 9(3):452-62.

12. Kawaguchi A, Miyata T, Sawamoto K, Takashita K, et al.  Nestin-EGFP transgenic mice: visualization of the self-renewal and multipotency of CNS stem cells. Mol Cell Neurosci. 2001; 17(2): 259–273.

13. Pennacchio LA, Ahituv N, Moses AM, Prabhakar S, et al. In vivo enhancer analysis of human conserved non-coding sequences. Nature. 2006; 444(7118): 499-502.

14. Mothe AJ, Kulbatski I, Bendegem RLV, Lee L, et al.  Analysis of green fluorescent protein expression in transgenic rats for tracking transplanted neural stem/progenitor cells. J Histochem Cytochem. 2005; 53(10): 1215.

15. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001; 29(9): e45.

16. Bancroft JD, Gamble M. Theory and practice of histological techniques. 5rd ed, Edinburgh, Chuchill Livingstone.2002: 85-107.

17. Muller FJ, Snyder EY, Loring JF. Opinion: Gene therapy: can neural stem cells deliver? Nature Rev. 2006; 7(1):75-84.

18. Paspala S, Murthy T, Mahaboob V, Habeeb M.  Pluripotent stem cells A review of the current status in neural regeneration. J Neuro India. 2011; 59(4): 558–65.

19. Alenzi  F, Bahkali A. Stem cells: Biology and clinical potential. Afr J Biotech. 2011; 10(86): 19929–40.

20. Mayer M, Bhakoo K, Noble M. Ciliary neurotrophic factor and leukemia inhibitory factor promote the generation, maturation and survival of oligodendrocytes in vitro. Development. 19941; 20(1): 143–153.

21. Marriott MP, Emery B, Cate HS, Binder MD, et al. Leukemia inhibitory factor signaling modulates both central nervous system demyelination and myelin repair. Glia J. 2008; 56(6): 686–698.